Cancer Research CR Helping Patients  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ichimura, K.
Right arrow Articles by Collins, V. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ichimura, K.
Right arrow Articles by Collins, V. P.
[Cancer Research 60, 417-424, January 15, 2000]
© 2000 American Association for Cancer Research


Molecular Biology and Genetics

Deregulation of the p14ARF/MDM2/p53 Pathway Is a Prerequisite for Human Astrocytic Gliomas with G1-S Transition Control Gene Abnormalities1

Koichi Ichimura, Maria Bondesson Bolin2, Helena M. Goike, Esther E. Schmidt, Ahmad Moshref and V. Peter Collins3

Department of Pathology, Division of Molecular Histopathology, University of Cambridge, Addenbrooke’s Hospital, Cambridge CB2 2QQ, United Kingdom [K. I., E. E. S., V. P. C], and Ludwig Institute for Cancer Research and Unit of Tumorpathology, Department of Oncology and Pathology, Karolinska Hospital, 171 76 Stockholm, Sweden [K. I., M. B. B., H. M. G., E. E. S., A. M., V. P. C.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Deregulation of G1-S transition control in cell cycle is one of the important mechanisms in the development of human tumors including astrocytic gliomas. We have previously reported that approximately two-thirds of glioblastomas (GBs) had abnormalities of G1-S transition control either by mutation/homozygous deletion of RB1 or CDKN2A (p16INK4A), or amplification of CDK4 (K. Ichimura et al., Oncogene, 13: 1065–1072, 1996). However, abnormalities of G1-S transition control genes may induce p53-dependent apoptosis in cells. Recent investigations suggest that p14ARF is induced in response to abnormal cell cycle entry and results in p53 accumulation by inhibiting MDM2-mediated transactivational silencing and degradation of p53. To investigate the roles of the G1-S transition control system and the p14ARF/MDM2/p53 pathway in the development of astrocytic gliomas, we examined abnormalities of genes involved in these regulatory pathways in a total of 190 primary human astrocytic gliomas of different malignancy grades [136 GBs, 39 anaplastic astrocytomas (AAs) and 15 astrocytomas (As)]. Sixty-seven percent of GBs (91/136) and 21% of AAs (8/39) had abnormalities of the G1-S control system either by mutation/homozygous deletion of RB1, CDKN2A or CDKN2B, or amplification of CDK4. Seventy-six percent of GBs (103 of 136), 72% of AAs (28 of 39), and 67% of As (10 of 15) had deregulated p53 pathway either by mutation of TP53, amplification of MDM2, or homozygous deletion/mutation of p14ARF. When all of the data were combined and compared, 96% of GBs (87 of 91) and 88% of AAs (7 of 8) with abnormal G1-S transition control also had deregulated p53 pathway. Thus, we demonstrate that deregulation of the G1-S transition control system was almost always accompanied by inactivation of the p53 pathway, clearly illustrating the cooperative roles of these two systems in the development/progression of primary human astrocytic gliomas.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Frequent alterations of genes coding for proteins involved in G1-S transition control have been reported in GBs,4 the most malignant form of brain tumor in adults (1, 2, 3, 4) . Almost mutually exclusive involvement of RB1/CDK4/CDKN2A(p16INK4A) has been reported in more than 60% of these tumors (5) . The proteins coded by these genes all directly or indirectly control the phosphorylation of pRB and the release of the E2F1 transcription factor (reviewed in Ref. 6 , 7 ). GBs [malignancy grade IV according to the WHO classification (8) ] may arise de novo but also by progression from astrocytic tumors of a lower malignancy grade, such as the AA (malignancy grade III) and A [malignancy grade II (9) ].

There are several lines of evidence to indicate that deregulation of G1-S transition control alone may be detrimental for cell survival: (a) transfection of rodent cells with the adenoviral E1A and E1B genes resulted in transformation due to the viral proteins binding to and inactivating pRB and p53. Transfection with E1A alone induced p53 dependent apoptosis (10) ; (b) when E2F1 was ectopically expressed in rodent embryo fibroblasts, although the cell indeed entered S phase (11) , apoptosis was induced in a p53-dependent manner (12) ; (c) loss of pRB function leads to inappropriate progression through S phase and induces apoptosis in developing mouse lens fiber cells, which can be overcome by simultaneous loss of p53 (13) or E2F1 (14) . This evidence suggests that, at least in some cell types, p53 prevents cells with deregulated G1-S control from abnormal proliferation by inducing apoptosis.

p53 is a key regulator of cell cycle checkpoints. p53 binds to DNA in a sequence-specific manner and functions as a transcription factor. It induces either G1 arrest or apoptosis in response to various forms of cell stresses (reviewed in Ref. 15 ). Expression of the p53 protein is mainly regulated posttranscriptionally and maintained at a very low level in normal cells. MDM2 is an important regulator of p53. MDM2 binds to p53 and inhibits its function by concealing the activation domain of p53 (16 , 17) and by promoting degradation of p53, most likely through the ubiquitin-proteasome pathway (18 , 19) . In response to DNA damage, the MDM2 binding site of p53 is phosphorylated, the p53-MDM2 interaction is attenuated and p53 accumulates rapidly, relieved from MDM2-mediated suppression (reviewed in Ref. 20 ). MDM2 is also one of the transcriptional targets of p53 (21) .

Recent investigations have identified another important regulator in this pathway, p14ARF (human homologue of mouse p19ARF). The p14ARF protein is encoded by the CDKN2A/INK4A locus but is distinct from the p16INK4A protein (22) . p14ARF is encoded by the unique exon 1ß (E1ß) and exon 2 and 3 of p16INK4A, using an alternative reading frame. E1ß is located between exon 1{alpha} of CDKN2A (E1{alpha}) and exon 2 of CDKN2B on 9p21 (23 , 24) . It has been shown that the p14ARF protein binds to the p53/MDM2 complex and inhibits MDM2-mediated degradation of p53, which indicates that p14ARF is an upstream regulator of p53 via MDM2 (25, 26, 27, 28) . There is also evidence suggesting that p53 down-regulates expression of p14ARF, which would establish an autoregulatory feedback loop between p53, MDM2, and p14ARF (29) . The most striking finding is that E2F1 transcriptionally up-regulates expression of p14ARF (29 , 30) . It has been shown that in p19ARF null mouse embryonic fibroblasts, accumulation of p53 and induction of apoptosis after introduction of E1A was attenuated (31) . Thus, p14ARF seems to be a critical component in the scrutiny of proliferation signals by the p53 system (32) .

These findings prompted us to determine the status of genes involved in G1-S transition control and the p14ARF/MDM2/p53 pathway in a large series of astrocytic gliomas. We found that almost all astrocytic gliomas with altered G1-S transition control genes also had abnormalities of the p14ARF/MDM2/p53 pathway genes. Our findings indicated that disruption of the p53 pathway is virtually obligatory for these tumors with G1-S transition control gene abnormality.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor Materials.
Fresh surgical specimens from patients’ tumors were dissected into several macroscopically homogeneous pieces and stored at -135°C for up to 5 years before DNA/RNA extraction. A portion of each frozen tumor piece was histologically examined for diagnosis and evaluation of the tumor cell content. Three tumors (AA17, AA59, and A26) had an estimated tumor cell content of 60%. All of the others had a minimum of 70% and generally more than 90% of tumor cells. Each patient’s blood was collected before surgery and stored at -20°C before DNA extraction. The study was approved by the ethics committee of the Karolinska Hospital.

A total of 190 astrocytic gliomas were included in the present investigation. All of the tumors had been used in previous studies (1, 2, 3 , 5 , 33 , 34) . The histopathological diagnosis was carried out strictly according to the WHO classification (8) . All of the cases collected before publication of the second edition of WHO classification (8) were reviewed in detail and reclassified. A new tumor number with the appropriate prefix representing the diagnosis (GB, AA, or A) was assigned to each reclassified case. All of the diagnoses are based on the histopathology of the case, not the tumor piece, although the pieces chosen are representative for each case.

