| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Radiation Oncology, Long Island Jewish Medical Center, The Long Island Campus for the Albert Einstein College of Medicine, New Hyde Park, New York 11040 [S. F., Q. M., J. G., M. Y., I. D. G., E. M. R.], and Department of Pharmacology and Toxicology, Medical College of Virginia, Commonwealth University, Richmond, Virginia 23298 [B. G.]
| ABSTRACT |
|---|
|
|
|---|
),
but did not activate the nonliganded receptor. Significant
stimulation of ER-
activity was observed at EtOH concentrations
comparable with or less than blood alcohol levels associated with
intoxication and at doses below the threshold for in
vitro cytotoxicity. These findings may be explained, in part,
by an EtOH-induced down-regulation of the expression of BRCA1, a
potent inhibitor of ER-
activity, and, in part, by a modest increase
in the ER-
levels. Our findings suggest that inactivation of
BRCA1 and increased estrogen-responsiveness might
contribute to alcohol-induced breast cancer. | Introduction |
|---|
|
|
|---|
Aside from ionizing radiation, alcohol consumption is probably the
best-defined environmental risk factor for breast cancer, but the
mechanism(s) of alcohol-induced carcinogenesis is not understood
(7
, 8)
. In combination with other events such as oncogenic
mutations and inactivation of tumor suppressors, prolonged estrogenic
stimulation of the mammary epithelia is thought to contribute to the
development of breast cancer. In this report, we show that alcohol can
down-regulate the tumor suppressor BRCA1 (9)
and stimulate
ER-
3
activity, both of which might contribute to alcohol-induced breast
cancer.
| Materials and Methods |
|---|
|
|
|---|
was used to express ER-
. The estrogen-responsive
reporter plasmid ERE-TK-Luc is composed of the vitellogenin A2 ERE
controlling a minimal thymidine kinase promoter (TK81) and
luciferase, in plasmid pGL2 (10)
. The E2F reporter (E2F-TK-Luc) is composed of the E2F site from adenovirus E2a linked to the minimal TK promoter (TK81) and luciferase, and the Sp1 reporter (Sp1-TK-Luc) is composed of the Sp1 site from the cyclin D1 promoter (-127 to -99), TK81, and luciferase. Expression plasmids for E2F1 (pCMV-E2F1) and Sp1 (pCMV-Sp1) and the E2F- and Sp1-responsive reporter plasmids were provided by Dr. Richard Pestell (Departments of Medicine and Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, NY).
Cell Lines.
Hormone-responsive human breast cancer cell lines MCF-7 and T47D were
obtained from the American Type Culture Collection (Rockville, MD) and
grown in DMEM supplemented with 5% FCS, L-glutamine (5
mM), nonessential amino acids (5 mM),
penicillin (100 units/ml), and streptomycin (100 µg/ml; Ref.
11
).
Estrogen Receptor (ER-
) Transcriptional Assays.
ER-
transcriptional activity was determined by measuring the
estrogen-stimulated, ER-
mediated activation of the
estrogen-responsive reporter plasmid ERE-TK-Luc. Assays were performed
essentially as described earlier (11)
. Briefly,
asynchronously proliferating cells at about 5070% of confluency in
24-well dishes were washed several times and incubated overnight with
0.25 µg of each vector in serum-free DMEM containing Lipofectin (Life
Technologies). Cells were then washed at least three times, incubated
in serum-free, phenolphthalein-free DMEM (0.2 ml/well) without or with
17ß-estradiol (E2, 1 µM) and/or ethanol for 24 h,
and harvested for luciferase assays. Luciferase values are
means ± SE of four replicate wells and are
representative of several independent experiments. In some experiments,
plasmid pRSV-ß-gal was cotransfected as a control for transfection
efficiency. These experiments revealed no effect of ethanol or wtBRCA1
on ß-galactosidase activity.
Assays of Cytotoxicity. MTT Assays.
MTT assays of cell viability were performed as described previously
(12)
. This assay is based on the ability of viable cells
to convert MTT, a soluble tetrazolium salt, into an insoluble formazan
precipitate, which is quantitated by spectrophotometry after
solubilization in DMSO (13)
. Briefly, subconfluent
proliferating cells in 96-well dishes were treated with different doses
of ethanol for 24 h in serum-free DMEM, after which the cells were
solubilized and absorbance readings were taken using a multiwell
spectrophometer. The amount of MTT dye reduction was calculated based
on the difference between absorbance at 570 nm and at 630 nm.
Cell viability was expressed as the amount of dye reduction relative to
that of untreated controls.
Apoptosis Assays.
Subconfluent exponentially proliferating cells in 100-mm plastic Petri
dishes were incubated with different doses of ethanol in serum-free
DMEM for 24 h, and then the cells were counted using a
hemacytometer. Samples were normalized by cell number (500,000750,000
cells), and the low molecular weight apoptotic DNA was extracted as
described previously (12
, 14)
. The DNA was electrophoresed
through 1.2% agarose gels containing 0.1 mg/ml of ethidium bromide,
and the gels were photographed under UV illumination.
Western Blotting.
Preparation of whole cell lysates and Western blotting was performed as
described previously (12)
. The primary antibodies and
their sources were as follows: (a) BRCA1 (C-20, rabbit
polyclonal, Santa Cruz Biotechnology, 1:200 dilution); (b)
ER-
(H-184, rabbit polyclonal, Santa Cruz, 1:1000); (c)
Bax (P-19, Santa Cruz); (d) Bcl-2 (N-19, Santa Cruz); and
(e)
-actin (I-19, goat polyclonal, Santa Cruz, 1:500).
Proteins were visualized using the enhanced chemiluminescence detection
system (Amersham), with colored markers (Bio-Rad) as size standards.
Semiquantitative RT-PCR Analysis.
The BRCA1 mRNA expression was evaluated by semiquantitative RT-PCR, as
described previously by us (12)
. Briefly, total cell RNA
was extracted from the cell monolayers using TriPure reagent
(Boehringer Mannheim), treated with DNase, and purified by
phenol-chloroform extraction. Aliquots of RNA (5 µg) were
reverse-transcribed using Superscript II reverse transcriptase (Life
Technologies, 10,000 units/ml). Aliquots of cDNA corresponding to 0.5
µg of original RNA were used for PCR amplification. The cycle number
(n = 27) was adjusted so that all reactions
fell within the linear range of amplification. The PCR primers and
predicted products were as follows: BRCA1, 5'TTGCGGGAGGAAAATGGGTAGTTA'3
(forward), 3'TGTGCCAAGGGTGAATGATGAAG'5 (backward), 285 bp (position in
DNA 5239-5524); and ß-actin, 5'TTGTTACCAACTGGGACGATA3' (forward),
3'GATCTTGATCTTGGTGCT5' (backward), 764 bp (position in DNA 265-1028).
| Results |
|---|
|
|
|---|
in
Cultured Human Breast Cancer Cells.
. Initially we tested
MCF-7 cells, a commonly studied human breast cancer cell line that is
estrogen- and progesterone-receptor-positive and wt for the
p53, Rb, and BRCA1 tumor suppressor
genes. Cells were transfected with ER-
, to ensure high-level ER
expression (see below) and an estrogen-responsive reporter plasmid
(ERE-TK-Luc) and assayed for estradiol (E2)-stimulated reporter
activity. E2 alone induced an
100-fold stimulation of reporter
activity in MCF-7 cells (positive control).