Allelic Assessment.
Allelic assessment of RB1, CDK4, CDKN2A, CDKN2B, and MDM2 was done by densitometry on Southern hybridization using a PhosphorImager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). DNA/RNA extraction, probes, Southern blotting, hybridization and PhosphorImager analysis have been described previously (1, 2, 3 , 5 , 35) . A probe for E1ß of p14ARF was generated by PCR using primer pair PC978 (CGAGTGAGGGTTTTCGTGGTTC, forward) and PC977 (CGTTGTAACCCGAATGG-GAAGC, reverse), which amplify a genomic segment containing a 3' portion (138 bp) of E1ß and part of intron 1ß (145 bp). The primer sequences were chosen based on the published genomic sequence around E1ß (23) . STS markers WI-3306 or WI-7427 were used as control probes for allelic assessment of p14ARF. WI-3306 is located on 2q close to D2S121, D2S112 and D2S44 and WI-7427 is located on 21q between D21S1257 and D21S270. [Chromosome 2 workshop Consensus Map, GDB: 4225469; An STS-Based Map of the Human Genome, Data Files Release 12 (36) ]. For each tumor, the allelic status on 2q and 21q was determined by RFLP analysis with D2S44 or microsatellite analysis with D2S121, D2S112, D21S1257, and D21S270 (data not shown). A control locus from a chromosomal region that did not have allelic imbalance was chosen for each case. To assess allelic numbers at E1ß of p14ARF, densitometry on TaqI digested Southern blotting was carried out. The signal intensity of the bands corresponding to p14ARF and the control locus in tumor and control DNA was measured using the ImageQuant, version 3.3, software (Molecular Dynamics, Sunnyvale, CA). The number of alleles at p14ARF was determined by the following formula:

where T = tumor DNA and N = control normal DNA.

Mutation Analysis of CDKN2B and p14ARF.
Mutation of exon 1 and exon 2 of CDKN2B was examined by direct sequencing of PCR amplified products as described (3) . Mutation of E1ß of p14ARF was analyzed by direct sequencing of the PCR products that covered the entire coding region (PC1340: TGCAGTTAAGGGGGCAGGAG, forward; and PC1343: TTATCTCCTCCTCCTCCTAG-CCTG, reverse; putative start codon was according to Refs. 25 and 30 ). The PCR products were directly sequenced using the same set of primers using the ABI PRISM BigDye Terminator Cycle Sequencing Kit (PE Biosystems, Foster City, CA) on an ABI PRISM 373aXL and a 377 DNA Sequencer (PE Biosystems). Mutation in exon 2 of p14ARF was assessed by reevaluating the previously analyzed sequences of exon 2 of CDKN2A in the same tumor series (3 , 5) . Any nucleotide changes in exon 2 of CDKN2A that can cause amino acid changes in the p14ARF protein were documented.

DGGE Analysis of the TP53 Gene.
Mutation of the TP53 gene (the gene encoding the p53 protein) was analyzed using DGGE. The entire coding region of TP53 as well as intron sequences adjacent to exons (minimum of six bases) were covered by the analysis with the primer pairs listed in Table 1Citation . A stretch of a GC-rich sequence (GC-clamp) was attached to one of the primers for each pair as indicated (Table 1)Citation . Primers for exons 5–8 are modified from Hamelin et al. (37) . The details of DGGE conditions and the strategy of DGGE analysis will be presented elsewhere.5 Paired DNA from tumors and patients’ blood were aligned in 96-well microtiter plates at a concentration of 10 ng/µl. Thirty to 50 ng of DNA were used as PCR templates. A heteroduplex of tumor and blood PCR products was prepared for each sample to increase the sensitivity of analysis. The heteroduplex was made by mixing an equal volume of PCR products from tumor and blood, denaturing at 94°C for 15 min, incubating at 65°C for 1 h and then at room temperature for 3 h. Thirty-four µl of the heteroduplex was mixed with 10 µl of loading buffer (0.25% bromo-phenol-blue, 0.25% xylene cyanol, and 30% glycerol). The D GENE system (Bio-Rad, Hercules, CA) was used to perform DGGE. An appropriate amount of urea and formamide was mixed with 6.5% acrylamide and cast according to the manufacturer’s recommendation. Gels were run at 60°C at 160V for an optimal length of time for each primer pair. The gels were then stained with SYBR green I (FMC, Rockland, ME) and digitally documented by an EagleEye II system (Stratagene, La Jolla, CA). When an abnormal shift was detected, the corresponding exon was amplified from both tumor DNAand the patient’s blood DNA and directly sequenced to confirm the presence of a somatic mutation. DNA sequencing was performed using the ABI PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit (PE Applied Biosystems) on an ABI PRISM 373 DNA Sequencer (PE Applied Biosystems) as described previously (3) .


View this table:
[in this window]
[in a new window]

 
Table 1 Primers for DGGE analysis of TP53 mutation

 
Statistical Analysis.
A {chi}2 test was used to statistically evaluate an association between various genetic abnormalities and to compare the incidences of abnormalities among different malignancy grades. When the expected frequency was less than five in any category, a Fisher’s exact test was applied instead.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
G1-S Transition Control Genes.
We have previously reported the status of the following G1-S transition control genes, CDKN2A/p16INK4A, CDK4, and RB1, for all of the tumors in the series (1, 2, 3 , 5) . In addition, homozygous deletion and mutation of CDKN2B/p15INK4B were determined for all of the cases in the present study.

The cumulated data showed the following results (see Table 2Citation ). Three GBs had homozygous deletion of RB1 and an additional 15 had loss of one allele and mutation of the other allele of RB1. In addition, one GB (GB185) had an aberrant transcript lacking exons 14–17 of RB1. This case had loss of one allele at RB1 without a detectable mutation in the other allele.6 In all, 19 GBs (14%) had total loss of wild-type RB1. No homozygous deletion or mutation of RB1 was found in the AAs or As. Eighteen GBs (13%) and three AAs (8%) had CDK4 amplification. Fifty GBs and four AAs had homozygous deletion of CDKN2A, and an additional four GBs and one AA had loss of one allele and mutation of the other allele of CDKN2A. In all, 54 GBs (40%) and 5 AAs (13%) had total loss of wild type of CDKN2A. Fifty GBs (37%) and three AAs (8%) had homozygous deletion of CDKN2B. No mutation of CDKN2B was identified.


View this table:
[in this window]
[in a new window]

 
Table 2 Incidence of G1-S transition control and p53 pathway gene abnormalities in astrocytic gliomas

 
The patterns of these G1-S transition control gene abnormalities in individual tumors were then compared (Table 3)Citation . Eighteen of 19 GBs with RB1 mutation/homozygous deletion had neither CDK4 amplification nor CDKN2A/CDKN2B homozygous deletion. One GB (GB47) had mutation of both RB1 and CDKN2A. Eighteen GBs and three AAs with CDK4 amplification retained at least one wild-type allele of RB1, CDKN2A, and CDKN2B, whereas one GB (GB28) had both amplification of CDK4 and homozygous deletion of CDKN2A (Table 3)Citation . Forty-eight GBs and three AAs had homozygous deletion or mutation of both CDKN2A and CDKN2B but no RB1 mutation or CDK4 amplification. Six GBs and two AAs had homozygous deletion of only CDKN2A but not CDKN2B. Two GBs (GB199 and GB147) had homozygous deletion of CDKN2B but not CDKN2A. When all of these abnormalities were combined, 91 GBs (66%), 8 AAs (21%), and no As had either total loss of wild type of RB1, CDKN2A, or CDKN2B, or amplification of CDK4 (Tables 2Citation and 3)Citation .


View this table:
[in this window]
[in a new window]

 
Table 3 The profile of G1-S transition control and p53 pathway gene abnormalities in individual tumors

Only cases with G1-S transition control gene abnormalities are listed. Tumors with abnormalities of only G1-S transition control genes but not p53 pathway genes are underlined. Nomenclature of mutation is according to recommendations of the HUGO Nomenclature committee whenever applicable.(62)

 
p53 Pathway Genes.
We then examined abnormalities of TP53, MDM2, and p14ARF, which are involved in the regulation of the p53 pathway. All of the 190 tumors in the series were examined for mutation of the TP53 gene in exons 2–11 by DGGE. Primers for the DGGE analysis were chosen, and DGGE conditions were optimized so that any mutation in the entire coding region as well as intron sequences at exon/intron borders (minimum of six bases in introns) would be detected by at least one combination of the primer pairs. Examples of DGGE results are shown in Fig. 1ACitation . In all, 100 mutations were identified in 85 tumors (Table 2)Citation . There were 72 missense mutations, 3 inframe deletions, 10 frame-shift deletions, 3 insertions, and 9 nonsense mutations. Three point mutations were found in intronic consensus splice junction sequences. Thirteen tumors had two mutations (9 GBs, 3 AAs, and 1 A) and one GB (GB27) had three mutations. The details of the TP53 mutations as well as the allelic status of the TP53 locus and expression of the p53 protein as assessed by immunohistochemistry will be presented elsewhere.5 In summary, 49 GBs (36%), 26 AAs (67%), and 10 As (67%) had TP53 mutations (Table 2)Citation .



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, DGGE analysis using primer pairs for exon 5b and exon 7 of TP53 (see Table 1Citation ). GB154, GB44 (ex5b), GB12, and GB36 (ex7) have abnormal shifts besides the normal band (N). B, Southern hybridization using probes for MDM2, CDK4, RB1, and D2S44. Matched patients’ blood DNA (B) and tumor DNA (T) were loaded next to each other. The same TaqI blots were serially reprobed. GB140 had amplification of only MDM2 but not CDK4. It also had homozygous deletion of a 3' portion of RB1 (>= exon 18; Ref. 5 ). Using a cDNA probe for RB1, we found that the bands corresponding to exons 14–16 had an allelic number of 1.4 by densitometry whereas the bands corresponding to exons 21–22 had an allelic number of 0.5, which indicated that the region including these two exons were homozygously deleted. GB154 had amplification of only CDK4 but not MDM2. This case had mutation of TP53 (see A). GB90 had amplification of both MDM2 and CDK4. D2S44 was used to control the loading of DNA between blood and tumor from each patient. C, Southern hybridization using probes for E1ß of p14ARF, exon 2 of CDKN2A, exon 1 of CDKN2B, and WI-3306. All of the four probes were simultaneously hybridized to the blot. GB14 had homozygous deletion of p14ARF, CDKN2A but not CDKN2B. GB36 had hemizygous deletion of p14ARF, CDKN2A, and CDKN2B. It had mutation of exon 2 of CDKN2A (3) and exon 7 of TP53 (Table 3Citation and A). GB147 had homozygous deletion of p14ARF and CDKN2B but not CDKN2A. A 5.5-kb aberrant band was observed when probed with the CDKN2B exon 1 probe alone but not with the exon 2 probe, which indicated that the breakpoint of deletion lay between exon 1 and exon 2 of CDKN2B (data not shown). WI-3306 (2q) was used as a control locus.

 
Amplification of MDM2 was determined by densitometry on Southern blotting for all of the 190 tumors. A small part of the data has been described previously (1 , 38) . Eleven GBs (8%) had amplification of MDM2 (Table 2Citation ; Fig. 1BCitation ). No amplification was found among AAs or As.

The allelic status of E1ß of p14ARF was assessed in the following manner. E1ß of p14ARF is located approximately 20 kb centromeric to E1{alpha} of CDKN2A/p16INK4A, and telomeric and in the close vicinity to exon 2 of CDKN2B (23) . When homozygous deletion of both CDKN2A and CDKN2B was identified E1ß of p14ARF was considered as being homozygously codeleted. This cohomozygous deletion was demonstrated in an analysis of 13 glioma cell lines in which p14ARF E1ß, CDKN2A and CDKN2B were specifically examined (data not shown). On the basis of this principle, 48 GBs and 3 AAs were considered as having homozygous deletion of E1ß of p14ARF (Table 3)Citation .

The allelic status of E1ß of p14ARF was specifically examined in 15 cases using a genomic fragment containing part of E1ß and the adjacent intron as a probe for Southern hybridization. These include the cases with homozygous deletion/mutation of only CDKN2A (GB14, GB184, GB36, GB236, GB177, AA87, and AA86) or only CDKN2B (GB199 and GB147) and the cases with abnormalities of RB1 or CDK4 without TP53 mutation or MDM2 amplification [GB47, GB100, GB25, GB157, GB11, and AA7 (Table 3)Citation ]. As a result, 5 tumors (GB14, GB184, GB199, GB147, and AA87) were determined to have homozygous deletion of E1ß of p14ARF (Fig. 1CCitation ). For the remaining 10 cases, the coding region of E1ß was sequenced to determine mutations. No nucleotide changes in E1ß were identified. For mutation in exon 2 of p14ARF, CDKN2A/p16INK4A sequences were reevaluated in the context of the alternative reading frame for p14ARF [see above and (3 , 5) ]. Among five CDKN2A/p16INK4A mutations identified, four were located in the common exon 2. These four CDKN2A/p16INK4A mutations also altered the amino acid sequence of p14ARF (Table 3)Citation .

Profiles of p14ARF/MDM2/p53 pathway gene abnormalities in individual tumors were then compared. Eleven tumors (9 GBs and 2 AAs) had both TP53 mutation and homozygous deletion of p14ARF. Three tumors (two GBs and one AA) had mutation in TP53 and exon 2 of p14ARF. No tumor with MDM2 amplification had either TP53 mutation or p14ARF deletion/mutation. When abnormalities of all of the three genes were combined, 103 GBs (76%), 28 AAs (72%), and 10 As (67%) had either mutation of TP53, amplification of MDM2, or homozygous deletion or mutation of p14ARF (Table 2)Citation .

Correlation of G1-S Transition Control Gene and p53 Pathway Gene Abnormalities.
On the basis of the above findings, profiles of G1-S control gene abnormalities and p53 pathway gene abnormalities in each individual tumor were compared. Among the 19 GBs with RB1 homozygous deletion or mutation, 14 tumors had TP53 mutations and 1 tumor (GB140) had MDM2 amplification (Table 3Citation ; Fig. 1BCitation ). One GB (GB47) with both RB1 and CDKN2A mutation had a mutation of exon 2 of p14ARF (Table 3)Citation . Three GBs (GB100, GB25, and GB157) had no TP53 mutation, MDM2 amplification, nor p14ARF homozygous deletion/mutation.

Among the 21 cases with CDK4 amplification (18 GBs, 3 AAs), 7 GBs and 2 AAs had TP53 mutation (Table 3Citation ; see GB154 in Fig. 1, A and BCitation ). Among them, one GB with both CDK4 amplification and homozygous deletion of CDKN2A/CDKN2B (GB28) had both TP53 mutation and homozygous deletion of p14ARF (Table 3)Citation . An additional 10 GBs had amplification of MDM2 (see GB90 in Fig. 1BCitation ). Only two tumors (GB11 and AA7) had no TP53 mutation, MDM2 amplification, nor p14ARF homozygous deletion/mutation (Table 3)Citation .

Among the 48 GBs and 3 AAs in which E1ß of p14ARF was considered as being homozygously codeleted with CDKN2A/p16INK4A and CDKN2B/p15INK4B, 9 GBs and 1 AA had TP53 mutation (Table 3)Citation . Among two GBs and one AA with homozygous deletion of only CDKN2A but not CDKN2B, two (GB14 and AA87) had both homozygous deletion of E1ß of p14ARF and TP53 mutation (see GB14 in Fig. 1CCitation ), and one (GB184) had homozygous deletion of E1ß of p14ARF but not TP53 mutation. Among the five tumors with CDKN2A/p16INK4A mutation (GB47, GB36, GB236, GB177, and AA86), GB36, GB236, and AA86 had mutation of both TP53 and exon 2 of p14ARF (see GB36 in Fig. 1, A and CCitation , and Ref. 3 ), GB177 had only TP53 mutation, and GB47 had only exon 2 mutation of p14ARF (described above). Both of the cases with homozygous deletion of only CDKN2B but not CDKN2A (GB199 and GB147) had homozygous deletion of E1ß of p14ARF (see GB147 in Fig. 1CCitation ).