In cells incubated with E2 plus ethanol for 24 h, there was a
dose-dependent increase in E2-stimulated reporter activity, as compared
with the positive control (i.e., cells incubated with E2 but
no ethanol). This effect seems to be more dramatic when plotted on a
linear (Fig. 1A
, right) than on a logarithmic scale (Fig. 1A
, left). Generally similar results were
obtained using MCF-7 and T47D cells. In MCF-7, the maximum stimulation
of ER-
activity was
10-fold, relative to the positive control
(+E2, 0 ethanol) and was observed at 80100 mM
ethanol. In T47D, the maximum ethanol-induced stimulation was 13-fold
and occurred at 200 mM ethanol. At doses higher
than 100 mM in MCF-7 and 200
mM in T47D there was a reduction of ER-
activity consistent with cytotoxicity (see below).
|
activity in human breast cancer cells is
specific to liganded ER-
.
Although most experiments were performed with transfected ER-
to
ensure high level ER-
expression, we tested the effects of two doses
of ethanol (60 mM and 100 mM) in MCF-7 and T47D
cells in the absence of exogenous ER-
. When normalized to the +E2, 0
ethanol control (=100%), the luciferase activities (normalized to
cotransfected ß-gal activity) at 60 mM and 100
mM of ethanol were as follows: MCF-7, 437% and 981%,
respectively; and T47D, 389% and 528%, respectively (SE, <5%).
These values were significantly higher than the controls
(P < 0.001, two-tailed t tests),
indicating that it is not necessary to supply exogenous ER-
to
demonstrate the stimulation of ER-
transcriptional activity by
ethanol.
Doses of ethanol that markedly enhanced liganded ER-
transcriptional
activity (60100 mM) did not stimulate the activity of two
cell cycle-regulated transcription factors, E2F1 and Sp1, as
demonstrated by assays using E2F- and Sp1-responsive reporters (Fig. 1C)
. These findings suggest that the ability of ethanol to
activate ER-
is not because of nonspecific transcriptional
activation.
It is not likely that the ethanol-induced alterations of ER-
activity were attributable to toxicity, because ER-
activity was
increased rather than decreased, within the range of ethanol
concentrations comparable with achievable blood alcohol levels.
However, to determine the dose-effect relationship for alcohol
toxicity, MCF-7 cells were treated with ethanol for 24 h and
assayed using: (a) the MTT assay, a spectrohotometric assay
of cell viability based on the ability of intact mitochondria to reduce
a tetrazolium dye to formazan; and (b) agarose gel
electrophoresis to assess the presence of low molecular weight
interoligosomal DNA fragments ("DNA ladders") characteristic of
apoptosis.
At <100 mM of ethanol, cell viability determined by the
MTT assay was >95%; whereas concentrations
100 mM of
ethanol caused a dose-dependent reduction of cell viability from 90%
(100 mM) down to 65% (500 mM). Agarose gel
electrophoresis revealed apoptotic DNA ladders at ethanol
concentrations
100 mM, with little or no evidence of
laddering at lower doses of ethanol (data not shown). These findings
suggest that toxicity is not a major contributory factor to
ethanol-induced cellular alterations at concentrations <100
mM of ethanol.
Alcohol Partially Reverses the BRCA1-mediated Inhibition of ER-
Transcriptional Activity.
We recently reported that BRCA1 inhibits ER-
signaling in various
human breast cancer cell lines, including MCF-7 and T47D cells
(11)
. To determine whether ethanol could overcome the
BRCA1-mediated repression of ER-
activity, ER-
/ERE-TK-Luc
transcriptional assays were performed in MCF-7 cells cotransfected
without or with a wtBRCA1 expression vector. In the experiment shown in
Fig. 2A
, E2 induced a 60-fold increase in luciferase activity
(relative to the -E2 control), and wtBRCA1 caused inhibition of
E2-stimulated ER-
activity nearly down to the -E2 control levels.