When all of the genetic abnormalities described above were combined and compared, 87 GBs and 7 AAs had abnormalities of both G1-S transition control genes and p53 pathway genes (Tables 2Citation and 3)Citation . Among the tumors with G1-S transition control gene abnormalities, this corresponds to 96% of GBs (87 of 91) and 88% of AAs (7 of 8). Among tumors with p53 pathway gene abnormalities, 84% of GBs (87 of 103) and 25% of AAs (7 of 28) had deregulated G1-S transition control (Table 3)Citation . The association between abnormalities of G1-S control genes and p53 pathway genes was highly significant among GBs and among all of the tumors considered together ({chi}2 test, P < 0.0001).

Four GBs and one AA with either RB1 mutation (GB100, GB25, and GB157) or CDK4 amplification (GB11 and AA7) had no TP53 mutation, MDM2 amplification, nor p14ARF homozygous deletion/mutation. All of the tumors with homozygous deletion of CDKN2A and/or CDKN2B or CDKN2A mutation had either TP53 mutation or p14ARF homozygous deletion, or both. Sixteen GBs, 21 AAs, and 10 A grade II had TP53 mutation but none of the G1-S control gene abnormalities. MDM2 amplification was always associated with either RB1 mutation or CDK4 amplification. Twenty-nine GBs, 10 AAs, and 5 As had neither homozygous deletion/mutation of RB1, CDKN2A, CDKN2B, or TP53, nor amplification of CDK4 or MDM2.

In two patients, tumors from the first and second surgeries were studied. In one of them, the initial tumor (AA100) had two mutations in exon 8 of TP53 (R273C and T304ins). When the tumor recurred and progressed (GB177), it acquired a mutation in E1{alpha} of CDKN2A (Y44X) while retaining the same TP53 mutations as AA100.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The majority of genes analyzed in this paper have been extensively studied, in general individually. Frequent abnormalities of these genes have been documented in a variety of human tumors (reviewed in Ref. 39, 40, 41 ). However, no study has documented in detail the alterations in a series of genes coding for components of interacting cellular control mechanisms as is presented here. This type of study is necessary if we are to understand the cellular mechanisms that are aberrant in a particular tumor type. Individual genetic abnormalities should be viewed as ways of disrupting cellular control systems and not as simply abrogating the function of a single gene.

Our findings demonstrate that in primary human gliomas with altered G1-S transition control, the p53 pathway is almost always inactivated. Normally, p53 is involved in preventing cells from uncontrolled proliferation and tumor formation by inducing either G1 arrest or apoptosis when the cell enters the cell cycle in a nonphysiological manner. Cell biological experiments have suggested that abnormalities of G1-S transition control genes may give a growth advantage to the cell; however, simultaneous inactivation of the p53 pathway is a prerequisite for cell survival when such abnormalities are present (10 , 12 , 13) . It has been shown that introduction of wild-type p53 into the glioma cell lines U251 and A172, which had mutation of TP53 and homozygous deletion of CDKN2A, led to apoptosis (42, 43, 44) . Our results substantiate the hypothesis proposed as a result of such experiments using cultured cells.

The two systems can be targeted by a single genetic event. CDKN2A, CDKN2B, and p14ARF reside in a small region on 9p21, and they are frequently homozygously codeleted in diverse types of human tumors including astrocytic gliomas (2 , 45) . CDK4 and MDM2 are located in the same chromosomal region, 12q13–15, albeit with a 4-Mb gap between them (46) . Amplification of this region may be initiated as a single event encompassing both MDM2 and CDK4. Later the amplicon may be rearranged to include only the genes necessary to target, thus, explaining the finding that all of the loci between MDM2 and CDK4 are not amplified in all of the tumors when studied in detail (47) . Rearrangements of amplicons in tumor cells have been well documented. One example is the rearrangement of the amplified EGFR gene in some GBs producing an aberrant, constitutively activated, receptor (48) .

However, in a large proportion of the cases, mutations of TP53 (located on 17p13) and abnormalities of the G1-S transition control genes examined here (RB1, on 13q14; CDK4, on 12q13–15; CDKN2A and CDKN2B, on 9p21) must have occurred as independent and nonsynchronized events, because no single genetic event that would involve these genes simultaneously can be conceived. The association of RB1 mutations/deletions and TP53 mutations alone is statistically significant (P = 0.00081). Therefore, the association between the deregulated p53 pathway and G1-S transition control identified in this study is unlikely to be caused merely by the genetic proximity of some of these genes but is rather a consequence of selection for specific combinations of abnormalities.

The coinactivation of the two systems was found exclusively in GBs and some AAs, which indicates that the combination of these abnormalities contributes to a more aggressive biological tumor phenotype. Inactivation of the p53 pathway alone, exclusively by mutation of TP53, was observed in all of the malignancy grades. In fact, the frequency of TP53 mutation is higher in As and AAs than in the GBs ({chi}2 test, P = 0.0224 and 0.0007, respectively; see Table 2Citation ). It has been shown that As with mutation of TP53 are more likely to recur and progress as compared with those without TP53 mutation (49) . On the basis of these findings, an attractive model of astrocytic glioma progression considers mutation of TP53 an early step and the acquisition of G1-S transition control gene abnormalities a later step. A good example is given by one AA (AA100) in our series with TP53 mutation that progressed to GB (GB177) 3 years after the first operation. It had then acquired a mutation in E1{alpha} of CDKN2A in addition to the TP53 mutation documented in the AA.

It is clinically well documented that GB may arise as a de novo tumor or may progress from astrocytic gliomas of lower malignancy. Judging from clinical data the majority of GBs are de novo tumors. The arrangement of the genes in the genome provides the basis for single events that can inactivate the two cellular control systems simultaneously, providing a credible explanation for the prevalence of de novo GBs.

Abnormalities of genes involved in G1-S transition and the p53 pathway are frequently found in different human tumors. In our series, an individual tumor usually has an alteration of only one component from each regulatory system, which supports the idea that abnormalities of each component may have approximately equivalent effects. For example, RB1 mutation and CDK4 amplification are completely mutually exclusive in our tumors. Not a single case had both a TP53 mutation and MDM2 amplification (see Table 3Citation ). However, in some tumors there were apparently redundant genetic abnormalities. One explanation could be that certain genetic events involving more than one gene may also include a neighboring gene, i.e., homozygous deletion or amplification. In cases that have both TP53 mutation and p14ARF homozygous deletion, p14ARF may simply have been codeleted with CDKN2A or CDKN2B without giving an additional selective advantage. This is supported by our finding that such redundant abnormalities were found when CDKN2A, CDKN2B, or p14ARF were involved. Another possibility is that abnormalities of the different components may not have an equivalent effect. Even different mutations of the same gene may have varying impact on the function of its protein product. Additionally, it cannot be excluded that multiple abnormalities in the same complex pathway could provide an additional growth advantage.

p14ARF (p19ARF in mouse) has an unusual feature. Using an alternative reading frame, it is translated partially from common exons with CDKN2A/p16INK4A, yet results in a totally different protein (22, 23, 24) . p14ARF has been found frequently deleted in a variety of human tumors, most often codeleted with CDKN2A but sometimes specifically targeted (50) . We demonstrated that in cases that have homozygous deletion of only CDKN2A or CDKN2B, E1ß of p14ARF was always involved in the deletion, which indicated that E1ß of p14ARF was the most frequently deleted region on 9p21. p14ARF knockout mice that specifically lack E1ß developed normally but are predisposed to various types of tumors including glioma (51 , 52) . These findings support p14ARF as a tumor suppressor gene. The growth suppressive ability of p14ARF in p14ARF null human cells (or p19ARF in p19ARF null mouse cells) further supports this (28 , 53 , 54) .

Thus far no germ-line or somatic mutation in E1ß has been identified in human tumors (see Ref. 52 and references therein). Mutations in exon 2 of CDKN2A/p16INK4A often alter the amino acid sequence of p14ARF simultaneously, and four such mutations were identified in this study. It has been reported that the NH2-terminal domain of p14ARF, exclusively coded by E1ß, is necessary and sufficient for binding to MDM2 and inducing G1 arrest (27 , 28 , 54) . The growth suppressive activity of p14ARF was not abrogated by a number of common mutations in exon 2 that alter the amino acid sequences of both p16INK4A and p14ARF (53 , 54) . These findings question the significance of exon 2 mutations in p14ARF. Three of our four cases with mutations in exon 2 of p14ARF also had a TP53 mutation.

The role of CDKN2A/p16INK4A as a tumor suppressor gene has been well established by both cell biological experiments and genetic analysis of primary human tumors in sporadic cases and in familial tumor syndromes (55) . Nevertheless, the mutation frequency of CDKN2A is relatively low compared with the frequency of homozygous deletion. It could simply reflect that simultaneous inactivation of both CDKN2A and p14ARF by homozygous deletion is a more efficient way to simultaneously abrogate the p53 pathway and the G1-S transition control.

It is intriguing that five cases had G1-S transition control gene abnormalities without TP53 mutation, MDM2 amplification or p14ARF homozygous deletion/mutation. The most likely explanation is that another component of the p53 pathway, either a regulating protein, for example, p300 (56) , or downstream effector in the apoptosis pathway, for example, BAX (57) , may be altered in these cases. It is also possible that some TP53 mutations have escaped detection, although we think that this is unlikely because primers and conditions for DGGE were optimized to cover the entire coding region and splice junction sequences. However, mutations in regulatory sequences located outside of the screened region would naturally be missed.

Approximately one-third of GBs as well as the majority of AAs and all of the As in our series lack clear evidence of a deregulated G1-S control system. Many tumors in this category have loss of one allele at RB1 or CDKN2A, without detectable mutation in the other alleles (3 , 5) . Methylation of the promoter region of CDKN2A has been suggested to be an alternative mechanism to inactivate the gene (58) . However, our previous analysis of a limited number of tumors showed only a very low incidence of methylation, and this did not correlate to expression (3) . A preliminary mutation analysis of the promoter region of CDKN2A failed to identify somatic mutations.7 Mutation of codon 24 of CDK4 has been reported in familial melanoma kindreds and sporadic melanomas, and the mutated protein has been demonstrated to function as kinase, yet it is unable to bind to p16INK4A (59 , 60) . Mutation analysis of CDK4 exon 2, which contains codon 24, failed to identify any mutation in this tumor series.7 Other components in the same pathway, for example, CDK6 or members of Cyclin Ds, could possibly be involved (42 , 61) and remain to be studied.

The molecular mechanisms of growth control in cells is undoubtedly more complex than our current understanding. The identification of the molecular basis for the tumors without genetic abnormalities of the genes studied here will give further insight into tumorigenesis of astrocytic brain tumors.

ACKNOWLEDGMENTS
We thank Lotta Asplund and Susanne Öhlin for excellent technical assistance and Alice Johnson-Marshall, Lu Liu, and Shohreh Varmeh-Ziaie for critical reading of the manuscript. We also thank the Departments of Neurosurgery at Sahlgrenska Hospital, Göteborg, and the Karolinska Hospital, Stockholm, Sweden for their cooperation in the collection of clinical material.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Swedish Cancer Society, Stockholm’s Cancer Society, King Gustaf V. Jubilee Fund, Axel and Margaret Ax:son Johnsons Funds, Lars Hierta Foundation, the Funds of the Karolinska Institute, and CAMPOD. Back

2 Present address: Department of Cell and Molecular Biology, Medical Nobel Institute, Karolinska Institute, 171 77 Stockholm, Sweden. Back

3 To whom requests for reprints should be addressed, at Department of Pathology, Division of Molecular Histopathology, University of Cambridge, Addenbrooke’s Hospital, Box 235, Cambridge CB2 2QQ, United Kingdom. Phone: 44-1223-336072; Fax: 44-1223-216980; E-mail: vpc20{at}cam.ac.uk Back

4 The abbreviations used are: GB, glioblastoma; A, astrocytoma; AA, anaplastic A; DGGE, denaturing gradient gel electrophoresis; STS, sequence-tagged site. Back

5 K. Ichimura, manuscript in preparation. Back

6 H. M. Goike. Clonal selection for genetic abnormalities for the G1/S transition control and p53 pathways in human glioblastoma xenografts, manuscript in preparation. Back

7 K. Ichimura and V. P. Collins, unpublished data. Back

Received 7/14/99. Accepted 11/12/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Reifenberger G., Reifenberger J., Ichimura K., Meltzer P. S., Collins V. P. Amplification of multiple genes from chromosomal region 12q13–14 in human malignant gliomas: preliminary mapping of the amplicons shows preferential involvement of CDK4, SAS, and MDM2. Cancer Res., 54: 4299-4303, 1994.[Abstract/Free Full Text]
  2. Schmidt E. E., Ichimura K., Reifenberger G., Collins V. P. CDKN2 (p16/MTS1) gene deletion or CDK4 amplification occurs in the majority of glioblastomas. Cancer Res., 54: 6321-6324, 1994.[Abstract/Free Full Text]
  3. Schmidt E. E., Ichimura K., Messerle K. R., Goike H. M., Collins V. P. Infrequent methylation of CDKN2A(MTS1/p16) and rare mutation of both CDKN2A and CDKN2B(MTS2/p15) in primary astrocytic tumours. Br. J. Cancer, 75: 2-8, 1997.[Medline]
  4. Ueki K., Ono Y., Hensen J. W., Efird J. T., von Deimling A., Louis D. N. CDKN2/pl6 or RB alterations occur in the majority of glioblastomas and are inversely correlated. Cancer Res., 56: 150-153, 1996.[Abstract/Free Full Text]
  5. Ichimura K., Schmidt E. E., Goike H. M., Collins V. P. Human glioblastomas with no alterations of the CDKN2A (p16INK4A, MTS1) and CDK4 genes have frequent mutations of the retinoblastoma gene. Oncogene, 13: 1065-1072, 1996.[Medline]
  6. Pines J. The cell cycle kinases. Semin. Cancer Biol., 5: 305-313, 1994.[Medline]
  7. Weinberg R. A. The retinoblastoma protein and cell cycle control. Cell, 81: 323-330, 1995.[Medline]
  8. Kleihues, P., Burger, P. C., and Scheithauer, B. W. Histological Typing of Tumors of the Central Nervous System, Ed. 2. New York: Springer-Verlag, 1993.
  9. Russell, D. S., and Rubinstein, L. J. Tumours of central neuroepithelial origin. In: Pathology of Tumours of the Nervous System, Ed. 5, pp. 83–350. London: Edward Arnold, 1989.
  10. Debbas M., White E. Wild-type p53 mediates apoptosis by E1A, which is inhibited by E1B. Genes Dev., 7: 546-554, 1993.[Abstract/Free Full Text]
  11. Johnson D. G., Schwarz J. K., Cress W. D., Nevins J. R. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature (Lond.), 365: 349-352, 1993.[Medline]
  12. Wu X., Levine A. J. p53 and E2F-1 cooperate to mediate apoptosis. Proc. Natl. Acad. Sci. USA, 91: 3602-3606, 1994.[Abstract/Free Full Text]
  13. Morgenbesser S. D., Williams B. O., Jacks T., DePinho R. A. p53-dependent apoptosis produced by Rb-deficiency in the developing mouse lens. Nature (Lond.), 371: 72-74, 1994.[Medline]
  14. Tsai K. Y., Hu Y., Macleod K. F., Crowley D., Yamasaki L., Jacks T. Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and extends survival of Rb-deficient mouse embryos. Mol. Cell, 2: 293-304, 1998.[Medline]
  15. Prives C., Hall P. A. The p53 pathway. J. Pathol., 187: 112-126, 1999.[Medline]
  16. Momand J., Zambetti G. P., Olson D. C., George D., Levine A. J. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell, 69: 1237-1245, 1992.[Medline]
  17. Oliner J. D., Pietenpol J. A., Thiagalingam S., Gyuris J., Kinzler K. W., Vogelstein B. Oncoprotein MDM2 conceals the activation domain of tumour suppressor p53. Nature (Lond.), 362: 857-860, 1993.[Medline]
  18. Haupt Y., Maya R., Kazaz A., Oren M. Mdm2 promotes the rapid degradation of p53. Nature (Lond.), 387: 296-299, 1997.[Medline]
  19. Kubbutat M. H., Jones S. N., Vousden K. H. Regulation of p53 stability by Mdm2. Nature (Lond.), 387: 299-303, 1997.[Medline]
  20. Prives C. Signaling to p53: breaking the MDM2–p53 circuit. Cell, 95: 5-8, 1998.[Medline]
  21. Piette J., Neel H., Marechal V. Mdm2: keeping p53 under control. Oncogene, 15: 1001-1010, 1997.[Medline]
  22. Quelle D. E., Zindy F., Ashmun R. A., Sherr C. J. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83: 993-1000, 1995.[Medline]
  23. Mao L., Merlo A., Bedi G., Shapiro G. I., Edwards C. D., Rollins B. J., Sidransky D. A novel p16INK4A transcript. Cancer Res., 55: 2995-2997, 1995.[Abstract/Free Full Text]
  24. Stone S., Jiang P., Dayananth P., Tavtigian S. V., Katcher H., Parry D., Peters G., Kamb A. Complex structure and regulation of the P16 (MTS1) locus. Cancer Res., 55: 2988-2994, 1995.[Abstract/Free Full Text]
  25. Stott F. J., Bates S., James M. C., McConnell B. B., Starborg M., Brookes S., Palmero I., Ryan K., Hara E., Vousden K. H., Peters G. The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. EMBO J., 17: 5001-5014, 1998.[Medline]
  26. Pomerantz J., Schreiber-Agus N., Liegeois N. J., Silverman A., Alland L., Chin L., Potes J., Chen K., Orlow I., Lee H. W., Cordon-Cardo C., DePinho R. A. The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2’s inhibition of p53. Cell, 92: 713-723, 1998.[Medline]
  27. Zhang Y., Xiong Y., Yarbrough W. G. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell, 92: 725-734, 1998.[Medline]
  28. Kamijo T., Weber J. D., Zambetti G., Zindy F., Roussel M. F., Sherr C. J. Functional and physical interactions of the ARF tumor suppressor with p53 and Mdm2. Proc. Natl. Acad. Sci. USA., 95: 8292-8297, 1998.[Abstract/Free Full Text]
  29. Robertson K. D., Jones P. A. The human ARF cell cycle regulatory gene promoter is a CpG island which can be silenced by DNA methylation and down-regulated by wild-type p53. Mol. Cell. Biol., 18: 6457-6473, 1998.[Abstract/Free Full Text]
  30. Bates S., Phillips A. C., Clark P. A., Stott F., Peters G., Ludwig R. L., Vousden K. H. p14ARF links the tumour suppressors RB and p53. Nature (Lond.), 395: 124-125, 1998.[Medline]
  31. de Stanchina E., McCurrach M. E., Zindy F., Shieh S. Y., Ferbeyre G., Samuelson A. V., Prives C., Roussel M. F., Sherr C. J., Lowe S. W. E1A signaling to p53 involves the p19ARF tumor suppressor. Genes Dev., 12: 2434-2442, 1998.[Abstract/Free Full Text]
  32. Pan H., Yin C., Dyson N. J., Harlow E., Yamasaki L., Van Dyke T. Key roles for E2F1 in signaling p53-dependent apoptosis and in cell division within developing tumors. Mol. Cell, 2: 283-292, 1998.[Medline]
  33. Ichimura K., Schmidt E. E., Miyakawa A., Goike H. M., Collins V. P. Distinct patterns of deletion on 10p and 10q suggest involvement of multiple tumor suppressor genes in the development of astrocytic gliomas of different malignancy grades. Genes Chromosomes Cancer, 22: 9-15, 1998.[Medline]
  34. Liu L., Ichimura K., Pettersson E. H., Collins V. P. Chromosome 7 rearrangements in glioblastomas; loci adjacent to EGFR are independently amplified. J. Neuropathol. Exp. Neurol., 57: 1138-1145, 1998.[Medline]
  35. Ichimura K., Schmidt E. E., Yamaguchi N., James C. D., Collins V. P. A common region of homozygous deletion in malignant human gliomas lies between the IFN-{alpha}/{omega} gene cluster and the D9S171 locus. Cancer Res., 54: 3127-3130, 1994.[Abstract/Free Full Text]
  36. Hudson T. J., Stein L. D., Gerety S. S., Ma J., Castle A. B., Silva J., Slonim D. K., Baptista R., Kruglyak L., Xu S. H., Hu X., Colbert A., Rosenberg C., Reeve-Daly M. P., Rozen S., Hui L., Wu X., Vestergaard C., Wilson K., Bae J., Maitra S., Ganiatsas S., Evans C., DeAngelis M., Ingalls K., Nahf R., Horton L., Oskin M., Collymore A., Ye W., Kouyoumjian V., Zernsteva I., Tarn J., Devine R., Courtney D., Renaud M., Nguyen H., O’Connor T., Fizames C., Faure S., Gyapay G., Dib C., Morissette J., Orlin J., Birren B., Goodman N., Weissenbach J., Hawkins T., Foote S., Page D., Lander E. An STS-based map of the human genome, with supplementary data from the Whitehead Institute/MIT Center for Genome Research, Human Genetic Mapping Project, Data Release 11 (October 1996). Science (Washington DC), 270: 1945-1954, 1995.[Abstract]
  37. Hamelin R., Jego N., Laurent P. P., Vidaud M., Thomas G. Efficient screening of p53 mutations by denaturing gradient electrophoresis in colorectal tumors. Oncogene, 8: 2213-2220, 1993.[Medline]
  38. Reifenberger G., Liu L., Ichimura K., Schmidt E. E., Collins V. P. Amplification and overexpression of the MDM2 gene in a subset of human malignant gliomas without p53 mutations. Cancer Res., 53: 2736-2739, 1993.[Abstract/Free Full Text]
  39. Greenblatt M. S., Bennett W. P., Hollstein M., Harris C. C. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res., 54: 4855-4878, 1994.[Free Full Text]
  40. Hall M., Peters G. Genetic alterations of cyclins, cyclin-dependent kinases, and Cdk inhibitors in human cancer. Adv. Cancer Res., 68: 67-108, 1996.[Medline]
  41. Momand J., Jung D., Wilczynski S., Niland J. The MDM2 gene amplification database. Nucleic Acids Res., 26: 3453-3459, 1998.[Abstract/Free Full Text]
  42. He J., Allen J. R., Collins V. P., Allalunis-Turner M. J., Godbout R., Day R. S., III, James C. D. CDK4 amplification is an alternative mechanism to p16 gene homozygous deletion in glioma cell lines. Cancer Res., 54: 5804-5807, 1994.[Abstract/Free Full Text]
  43. Li H., Lochmuller H., Yong V. W., Karpati G., Nalbantoglu J. Adenovirus-mediated wild-type p53 gene transfer and overexpression induces apoptosis of human glioma cells independent of endogenous p53 status. J. Neuropathol. Exp. Neurol., 56: 872-878, 1997.[Medline]
  44. Gomez-Manzano C., Fueyo J., Kyritsis A. P., Steck P. A., Roth J. A., McDonnell T. J., Steck K. D., Levin V. A., Yung W. K. Adenovirus-mediated transfer of the p53 gene produces rapid and generalized death of human glioma cells via apoptosis. Cancer Res., 56: 694-699, 1996.[Abstract/Free Full Text]
  45. Hirama T., Koeffler H. P. Role of the cyclin-dependent kinase inhibitors in the development of cancer. Blood, 86: 841-854, 1995.[Free Full Text]
  46. Krauter K., Montgomery K., Yoon S. J., LeBlanc-Straceski J., Renault B., Marondel I., Herdman V., Cupelli L., Banks A., Lieman J. A second-generation YAC contig map of human chromosome 12. Nature (Lond.), 377(Suppl): 321-333, 1995.[Medline]
  47. Reifenberger G., Ichimura K., Reifenberger J., Elkahloun A. G., Meltzer P. S., Collins V. P. Refined mapping of 12q13–q15 amplicons in human malignant gliomas suggests CDK4/SAS and MDM2 as independent amplification targets. Cancer Res., 56: 5141-5145, 1996.[Abstract/Free Full Text]
  48. Sugawa N., Ekstrand A. J., James C. D., Collins V. P. Identical splicing of aberrant epidermal growth factor receptor transcripts from amplified rearranged genes in human glioblastomas. Proc. Natl. Acad. Sci. USA, 87: 8602-8606, 1990.[Abstract/Free Full Text]
  49. Reifenberger J., Ring G. U., Gies U., Cobbers L., Oberstrass J., An H. X., Niederacher D., Wechsler W., Reifenberger G. Analysis of p53 mutation and epidermal growth factor receptor amplification in recurrent gliomas with malignant progression. J. Neuropathol. Exp. Neurol., 55: 822-831, 1996.[Medline]
  50. Kumar R., Sauroja I., Punnonen K., Jansen C., Hemminki K. Selective deletion of exon 1ß of the p19ARF gene in metastatic melanoma cell lines. Genes Chromosomes Cancer, 23: 273-277, 1998.[Medline]
  51. Kamijo T., Bodner S., van de Kamp E., Randle D. H., Sherr C. J. Tumor spectrum in ARF-deficient mice. Cancer Res., 59: 2217-2222, 1999.[Abstract/Free Full Text]
  52. Kamijo T., Zindy F., Roussel M. F., Quelle D. E., Downing J. R., Ashmun R. A., Grosveld G., Sherr C. J. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell, 91: 649-659, 1997.[Medline]
  53. Arap W., Knudsen E., Sewell D. A., Sidransky D., Wang J. Y., Huang H. J., Cavenee W. K. Functional analysis of wild-type and malignant glioma derived CDKN2Aß alleles: evidence for an RB-independent growth suppressive pathway. Oncogene, 15: 2013-2020, 1997.[Medline]
  54. Quelle D. E., Cheng M., Ashmun R. A., Sherr C. J. Cancer-associated mutations at the INK4a locus cancel cell cycle arrest by p16INK4a but not by the alternative reading frame protein p19ARF. Proc. Natl. Acad. Sci. USA, 94: 669-673, 1997.[Abstract/Free Full Text]
  55. Serrano M. The tumor suppressor protein p16INK4a. Exp. Cell Res., 237: 7-13, 1997.[Medline]
  56. Grossman S. R., Perez M., Kung A. L., Joseph M., Mansur C., Xiao Z. X., Kumar S., Howley P. M., Livingston D. M. p300/MDM2 complexes participate in MDM2-mediated p53 degradation. Mol. Cell, 2: 405-415, 1998.[Medline]
  57. Rampino N., Yamamoto H., Ionov Y., Li Y., Sawai H., Reed J. C., Perucho M. Somatic frameshift mutations in the BAX gene in colon cancers of the microsatellite mutator phenotype. Science (Washington DC), 275: 967-969, 1997.[Abstract/Free Full Text]
  58. Merlo A., Herman J. G., Mao L., Lee D. J., Gabrielson E., Burger P. C., Baylin S. B., Sidransky D. 5' CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nat. Med., 1: 686-692, 1995.[Medline]
  59. Wölfel T., Hauer M., Schneider J., Serrano M., Wölfel C., Klehmann H. E., De P. E., Hankeln T., Meyer zum Büschenfelde K.-H., Beach D. A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science (Washington DC), 269: 1281-1284, 1995.[Abstract/Free Full Text]
  60. Zuo L., Weger J., Yang Q. B., Goldstein A. M., Tucker M. A., Walker G. J., Hayward N., Dracopoli N. C. Germline mutations in the p16INK4a binding domain of CDK4 in familial melanoma. Nat. Genet., 12: 97-99, 1996.[Medline]
  61. Costello J. F., Plass C., Arap W., Chapman V. M., Held W. A., Berger M. S., Su Huang H. J., Cavenee W. K. Cyclin-dependent kinase 6 (CDK6) amplification in human gliomas identified using two-dimensional separation of genomic DNA. Cancer Res., 57: 1250-1254, 1997.[Abstract/Free Full Text]
  62. Antonarakis S. E. Recommendations for a nomenclature system for human gene mutations. Nomenclature Working Group. Hum. Mutat., 11: 1-3, 1998.[Medline]



This article has been cited by other articles:


Home page
Am J Clin PatholHome page
Y. Ruano, T. Ribalta, A. R. de Lope, Y. Campos-Martin, C. Fiano, E. Perez-Magan, J.-L. Hernandez-Moneo, M. Mollejo, and B. Melendez
Worse Outcome in Primary Glioblastoma Multiforme With Concurrent Epidermal Growth Factor Receptor and p53 Alteration
Am J Clin Pathol, February 1, 2009; 131(2): 257 - 263.
[Abstract] [Full Text] [PDF]


Home page
Neuro OncolHome page
V. Suri, P. Das, A. Jain, M. C. Sharma, S. A. Borkar, A. Suri, D. Gupta, and C. Sarkar
Pediatric glioblastomas: A histopathological and molecular genetic study
Neuro-oncol, January 1, 2009; 11(3): 274 - 280.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
J. J. Hawes, J. D. Nerva, and K. M. Reilly
Novel Dual-Reporter Preclinical Screen for Antiastrocytoma Agents Identifies Cytostatic and Cytotoxic Compounds
J Biomol Screen, September 1, 2008; 13(8): 795 - 803.
[Abstract] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
L. P. Petalidis, A. Oulas, M. Backlund, M. T. Wayland, L. Liu, K. Plant, L. Happerfield, T. C. Freeman, P. Poirazi, and V. P. Collins
Improved grading and survival prediction of human astrocytic brain tumors by artificial neural network analysis of gene expression microarray data
Mol. Cancer Ther., May 1, 2008; 7(5): 1013 - 1024.
[Abstract] [Full Text] [PDF]


Home page
Ann. Surg. Oncol.Home page
S. Sinha, N. Chunder, N. Mukherjee, N. Alam, A. Roy, S. Roychoudhury, and C. K. Panda
Frequent Deletion and Methylation in SH3GL2 and CDKN2A Loci are Associated with Early- and Late-onset Breast Carcinoma
Ann. Surg. Oncol., April 1, 2008; 15(4): 1070 - 1080.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
R. Huang, A. Wallqvist, and D. G. Covell
Targeting changes in cancer: assessing pathway stability by comparing pathway gene expression coherence levels in tumor and normal tissues.
Mol. Cancer Ther., September 1, 2006; 5(9): 2417 - 2427.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
I. F. Pollack, R. L. Hamilton, R. W. Sobol, J. Burnham, A. J. Yates, E. J. Holmes, T. Zhou, and J. L. Finlay
O6-Methylguanine-DNA Methyltransferase Expression Strongly Correlates With Outcome in Childhood Malignant Gliomas: Results From the CCG-945 Cohort
J. Clin. Oncol., July 20, 2006; 24(21): 3431 - 3437.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. A. Reardon, J. N. Rich, H. S. Friedman, and D. D. Bigner
Recent Advances in the Treatment of Malignant Astrocytoma
J. Clin. Oncol., March 10, 2006; 24(8): 1253 - 1265.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Ghosh and G. J. Duigou
Decreased Replication Ability of E1-Deleted Adenoviruses Correlates with Increased Brain Tumor Malignancy
Cancer Res., October 1, 2005; 65(19): 8936 - 8943.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. K. Wiencke, K. Aldape, A. McMillan, J. Wiemels, M. Moghadassi, R. Miike, K. T. Kelsey, J. Patoka, J. Long, and M. Wrensch
Molecular Features of Adult Glioma Associated with Patient Race/Ethnicity, Age, and a Polymorphism in O6-Methylguanine-DNA-Methyltransferase
Cancer Epidemiol. Biomarkers Prev., July 1, 2005; 14(7): 1774 - 1783.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
C. Gomez-Manzano, W.K. A. Yung, R. Alemany, and J. Fueyo
Genetically modified adenoviruses against gliomas: From bench to bedside
Neurology, August 10, 2004; 63(3): 418 - 426.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
V P Collins
Brain tumours: classification and genes
J. Neurol. Neurosurg. Psychiatry, June 1, 2004; 75(suppl_2): ii2 - ii11.
[Full Text] [PDF]


Home page
Cancer Res.Home page
S. Godard, G. Getz, M. Delorenzi, P. Farmer, H. Kobayashi, I. Desbaillets, M. Nozaki, A.-C. Diserens, M.-F. Hamou, P.-Y. Dietrich, et al.
Classification of Human Astrocytic Gliomas on the Basis of Gene Expression: A Correlated Group of Genes with Angiogenic Activity Emerges As a Strong Predictor of Subtypes
Cancer Res., October 15, 2003; 63(20): 6613 - 6625.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Watanabe, Y. Katayama, A. Yoshino, C. Komine, and T. Yokoyama
Deregulation of the TP53/p14ARF Tumor Suppressor Pathway in Low-Grade Diffuse Astrocytomas and Its Influence on Clinical Course
Clin. Cancer Res., October 15, 2003; 9(13): 4884 - 4890.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. M. Backlund, B. R. Nilsson, H. M. Goike, E. E. Schmidt, L. Liu, K. Ichimura, and V. P. Collins
Short Postoperative Survival for Glioblastoma Patients with a Dysfunctional Rb1 Pathway in Combination with No Wild-type PTEN
Clin. Cancer Res., September 15, 2003; 9(11): 4151 - 4158.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. van den Boom, M. Wolter, R. Kuick, D. E. Misek, A. S. Youkilis, D. S. Wechsler, C. Sommer, G. Reifenberger, and S. M. Hanash
Characterization of Gene Expression Profiles Associated with Glioma Progression Using Oligonucleotide-Based Microarray Analysis and Real-Time Reverse Transcription-Polymerase Chain Reaction
Am. J. Pathol., September 1, 2003; 163(3): 1033 - 1043.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. J. Gilbertson, D. A. Hill, R. Hernan, M. Kocak, R. Geyer, J. Olson, A. Gajjar, L. Rush, R. L. Hamilton, S. D. Finkelstein, et al.
ERBB1 Is Amplified and Overexpressed in High-grade Diffusely Infiltrative Pediatric Brain Stem Glioma
Clin. Cancer Res., September 1, 2003; 9(10): 3620 - 3624.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. Berggren, R. Kumar, S. Sakano, L. Hemminki, T. Wada, G. Steineck, J. Adolfsson, P. Larsson, U. Norming, H. Wijkstrom, et al.
Detecting Homozygous Deletions in the CDKN2A(p16INK4a)/ARF(p14ARF) Gene in Urinary Bladder Cancer Using Real-Time Quantitative PCR
Clin. Cancer Res., January 1, 2003; 9(1): 235 - 242.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Uhrbom, C. Dai, J. C. Celestino, M. K. Rosenblum, G. N. Fuller, and E. C. Holland
Ink4a-Arf Loss Cooperates with KRas Activation in Astrocytes and Neural Progenitors to Generate Glioblastomas of Various Morphologies Depending on Activated Akt
Cancer Res., October 1, 2002; 62(19): 5551 - 5558.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Wadhwa, T. Sugihara, Md. K. Hasan, K. Taira, R. R. Reddel, and S. C. Kaul
A Major Functional Difference between the Mouse and Human ARF Tumor Suppressor Proteins
J. Biol. Chem., September 20, 2002; 277(39): 36665 - 36670.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Sanchez-Aguilera, M. Sanchez-Beato, J. F. Garcia, I. Prieto, M. Pollan, and M. A. Piris
p14ARF nuclear overexpression in aggressive B-cell lymphomas is a sensor of malfunction of the common tumor suppressor pathways
Blood, February 15, 2002; 99(4): 1411 - 1418.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
I. F. Pollack, S. D. Finkelstein, J. Woods, J. Burnham, E. J. Holmes, R. L. Hamilton, A. J. Yates, J. M. Boyett, J. L. Finlay, R. Sposto, et al.
Expression of p53 and Prognosis in Children with Malignant Gliomas
N. Engl. J. Med., February 7, 2002; 346(6): 420 - 427.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. F. Garcia, R. Villuendas, M. Sanchez-Beato, A. Sanchez-Aguilera, L. Sanchez, I. Prieto, and M. A. Piris
Nucleolar p14ARF Overexpression in Reed-Sternberg Cells in Hodgkin's Lymphoma : Absence of p14ARF/Hdm2 Complexes Is Associated with Expression of Alternatively Spliced Hdm2 Transcripts
Am. J. Pathol., February 1, 2002; 160(2): 569 - 578.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. F. Pollack, S. D. Finkelstein, J. Burnham, E. J. Holmes, R. L. Hamilton, A. J. Yates, J. L. Finlay, and R. Sposto
Age and TP53 Mutation Frequency in Childhood Malignant Gliomas: Results in a Multi-institutional Cohort
Cancer Res., October 1, 2001; 61(20): 7404 - 7407.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Sonoda, T. Ozawa, K. D. Aldape, D. F. Deen, M. S. Berger, and R. O. Pieper
Akt Pathway Activation Converts Anaplastic Astrocytoma to Glioblastoma Multiforme in a Human Astrocyte Model of Glioma
Cancer Res., September 1, 2001; 61(18): 6674 - 6678.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Calogero, A. Arcella, G. De Gregorio, A. Porcellini, D. Mercola, C. Liu, V. Lombari, M. Zani, G. Giannini, F. M. Gagliardi, et al.
The Early Growth Response Gene EGR-1 Behaves as a Suppressor Gene That Is Down-Regulated Independent of ARF/Mdm2 but not p53 Alterations in Fresh Human Gliomas
Clin. Cancer Res., September 1, 2001; 7(9): 2788 - 2796.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Sonoda, T. Ozawa, Y. Hirose, K. D. Aldape, M. McMahon, M. S. Berger, and R. O. Pieper
Formation of Intracranial Tumors by Genetically Modified Human Astrocytes Defines Four Pathways Critical in the Development of Human Anaplastic Astrocytoma
Cancer Res., July 1, 2001; 61(13): 4956 - 4960.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. A. Nicholson, N. T. Okby, M. A. Khan, J. A. Welsh, M. G. McMenamin, W. D. Travis, J. R. Jett, H. D. Tazelaar, V. Trastek, P. C. Pairolero, et al.
Alterations of p14ARF, p53, and p73 Genes Involved in the E2F-1-mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma
Cancer Res., July 1, 2001; 61(14): 5636 - 5643.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Chen, K. Aldape, J. K. Wiencke, K. T. Kelsey, R. Miike, R. L. Davis, J. Liu, A. Kesler-Diaz, M. Takahashi, and M. Wrensch
Ethnicity Delineates Different Genetic Pathways in Malignant Glioma
Cancer Res., May 1, 2001; 61(10): 3949 - 3954.
[Abstract] [Full Text]


Home page
The OncologistHome page
A. Di Bacco, K. Keeshan, S. L. McKenna, and T. G. Cotter
Molecular Abnormalities in Chronic Myeloid Leukemia: Deregulation of Cell Growth and Apoptosis
Oncologist, October 1, 2000; 5(5): 405 - 415.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ichimura, K.
Right arrow Articles by Collins, V. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ichimura, K.
Right arrow Articles by Collins, V. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online