E2-stimulated ER-
activity (relative luciferase activity of 40) was
observed in wtBRCA1-transfected cells exposed to ethanol (100
mM), suggesting that ethanol opposes the
BRCA1-mediated repression.
|
activity in wtBRCA1-transfected
cells, the relative luciferase activity was much lower in
wtBRCA1-transfected, ethanol-treated cells (40) than in nontransfected,
ethanol-treated cells (
700). Stated in other terms, over-expression
of wtBRCA1 blocked the ability of ethanol to stimulate ER-
activity. As illustrated in the plasmid dose-response study in Fig. 2B
activity in the presence of 100 mM of ethanol,
ultimately down to or below the positive control (+E2, 0 ethanol) level
in MCF-7 cells.
Alcohol Down-Regulates BRCA1 and Up-Regulates ER-
Expression in
MCF-7 Cells.
Subconfluent proliferating MCF-7 cells were incubated with different
doses of ethanol for 24 h and then harvested for Western blotting,
to determine the effect on the levels of BRCA1, ER-
, and other
proteins. Protein bands were quantitated by densitometry and expressed
relative to
-actin, as the control. This experiment revealed a
dose-dependent decrease in BRCA1 to <5% of control and a
dose-dependent increase in ER-
protein by about 3-fold at 100
mM of ethanol (Fig. 3A)
. Alterations in BRCA1 and ER-
protein levels were
observed at ethanol concentrations as low as 2040
mM. These concentrations are within the range of
blood alcohol levels achieved by acute alcohol consumption: a blood
alcohol level of 0.2% ("legally drunk") corresponds to 43
mM ethanol. Furthermore, these ethanol
concentrations are below the threshold required to cause cytotoxicity
of MCF-7 cells (100 mM; see below). In contrast
to BRCA1 and ER-
, levels of the proapoptotic protein Bax, the
antiapoptotic protein Bcl-2, and
-actin were unchanged.
|
20
mM, with no change in mRNA levels of the control gene,
ß-actin (Fig. 3B)| Discussion |
|---|
|
|
|---|
The role of alcohol as a mammary carcinogen is suggested by epidemiological studies, but there are, as yet, no compelling data to indicate a mechanism for alcohol-induced breast cancer (reviewed in Ref. 8 ). Furthermore, the mechanism of alcohol-induced breast cancer may be different from that of head and neck cancers, in which the primary carcinogens may originate as procarcinogens in tobacco smoke. Our studies suggest a potential mechanistic linkage of alcohol and breast cancer by documenting effects of ethanol on two molecular pathways directly related to breast cancer: estrogen response and BRCA1 function.
Thus, ethanol stimulated the transcriptional activity of the
liganded estrogen receptor (ER-
) in human breast cancer cell lines,
although it did not cause de novo activation of ER-
in
the absence of the ligand, estrogen. The stimulation of ER-
activity
by ethanol was observed at concentrations of ethanol comparable with
those achieved during intoxication. Thus, 40 mM
ethanol, which gave a significant stimulation of ER-
in MCF-7 and
T47D cell cultures, corresponds to a blood alcohol level of about 0.2.
Stimulation of ER-
activity was observed at ethanol doses lower than
the threshold for cytoxicity (about 100 mM in
MCF-7 cells); and ethanol did not induce the activation of two other
cellular transcription factors: E2F1 and Sp1. Taken together, these
findings suggest that ethanol may cause physiologically relevant
stimulation of ER-
activity, and that the stimulation is not
attributable to nonspecific actions.
Mutations of the breast cancer susceptibility gene BRCA1 (17q21) confer an increased risk for breast and ovarian cancers (9 , 19) . BRCA1 encodes an 1863 amino acid, 220 kDa nuclear phospho-protein with an N-terminal RING finger domain that interacts with cell cycle proteins and an acidic COOH-terminal transcriptional activation domain (9 , 20 , 21) . BRCA1 plays roles in cell cycle regulation, apoptosis, and DNA repair and recombination pathways that may be related to its tumor suppressor function (reviewed in Ref. 22 ). The finding that ethanol down-regulates the mRNA and protein levels of BRCA1 in human breast cancer cells suggests a second possible mechanism linking ethanol to breast cancer: i.e., down-regulation of the BRCA1 tumor suppressor gene. Interestingly, a significant fraction of sporadic human breast cancers contain decreased levels of immunoreactive BRCA1 (23) , suggesting that decreased BRCA1 expression is a mechanism through which sporadic breast cancers may escape the control of this tumor suppressor in the absence of an inactivating mutation.
The ability of ethanol to up-regulate ER-
expression and to
down-regulate BRCA1 expression may each contribute to the stimulation
of ER-
transcriptional activity. It is unlikely that the increase in
ER-
activity could be explained solely by an increased level of
ER-
protein, for several reasons: (a) the increase in
ER-
activity in the transcriptional assays (
10-fold at 100
mM ethanol) was greater than the increase in
ER-
protein (
3-fold at 100 mM ethanol); and
(b) although we did not measure ER-
protein levels in the
transcriptional assays, an ER-
expression vector was used to
equalize ER-
levels to the extent possible in cells treated without
or with ethanol.
Inasmuch as BRCA1 is a potent repressor of ER-
transcriptional
activity (11)
, the ethanol-mediated down-regulation of
BRCA1 expression could contribute to increased intrinsic activity of
ER-
independently of any changes in ER-
levels. In this study,
ethanol partially overcame the inhibition of ER-
activity caused by
overexpression of a wtBRCA1 gene; and conversely, expression
of the wtBRCA1 gene caused dose-dependent loss of ER-
activity in the presence of ethanol.
In evaluating these findings, it should be noted that we do not
know what levels of ethanol are achieved in human mammary tissue after
alcohol ingestion; nor do we know if the effects of acute
versus chronic ethanol exposure on ER-
function are
different. However, previous studies indicate that relatively high
levels of ethanol (4488% of serum levels) accumulate in the milk of
lactating rats (24)
, and it is well established that
sufficiently high levels of toxins, including alcohol, cocaine, etc.,
can be found in human breast milk to cause toxicity or even death to
the baby (25
, 26)
. These considerations suggest that
ethanol may accumulate in considerable levels in the mammary tissue.
The molecular mechanisms underlying the ethanol-induced alterations of
ER-
activity and BRCA1 expression and their significance need to be
elucidated further. However, this study suggests that decreased
expression of BRCA1 and increased estrogen-responsiveness might
contribute to alcohol-induced breast cancer, and it provides directions
for additional research.
| FOOTNOTES |
|---|
1 This research was supported in part by research
grants from the USPHS (R01-ES09169, RO1-CA-80000, and R01-CA82599), the
Elsa U. Pardee Cancer Foundation of Michigan, the New York State
Department of Health, and the United States Army Breast Cancer Research
Program (DAMD17-99-1-9254 and BC980064). ![]()
2 To whom requests for reprints should be
addressed, at Department of Radiation Oncology, Long Island Jewish
Medical Center, The Long Island Campus for the Albert Einstein College
of Medicine, 270-05, 76th Avenue, New Hyde Park, NY 11040. Phone: (718)
470-7456; Fax: (718) 470-9756; Email: fan{at}lij.edu ![]()
3 ER, estrogen receptor; wt, wild type; MTT,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide;
ERE, estrogen-responsive enhancer; RT-PCR, reverse transcription-PCR. ![]()
Received 6/13/00. Accepted 8/30/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Q. Lew, N. D. Freedman, M. F. Leitzmann, L. A. Brinton, R. N. Hoover, A. R. Hollenbeck, A. Schatzkin, and Y. Park Alcohol and Risk of Breast Cancer by Histologic Type and Hormone Receptor Status in Postmenopausal Women: The NIH-AARP Diet and Health Study Am. J. Epidemiol., August 1, 2009; 170(3): 308 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Deandrea, R. Talamini, R. Foschi, M. Montella, L. Dal Maso, F. Falcini, C. La Vecchia, S. Franceschi, and E. Negri Alcohol and Breast Cancer Risk Defined by Estrogen and Progesterone Receptor Status: A Case-Control Study Cancer Epidemiol. Biomarkers Prev., August 1, 2008; 17(8): 2025 - 2028. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Venkata, C. S. Aung, P. J. Cabot, G. R. Monteith, and S. J. Roberts-Thomson PPAR{alpha} and PPAR{beta} Are Differentially Affected by Ethanol and the Ethanol Metabolite Acetaldehyde in the MCF-7 Breast Cancer Cell Line Toxicol. Sci., March 1, 2008; 102(1): 120 - 128. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Zhang, I-M. Lee, J. E. Manson, N. R. Cook, W. C. Willett, and J. E. Buring Alcohol Consumption and Breast Cancer Risk in the Women's Health Study Am. J. Epidemiol., March 15, 2007; 165(6): 667 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Andrieu, D. E. Goldgar, D. F. Easton, M. Rookus, R. Brohet, A. C. Antoniou, S. Peock, G. Evans, D. Eccles, F. Douglas, et al. Pregnancies, breast-feeding, and breast cancer risk in the International BRCA1/2 Carrier Cohort Study (IBCCS). J Natl Cancer Inst, April 19, 2006; 98(8): 535 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Suzuki, W. Ye, T. Rylander-Rudqvist, S. Saji, G. A. Colditz, and A. Wolk Alcohol and Postmenopausal Breast Cancer Risk Defined by Estrogen and Progesterone Receptor Status: A Prospective Cohort Study J Natl Cancer Inst, November 2, 2005; 97(21): 1601 - 1608. [Abstract] [Full Text] [PDF] |
||||
![]() |
E M Rosen, S Fan, and C Isaacs BRCA1 in hormonal carcinogenesis: basic and clinical research Endocr. Relat. Cancer, September 1, 2005; 12(3): 533 - 548. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Hilakivi-Clarke, C Wang, M Kalil, R Riggins, and R G Pestell Nutritional modulation of the cell cycle and breast cancer Endocr. Relat. Cancer, December 1, 2004; 11(4): 603 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Dumeaux, E. Lund, and A. Hjartaker Use of Oral Contraceptives, Alcohol, and Risk for Invasive Breast Cancer Cancer Epidemiol. Biomarkers Prev., August 1, 2004; 13(8): 1302 - 1307. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cabanes, M. Wang, S. Olivo, S. DeAssis, J.-A. Gustafsson, G. Khan, and L. Hilakivi-Clarke Prepubertal estradiol and genistein exposures up-regulate BRCA1 mRNA and reduce mammary tumorigenesis Carcinogenesis, May 1, 2004; 25(5): 741 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-Y. Wang, R. Fulthorpe, S. N. Liss, and E. A. Edwards Identification of Estrogen-Responsive Genes by Complementary Deoxyribonucleic Acid Microarray and Characterization of a Novel Early Estrogen-Induced Gene: EEIG1 Mol. Endocrinol., February 1, 2004; 18(2): 402 - 411. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. I. Li, K. E. Malone, P. L. Porter, N. S. Weiss, M.-T. C. Tang, and J. R. Daling The Relationship between Alcohol Use and Risk of Breast Cancer by Histology and Hormone Receptor Status among Women 65-79 Years of Age Cancer Epidemiol. Biomarkers Prev., October 1, 2003; 12(10): 1061 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Singletary and S. M. Gapstur Alcohol and Breast Cancer: Review of Epidemiologic and Experimental Evidence and Potential Mechanisms JAMA, November 7, 2001; 286(17): 2143 - 2151. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. L. Bhat, D. Lantvit, K. Christov, R. G. Mehta, R. C. Moon, and J. M. Pezzuto Estrogenic and Antiestrogenic Properties of Resveratrol in Mammary Tumor Models Cancer Res., October 1, 2001; 61(20): 7456 - 7463. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |