Cancer Research Meeting Calendar  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wijnhoven, S. W. P.
Right arrow Articles by van Steeg, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wijnhoven, S. W. P.
Right arrow Articles by van Steeg, H.
[Cancer Research 60, 5681-5687, October 15, 2000]
© 2000 American Association for Cancer Research


Carcinogenesis

The Relationship between Benzo[a]pyrene-induced Mutagenesis and Carcinogenesis in Repair-deficient Cockayne Syndrome Group B Mice1

Susan W. P. Wijnhoven, Hanneke J. M. Kool, Conny T. M. van Oostrom, Rudolf B. Beems, Leon H. F. Mullenders, Albert A. van Zeeland, Gijsbertus T. J. van der Horst, Harry Vrieling2 and Harry van Steeg

Department of Radiation Genetics and Chemical Mutagenesis-MGC, Leiden University Medical Center, 2300 RA Leiden [S. W. P. W., L. H. F. M., A. A. v. Z., H. V.]; National Institute of Public Health and the Environment (RIVM), Laboratory of Health Effects Research, Department of Carcinogenesis, Mutagenesis and Genetics, [C. T. M. v. O., H. v. S.], Laboratory of Pathology and Immunobiology [R. B. B.], 3720 BA Bilthoven; Department of Cell Biology and Genetics-MGC, Erasmus University Rotterdam, 3000 DR Rotterdam [H. J. M. K., G. T. J. v. d. H.]; and J. A. Cohen Institute, Inter-University Institute for Radiopathology and Radiation Protection, 2300RA Leiden [L. H. F. M., A. A. v. Z., H. V.], the Netherlands


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 Materials and Methods
 RESULTS
 DISCUSSION
 REFERENCES
 
Cockayne syndrome (CS) patients are deficient in the transcription coupled repair (TCR) subpathway of nucleotide excision repair (NER) but in contrast to xeroderma pigmentosum patients, who have a defect in the global genome repair subpathway of NER, CS patients do not have an elevated cancer incidence. To determine to what extent a TCR deficiency affects carcinogen-induced mutagenesis and carcinogenesis, CS group B correcting gene (CSB)-deficient mice were treated with the genotoxic carcinogen benzo(a)pyrene (B[a]P) at an oral dose of 13 mg/kg body weight, three times a week. At different time points, mutant frequencies at the inactive lacZ gene (in spleen, liver, and lung) as well as at the active hypoxanthine phosphoribosyltransferase (Hprt) gene (in spleen) were determined to compare mutagenesis at inactive versus active genes. B[a]P treatment gave rise to increased mutant frequencies at lacZ in all of the organs tested without a significant difference between CSB-/- and wild-type mice, whereas B[a]P-induced Hprt mutant frequencies in splenic T-lymphocytes were significantly more enhanced in CSB-/- mice than in control mice. The sequence data obtained from Hprt mutants indicate that B[a]P adducts at guanine residues were preferentially removed from the transcribed strand of the Hprt gene in control mice but not in CSB-/- mice. On oral treatment with B[a]P, the tumor incidence increased in both wild-type and CSB-deficient animals. However, no differences in tumor rate were observed between TCR-deficient CSB-/- mice and wild-type mice, which is in line with the normal cancer susceptibility of CS patients. The mutagenic response at lacZ, in contrast to Hprt, correlated well with the cancer incidence in CSB-/- mice after B[a]P treatment, which suggests that mutations in the bulk of the DNA (inactive genes) are a better predictive marker for carcinogen-induced tumorigenesis than mutations in genes that are actively transcribed. Thus, the global genome repair pathway of NER appears to play an important role in the prevention of cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 Materials and Methods
 RESULTS
 DISCUSSION
 REFERENCES
 
NER3 is a universal and versatile repair process capable of removing a large variety of DNA lesions from the genome, including UV-induced lesions and bulky chemical adducts. The NER process entails multiple steps, i.e., DNA damage recognition and demarcation, chromatin-remodeling, endonuclease-mediated incision at both sides of the lesion and release of the damaged oligonucleotide, followed by gap-filling DNA synthesis and ligation (1, 2, 3) . Although NER acts on the entire genome, a clear heterogeneity exists in the efficiency of repair in different parts of the genome for at least some types of lesions. In general, a priority exists for the elimination of DNA injury from active genes (4 , 5) . The NER pathway can be divided into two, partly overlapping, subpathways, i.e., the TCR pathway that preferentially repairs lesions in the transcribed strand of active genes and the GGR pathway, which is responsible for the repair of lesions in the remaining part of the genome. Approximately 30 different proteins are involved in NER, and defects in a single NER protein can have severe biological effects.

In humans, inherited defects in NER proteins are associated with at least three different photosensitive disorders: XP, CS, and TTD. Complementation studies with patient cell lines have revealed the existence of seven genes in XP (XPA-XPG), two in CS (CSA-CSB) and one in TTD (TTDA; Ref. 6 ).

In the NER pathway, both the XPA and XPC protein are involved in damage recognition. The XPA protein is involved in both subpathways of NER. Therefore, cells from XP-A patients are defective in both TCR and GGR. Because the XPC protein is necessary only for damage recognition in the global genome repair subpathway, cells from XP-C patients lack GGR but have normal TCR. XP patients have a >2000-fold increment in all forms of skin cancer, on the sun-exposed areas of the skin. The frequency of cancer is also elevated in some internal tissues, but to a much lesser extent (1 , 6) . Cells derived from CS patients display a selective defect in the TCR pathway, whereas GGR is unaffected (7 , 8) . CS patients typically suffer from developmental and neurological abnormalities, including neuro-dysmyelination, immature sexual development, mental retardation, and impaired physical development. Death results from a progressive neurological degeneration, in most cases before the age of 20. In CS patients, the skin is photosensitive, but in contrast to XP patients, CS patients have not been reported to develop skin cancer at an increased rate (9) .

Because cancer development is an in vivo process in which somatic mutations accumulate, the question arises whether the differences in cancer susceptibility between XP-A and XP-C on one hand and CS-B on the other, are reflected by differences in the extent of mutation induction and the kind of somatic mutations that occur. Mouse mutants, in which in vivo mutagenesis and carcinogenesis studies can be performed, have recently been generated for XP-A, XP-C and CS-B (10, 11, 12, 13) . XPA- and XPC-deficient mice clearly mimic the human XP disorder with respect to skin cancer predisposition (10, 11, 12 , 14) . CSB-deficient mice have a repair defect similar to the human syndrome but do not display the characteristic hallmarks of CS as dramatically as the human patients, inasmuch as only minor growth disturbance and neurological deficits have been noted (13) . In addition, CSB-/- mice, in contrast to CS patients, appeared to be cancer-prone after UV exposure. However, compared with XPA-/- and XPC-/- mice, a higher cumulative dose of UVB and a longer latency time is required in CSB-/- mice before they develop skin cancer (13) .

Previously, we have studied the relationship between carcinogen-induced DNA damage, induction of somatic mutations, and tumorigenesis in a complete NER-deficient background (15) . XPA-deficient mice were exposed to the mutagenic chemical B[a]P, which in mammalian cells is metabolized to the reactive metabolite BPDE. This reactive metabolite induces predominantly adducts at the N2 position of guanine and is known to be a potent carcinogen in rodents (15, 16, 17, 18) . BPDE-N2-dG adducts are mutagenic lesions (19) and substrate for NER in human cells (20) . A subchronical, oral B[a]P treatment of XPA-/- mice gave rise to enhanced MFs, both in the endogenous, transcriptionally active Hprt gene in splenic T-lymphocytes (21) and the inactive prokaryotic lacZ marker gene in the spleen (22) . Furthermore, XPA-/- mice appeared to be more susceptible to the carcinogenic effects of B[a]P resulting in an increased frequency of lymphomas compared with heterozygous or wild-type littermates (15) .

In this study, the effect of a deficiency in the TCR subpathway of NER on B[a]P-induced mutagenesis and carcinogenesis was investigated. Therefore, CSB-/- mice that are defective in TCR and can only perform GGR were subchronically exposed to B[a]P. After different exposure times, MFs were determined at both the Hprt and LacZ gene to compare mutation induction in an endogenous active gene with that in inactive DNA. The nature of B[a]P-induced Hprt mutations was determined to monitor a possible effect of the TCR deficiency on mutation strand specificity. Finally, tumor formation in B[a]P-treated CSB-deficient, heterozygous CSB+/- and wild-type mice was determined.

Whereas B[a]P-induced mutation induction at Hprt was enhanced in CSB-/- mice compared with wild-type mice, induction at LacZ was similar in all of the genotypes. Tumor incidences increased similarly in TCR-deficient CSB-/- mice and wild-type mice on B[a]P-treatment. Mutations in the bulk of the DNA seem to be a better predictive marker for carcinogen-induced tumorigenesis than mutations in genes that are actively transcribed.


    Materials and Methods
 Top
 ABSTRACT
 INTRODUCTION
 Materials and Methods
 RESULTS
 DISCUSSION
 REFERENCES
 
Mice
The generation of CSB mice has been described elsewhere (13) . For the B[a]P-induced carcinogenesis study, heterozygous CSB+/- mice that were in a mixed hybrid genetic background (Ola129-FVB-C57Bl/6) were intercrossed. Mice having a CSB+/+ or CSB+/- genotype were considered to be wild type, and results obtained with these genotypes were pooled.

CSB mice used in the Hprt mutation analysis experiments were all in C57Bl/6 genetic background (F8 generation) and were derived from crosses between heterozygous CSB+/- and homozygous knockout CSB-/- mice. Genotyping of mice was performed by PCR analysis of DNA isolated from tail tips. DNA isolation was carried out by the salting-out technique as described previously (23) . The three different PCR primers used were: CSB4, 5'-GCTGCTTATAATAATCCTCATCTCC-3'; CSB5, 5'-ATCTGCGTGTTCGAATTCGCCAATG-3'; and CSB6, 5'-GTCTTCTGATGACGTTAGCTATGAG-3'.

The PCR reaction was performed in a mix containing 6.7 mM MgCl2, 16.6 mM (NH4)2SO4, 5 mM 2-mercaptoethanol, 6.8 mM EDTA, 67 mM Tris-HCl (pH 8.8), 10% DMSO, 0.2 mM each of the four deoxyribonucleotide triphosphates, 20 pmol of each of the PCR primers, and 1.5 units of Amplitaq polymerase (Perkin-Elmer) in a total volume of 50 µl. After an initial denaturing step at 93°C for 5 min, 35 cycles of PCR were performed (1 min at 94°C, 1 min at 57°C, and 3 min at 72°C) in a Thermal Cycler (Perkin-Elmer).

The targeted allele (CSB6-CSB5) was identified as a 490-bp PCR product and the wild-type allele (CSB6-CSB4) as a 195-bp PCR product. In the lacZ mutation analysis experiments, both CSB-/- and CSB+/+ mice were crossed with C57Bl/6 pUR288 transgenic mice (line 60; Ref. 24 ). The primers used to detect the presence of the lacZ transgenes were: for lacZ 5', 5'-TGGCGTTACCCAACTTAATCGCCTTG-3'; and for lacZ 3': 5'-ATAACTGCCGTCACTCCAACGCAGCA-3'. Amplification of the lacZ gene gave rise to a fragment of approximately 500 bp.

Chronic Exposure of Mice to B[a]P
Wild-type (CSB+/+) and heterozygous (CSB+/-) mice were considered as being wild type for NER. Unless stated otherwise, no discrimination will be made between these genotypes.

B[a]P was given to young adult mice (6–9 weeks old) being either wild type or CSB-/-. The mice were treated 3 times per week during 13 weeks by oral gavage at a dose of 13 mg/kg body weight. Control animals (both genotypes, both sexes) received only the solvent (0.1 ml soy oil). Body weights were recorded every 2 weeks, and the B[a]P stock solution concentrations were calculated accordingly. Total mice used were: untreated wild type, 14 males and 13 females; untreated CSB-/-, 6 males and 7 females; B[a]P-treated wild type, 18 males and 11 females; and B[a]P-treated CSB-/-, 6 males and 6 females.

All of the mice were monitored daily for a total observation period of 52 weeks starting from the beginning of the treatment. Animals that were moribund because of the treatment were killed, as were all of the surviving mice at the end of the observation period. All of the tissues were collected for histopathological analysis. Samples were embedded in paraffin wax and cut into 5-µm sections and were finally stained with H&E.

Short-Term B[a]P Treatment of Mice
Short-term treatment with B[a]P was performed using 8–10-week-old mice of both sexes. Mice were treated as described above with a dose of 13 mg/kg body weight B[a]P dissolved in 0.1 ml of soy-oil, three times a week during 0, 5, 9, or 13 weeks. For the Hprt MF analysis, mice were killed 3 weeks after the last treatment. The number of treated animals in the different dose groups varied between 5 and 7 mice. The control groups of mice consisted of 5 CSB-/- (2 male and 3 female) mice and 7 CSB+/- (4 male and 3 female) mice that received the solvent only for 9 weeks. For the lacZ MF analysis, mice were killed 3 days after the last treatment. The lacZ MF was determined in 6 animals (3 males and 3 females). From control groups in this lacZ experiment, two mice of each genotype were killed at 5 and 9 weeks after start of the treatment (in total, 2 males and 2 females). Body weights were recorded biweekly, and concentrations of B[a]P were calculated according to these weights. Splenocytes were isolated directly from the sacrificed animal for Hprt mutation analysis and were stored at -80°C. Collected tissues for lacZ mutation analysis were frozen at -80°C prior to DNA isolation.

lacZ Mutation Analysis
Genomic DNA was isolated from tissues as described by Dollé et al. (25) . A detailed description of rescuing pUR288 plasmids from genomic mouse DNA and electroporation of rescued plasmids into electro-competent Escherichia coli cells strain C ({Delta}lacZ, galE-; Ref. 26 ) was provided previously (22) .

Isolation and Culturing of Splenic T-Lymphocytes
Priming and cloning of T-lymphocytes was performed in a culture medium as described by Tates et al. (27) with some minor modifications. The serum-free medium DCCM-1 was replaced by AIM-V (Life Technologies, Inc.) To the medium, antibiotics were added: 100 units/ml penicillin and 100 µg/ml streptomycin sulfate.

Additional details about the isolation, freezing, and thawing of mouse splenocytes as well as the priming of the cells with Concavalin A and the selection of the Hprt-deficient mutants with 6-thioguanine have been described previously (28) . Calculation of cloning efficiencies and MFs was performed as described by Tates et al. (27) .

Molecular Characterization of 6-TG-resistant T-Lymphocyte Clones
Isolation of Hprt Mutant Clones.
6-TG-resistant clones were selected from 10 CSB-/- mice and 10 CSB+/- heterozygous littermates. The clones were diluted 1:3 in culture medium containing 6-TG (2.5 µg/ml). After 3–4 days of culturing, cells were collected and centrifuged, and cell pellets were washed with PBS and either frozen at -80°C or directly processed to isolate RNA.

RNA Extraction and cDNA Synthesis.
For RNA isolation, the cells were lysed in 100 µl of TRIzol (Life Technologies), and, subsequently, chloroform extraction was performed after the addition of 40 µl of pure chloroform. After precipitation of the RNA by adding 30 µl of isopropanol and subsequent centrifugation for 5 min at 4°C, the pellet was washed with 100 µl of ethanol 70%, after which it could be stored at -20°C. RNA was resuspended in 18 µl of anneal buffer [250 mM KCl, 10 mM Tris-HCl (pH 8.3), and 1 mM EDTA] and, together with 40 pmol of Hprt-cDNA primer (GCAGCAACTGACATTTCTAAA), was incubated at 65°C for 3 min to allow annealing of the primer to the Hprt mRNA strand. After this, the sample was split in two, and cDNA synthesis was performed as described previously (29) .

Amplification of Hprt cDNA by the PCR.
Three µl of synthesized cDNA was used to amplify the coding region of the Hprt gene in a total volume of 100 µl containing 20 µl of a 5x PCR buffer [500 mM KCl, 100 mM Tris-HCl (pH 8.3), 15 mM MgCl2], 4 µl of a dNTP mix (2.5 mM), 1 unit of Amplitaq polymerase (Perkin-Elmer), and 20 pmol of each of the PCR primers. For the first round of amplification the PCR primers were hprt-mus2 (AAAAAGCTTTACTAGGCAGATGG) and zee1-mus (GGCTTCCTCC TCAGAC CGT). After an initial denaturation step for 5 min at 93°C, 35 cycles of PCR were performed (1 min at 94°C, 1 min at 50°C, and 3 min at 72°C), followed by a final extension step of 8 min at 72°C. One µl of amplified DNA was used in a reamplification reaction of 25 cycles with an annealing temperature of 55°C using primers hprt-mus1 (TTTTTGCCGCGAGCCGACC) and san2m13 (CGACGTTGTAAAACGACGGCCAGTG CAGATTCAACTTGCGCTC). Ten µl of the reamplified DNA was used for sequence analysis with the Thermo Sequenase fluorescent labeled primer cycle sequencing kit containing 7-deaza-dGTP (Amersham/Pharmacia/Biotech) on an automated laser fluorescence sequencer (Amersham).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 Materials and Methods
 RESULTS
 DISCUSSION
 REFERENCES
 
B[a]P-induced lacZ MFs.
To study the effect of B[a]P treatment on mutation induction at the inactive prokaryotic lacZ gene, we crossed CSB-/- (Ola129/FVB genetic background, 13) with transgenic mice (pUR288, C57Bl/6 genetic background, 24) containing a lacZ reporter gene. Mice that were heterozygous for both the CSB mutation and the lacZ reporter gene (CSB+/-/lacZ+/-) were subsequently crossed with CSB-/- mice. The offspring with a CSB-/-/lacZ+/- and CSB+/-/lacZ+/- genotype were subchronically exposed to B[a]P for 5, 9, or 13 weeks (13 mg/kg body weight, 3 times a week). After 5, 9, or 13 weeks of exposure, lung, liver, and spleen were collected, and total genomic DNA was isolated. The lacZ MF was determined at each time point in three males and three females and was compared with that of untreated control mice. From Table 1Citation and Fig. 1ACitation , it is clear that the lacZ MF increased gradually in all of the organs tested and that there was no significant difference between the two different genotypes. The increase was dose-dependent and ranged from 5 to 8 x 10-5 in untreated mice up to ~60 x 10-5 in wild-type (CSB+/-) and in CSB-/- mice that had been treated with B[a]P for 13 weeks.


View this table:
[in this window]
[in a new window]

 
Table 1 LacZ mutant frequencies in tissues of B[a]P-treated CSB-/- and wild-type mice

For treating procedures and calculation of the lacZ mutant frequencies, see "Materials and Methods" section and Fig. 1Citation legend. Values are depicted as mean mutant frequencies (x 10-5) ± SD and were determined in four different untreated mice (two males and two females) or in six treated mice (three males and three females).

 


View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. In vivo mutagenicity of B[a]P in spleen of wild-type and NER-deficient mice. MFs were determined after B[a]P treatment for different time periods (i.e., 0, 5, 9, and 13 weeks), both at the inactive lacZ gene (A and B) and at the active Hprt gene (C and D). {square}, MFs in wild-type mice; {blacksquare}, MFs in NER-deficient mice. A and C, MFs in CSB-deficient mice compared with wild-type mice; B and D, MFs in XPA-deficient mice and wild-type mice as described previously (21 , 22) .

 
These lacZ mutagenicity data are in good agreement with previously obtained results for the same tissues of B[a]P-treated wild-type mice (15 , 30) . However, in these studies, a clearly enhanced lacZ MF was found in spleens of totally NER-deficient XPA-/- mice compared with wild-type mice [(i.e., MF 94 x 10-5 compared with MF 48 x 10-5 in spleens of 13-week-treated wild-type mice (see Fig. 1BCitation ); Ref. 15 ].

B[a]P-induced Hprt MFs.
To detect a possible effect of a deficiency in TCR on mutagenesis, mutation studies have to be performed in a gene that is actively transcribed. Therefore, MFs were determined at the X-chromosomal Hprt gene in splenic T-lymphocytes. For these experiments, CSB-/- and heterozygous (CSB+/-) mice (C57Bl/6 genetic background, F8 generation) were exposed to B[a]P for 5, 9, and 13 weeks. Three weeks after the final treatment, splenocytes were isolated, and Hprt MFs were determined at the different time points (Fig. 1CCitation ; Table 2Citation ).


View this table:
[in this window]
[in a new window]

 
Table 2 Hprt mutant frequencies found in splenic T-lymphocytes of CSB-/- and wild-type mice exposed to B[a]P in vivo

 
The mean cloning efficiency (cloning efficiency ± SE, Table 2Citation ) per dose-group varied between 17.5 (±1.2%) and 22.5 (±1.7%), and was not influenced by the B[a]P exposure or the CSB genotype. The background MF of 0.5 ± 0.3 x 10-6 in CSB+/- mice and 0.9 ± 0.6 x 10-6 in CSB-/- mice is in the normal range of Hprt spontaneous MFs in the mouse (31) . After treatment with B[a]P, both CSB-deficient and heterozygous CSB+/- mice showed a clear dose-dependent increase in Hprt MF compared with untreated mice of the same genotype. However, B[a]P was significantly more mutagenic at Hprt in the CSB-deficient mice than in heterozygous littermates at the two latest time points (Fig. 1CCitation ; Table 2Citation ). A somewhat more pronounced mutation response was previously found at Hprt in T-lymphocytes of B[a]P-treated XPA mice that were deficient in both TCR and GGR of NER (Fig. 1DCitation ; Ref. 21 ).

Hprt Mutational Spectrum Analysis.
The metabolically active form of B[a]P, BPDE, is known to form bulky adducts at purines in the DNA, predominantly at guanine residues. B[a]P diolepoxide adducts are preferentially and strand-specifically repaired from the HPRT gene of human diploid fibroblasts (32) . For mouse cells, it is still unknown whether BPDE-induced lesions are repaired preferentially and strand-specifically. As described above, we observed a significantly larger increase in MF in B[a]P-treated CSB-deficient mice that are unable to perform TCR than in heterozygous CSB+/- littermates, which suggests that BPDE adducts in the transcribed strand of Hprt are preferentially repaired by TCR. To investigate whether the mutational spectrum of B[a]P-induced mutants as well as the strand specificity of mutations was influenced by the CSB deficiency, 6-TG-resistant clones of untreated as well as B[a]P-treated mice of both genotypes were subcultured and further processed for DNA sequencing analysis.

In all, 62 Hprt mutants of CSB-/- mice and 36 Hprt mutants of CSB+/- mice that had been treated for 9 and 13 weeks were sequenced (Table 3)Citation . Identical mutations found within one animal, were considered to result from clonal expansion. Both in the group of CSB-/- and CSB+/- mutants, ~50% of the mutants contained independent mutations (Table 3)Citation . Furthermore, also in untreated mice, clonal expansion of mutant cells was observed. Therefore, clonal expansion occurred frequently in mice, regardless of the CSB genotype and the B[a]P treatment. Among the independent mutations, 17 (53%) of the CSB-/- mutants and 15 (75%) of the CSB+/- mutants were bp substitutions, and 9 (28%) of the CSB-/- mutants and 3 (15%) of the CSB+/- mutants were splice mutations, in which one or more exons were lacking from the amplified Hprt-cDNA (Table 3)Citation . The majority of the recovered base substitutions were GC->TA transversions, both in CSB-/- and CSB+/- (6 of 17 and 9 of 15, respectively). In the CSB -/- group, other base substitutions also occurred frequently, which resulted in a more diverse mutational spectrum than in the CSB+/- group. If we assume that base substitutions at G residues were caused by mutational bypass of N2-G-BPDE adducts, then the location of the adducted G and, subsequently, a possible strand-specificity of repair can be determined. In all of the 13 mutants of CSB+/- mice containing a G mutation, the G was present in the nontranscribed strand, whereas in CSB-/- mice, 2 of 12 Hprt mutants were presumably caused by an adducted G in the transcribed strand.


View this table:
[in this window]
[in a new window]

 
Table 3 Mutational spectrum of Hprt mutations in T-lymphocytes of CSB mice exposed to B[a]Pa

 
Surprisingly, a substantial fraction of the mutant clones did not carry a detectable mutation, especially in the CSB-/- group (11 mutants isolated from 3 different mice). We assume that this is the result of the loss of the Hprt gene or from mutations that result in unstable mRNA and that the reverse transcription-PCR reaction is amplifying contaminating wild-type mRNA from feeder cells or nonmutant T-lymphocytes. This phenomenon has been described previously for both the Tk and Hprt gene (33 , 34) .

B[a]P-induced Tumors in CSB- and Wild-Type Mice.
One of the most intriguing differences between patients affected by XP and those with CS is that patients with XP develop sunlight-induced skin cancers at a much higher frequency than normal individuals, whereas CS patients do not exhibit an increased tumor incidence. We have previously shown (13) that CSB mice, in contrast to CS patients, do have a predisposition to develop UV-induced skin cancer, although to a much weaker extent than XPA-deficient mice.

To further explore the issue of cancer predisposition in CS, we exposed CSB mice to B[a]P p.o. Mice were treated by gavage at a dose of 13 mg/kg body weight, three times a week for a total period of 13 weeks. The same dose regimen was used previously in an experiment with XPA-deficient mice (15) . After the treatment was stopped, we followed the mice for another 39 weeks to monitor tumor development. The results of this study are summarized in Table 4Citation . The B[a]P dose used, appeared to be carcinogenic to both wild-type- and CSB-/- mice. Of the wild-type mice 17 (59%) of 29 developed tumors, which is significantly higher (P = 0.0023; Fisher’s one-sided exact test) compared with the untreated control mice, of which 5 (19%) of 27 developed tumors during the same observation period of 52 weeks. In untreated CSB-/- mice (n = 13), we did not find any tumors, but after B[a]P treatment, tumor incidence in CSB-/- mice was significantly enhanced statistically (P = 0.0017); 7 (58%) of 12 mice carried tumors. Only two mice died intercurrently because of tumor development—a wild-type B[a]P-treated mouse with forestomach squamous cell carcinoma and a CSB B[a]P-treated mouse with a skin histiocytic sarcoma, at 39 and 37 weeks after start of the treatment, respectively. Consequently, most tumors were discovered at the end of the observation period (52 weeks). The major tumor site was, as expected, the forestomach, followed by lung bronchiolo-alveolar adenomas and (histiocytic) sarcomas (see Table 4Citation ). The tumor spectra of wild-type and CSB mice were essentially the same. However, in contrast to our previous study (15) , we did not observe treatment-related lymphoma induction. Nevertheless, no statistically significant difference in tumor induction between wild-type and CSB-/- mice was found (P = 0.6). Therefore, we can conclude that CSB- and wild-type mice are equally sensitive in terms of tumor development after oral treatment with B[a]P.


View this table:
[in this window]
[in a new window]

 
Table 4 Tumor types found in B[a]P-treated CSB-/- and wild-type micea

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 Materials and Methods
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study, CSB-deficient mice were treated with B[a]P to determine the effect of a deficiency in the TCR subpathway of NER on carcinogen-induced somatic mutations in active and inactive genes as well as on tumor development in internal tissues.

A deficiency in TCR results in a reduced rate of the removal of lesions from the transcribed strand of active genes and, thus, should lead to enhanced mutation induction in actively transcribed genes. In line with this hypothesis, the oral treatment of CSB mice with B[a]P gave rise to a 3-fold enhanced MF at the actively transcribed Hprt gene in CSB-deficient mice compared with their heterozygous littermates. Because the repair efficiency of the GGR subpathway of NER is not diminished in CSB mice, no effect on mutation induction by B[a]P would be expected at transcriptionally inactive loci. Indeed, no increase in the induction of lacZ gene mutations was found in spleen, liver, or lung of B[a]P-treated CSB-/- mice compared with that found in repair-proficient littermates. In contrast, in XPA-/- mice in which NER activity is completely abolished, increased MFs at both the active Hprt gene and the inactive lacZ gene in the spleen were found (21 , 22) . Thus, whereas the increase in MF at the inactive lacZ gene in XPA mice indicates removal of B[a]P adducts by GGR, the elevated MF at Hprt in CSB mice suggests that TCR enhances removal of B[a]P adducts from actively transcribed genes. The effect of mutation induction in the Hprt gene appeared to be more pronounced in XPA mice (21) than in CSB mice, which can be explained by the ability of CSB mice to perform GGR of B[a]P-induced lesions at transcribed genes.

For human diploid fibroblasts, it has been shown that B[a]P-DNA adducts were preferentially removed from the transcribed strand of the HPRT gene (32) , which coincided with a strong strand-specific induction of mutations at adducted guanines in the nontranscribed strand.

To investigate the effect of a TCR deficiency on B[a]P-induced mutation specificity and strand distribution in the mouse, we determined the nature of 32 and 20 independent Hprt mutants from CSB-/- and CSB+/- mice, respectively. The Hprt MF was about 10- to 20-fold above the background (in wild-type and CSB-/- mice, respectively), which indicated that the contribution of spontaneous mutants is negligible and the vast majority of mutations were caused by the treatment.

The predominant types of mutations induced by B[a]P in cultured mammalian cells are base substitutions at G residues (32 , 35) , although at low doses of B[a]P, a significant fraction (38%) of the mutations at the Hprt gene in hamster cells are base changes at A residues (36) . In the present study, the mutational spectra in CSB-/- and CSB+/- mice were quite similar, although the fraction of GC->TA transversions was somewhat lower in the CSB-deficient background than in wild-type mice. Whereas all of the 13 G mutations from CSB+/- mice had the presumed adducted guanine in the nontranscribed strand of Hprt, 2 of 12 G mutations in CSB-/- mice were in the transcribed strand, which indicated preferential removal of B[a]P adducts from the transcribed strand of the Hprt gene in the mouse. In agreement with this result is the recent finding that the high strand-specificity for mutation-induction by BPDE at the Hprt gene in NER-proficient hamster cells (>99% of the G mutations at the nontranscribed strand), disappeared in a NER-deficient background (37) .

On oral B[a]P treatment, tumor incidences increased in both wild-type and CSB-deficient animals, but no significant differences in tumor frequencies were observed in the TCR-deficient CSB-/- mice compared with wild types. In contrast, B[a]P-treated XPA-deficient mice developed internal tumors more rapidly and at higher frequency compared with XPA+/+ and XPA+/- mice (15) . The spontaneous tumor frequency seemed to be lower in CSB-/- mice than in wild-type mice (Table 4)Citation . However, this difference was not statistically significant (P = 0.12, Fisher’s one-sided exact test).

The observation that CSB mice did not show increased cancer frequencies after B[a]P treatment was not unexpected. Human CS patients, in contrast to XP patients, have not been reported to be cancer prone (9) , which suggests that the defect in GGR in XP patients is predominantly responsible for the high cancer frequency. The TCR deficiency of XP-A and CS-B cells on the other hand, has been proposed to be responsible for the induction of p53-dependent apoptosis after UV (38 , 39) and N-acetoxy-2-aminofluorene exposure (40) .

It has previously been reported that CSB-deficient mice, in contrast to human CS patients, show an increased susceptibility to UV-induced skin cancer. However, compared with XPA and XPC mice, a higher cumulative dose of UVB was required and a longer latency time of tumor development was observed in CSB mice (13) . In fact, as recently determined in hairless SKH-HR1 mice exposed to UVB, inactivation of the CSB gene appeared to accelerate the UVB-induced skin carcinogenesis by a factor 2, whereas in XPA and XPC mice, this factor is 4 and 3, respectively (41) . The discrepancy between mouse and human CS could be related to the more efficient repair of CPDs by the GGR pathway in human skin fibroblasts compared with rodents. In contrast to mice, GGR in humans is apparently able to compensate for a defective TCR leading to unchanged cancer predisposition in CS patients. The global genome repair of CPD in human skin fibroblasts is dependent on the p48 xeroderma pigmentosum (i.e., XPE) gene, a gene required for damaged DNA-binding activity (42) . Hamster cell lines that do not express p48, fail to repair CPD from nontranscribed DNA (43) . The same repair characteristics for CPD have been observed in skin epidermal cells of NER-proficient hairless mice (44) . In line with this, skin fibroblasts of the mouse lack p48 expression, in contrast to internal tissues like testis, ovary, spleen and liver (unpublished results). Thus, the absence of p48 expression (and consequently the lack of GGR of CPD) in mouse skin cells is a determinant in the susceptibility to UV-induced skin cancer. Furthermore, the induction of tumors after chemical treatment is far less pronounced than after UV in CSB-defective mice as previously shown for 7,12-dimethyl-1,2-benz[a]anthracene (13) .

The diverse spectrum of tumor types found in B[a]P-treated CSB-/- mice in this study is similar to that reported for B[a]P-treated wild-type, XPA-/-, p53+/- as well as XPA/p53 double knockout mice (30) . When B[a]P is administered by gavage, the forestomach is a major target organ for B[a]P-induced tumorigenesis. In all of the genotypes reported previously, a large proportion of the B[a]P-induced tumors were forestomach papillomas. It is thus quite remarkable that this group of tumors was absent in B[a]P-treated CSB-deficient mice. It has been shown for UV-induced skin papillomas in XPA mice that these tumors disappear after high, repeated UV exposures (Ref. 45 and references therein). It could be that papillomas in CSB mice are extremely sensitive to the repeated B[a]P treatment and that these neoplasms go into apoptosis before they progress to more malignant forestomach carcinomas. However, if apoptosis is triggered by the absence of TCR, it leaves unexplained why XPA mice developed these tumors (30) .

When the XPA and CSB mutagenesis and carcinogenesis data are examined together, MFs at inactive loci (like lacZ) appear to be a better predictive early marker for B[a]P-induced tumorigenesis than MFs at active loci (like Hprt). Lesions at the inactive lacZ gene are repaired solely by GGR, whereas lesions at the active Hprt gene are substrate for both the TCR and GGR pathways, which suggests that the GGR pathway of NER plays an important role in the prevention of cancer. Indeed, as mentioned before, XP patients with a defect in GGR (XP-A and XP-C) develop cancer at an increased rate, whereas CS patients do not. Moreover, XP-A and XP-C patients are equally cancer-prone, although XP-C patients have active TCR.

The correlation made in this study between mutation induction at an inactive locus and cancer induction is based on genetic changes that can be recovered at lacZ, probably mainly bp substitutions. Larger types of genetic changes causing LOH, such as mitotic recombinational events, cannot be recovered by the lacZ assay and, thus, go undetected. It may be that these types of chromosomal changes, which are known to be important events in the development of some types of cancer, are triggered by the damage remaining in the genome overall and cause the increased cancer susceptibility in humans and mice that have a deficiency in GGR. The autosomal Aprt gene is a suitable locus to detect carcinogen-induced LOH events in somatic cells of the mouse (27 , 31 , 46) . Therefore, we are currently using the Aprt heterozygous mouse model to investigate whether a causal relationship between the induction of LOH and tumor induction exists. To this end, Aprt-NER-deficient double transgenic mice are treated with chemical carcinogens to study both mutagenic (including LOH) and carcinogenic events in one and the same animal.


    ACKNOWLEDGMENTS
 
We are indebted to Dr. Jan Vijg for kindly providing us with the plasmid-based transgenic lacZ mouse model.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported financially by the Dutch Cancer Society Project 96-1321. Back

2 To whom requests for reprints should be addressed, at Department of Radiation Genetics and Chemical Mutagenesis-MGC, Leiden University Medical Center, P. O. Box 9503, 2300 RA Leiden, the Netherlands. Phone: 31-715276148; Fax: 31-715221615; E-mail: H.Vrieling{at}LUMC.nl Back

3 The abbreviations used are: NER, nucleotide excision repair; B[a]P, benzo[a]pyrene; CS, Cockayne syndrome; XP, xeroderma pigmentosum; TCR, transcription-coupled repair; GGR, global genome repair; CSB, CS group B correcting gene; Hprt, hypoxanthine phosporibosyl transferase gene; TTD, trichothiodystrophy; BPDE, (±)-7ß,8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene; 6-TG, 6-thioguanine; MF, mutant frequency; CPD, cyclobutane pyrimidine dimer; LOH, loss of heterozygosity. Back

Received 1/31/00. Accepted 8/16/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 Materials and Methods
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hoeijmakers J. H. J. Human nucleotide excision repair syndromes: molecular clues to unexpected intricacies. Eur. J. Cancer, 30A: 1912-1991, 1994.
  2. Friedberg, E. C., Walker, G. C., and Siede, W. DNA Repair and Mutagenesis. Washington, DC: ASM Press, 1995.
  3. Wood R. D. DNA repair in eukaryotes. Annu. Rev. Biochem., 65: 135-167, 1996.[Medline]
  4. Bohr V. A., Smith C. A., Okumoto D. S., Hanawalt P. C. DNA repair in an active gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more efficient than in the genome overall. Cell, 40: 359-369, 1985.[Medline]
  5. Madhani H. D., Bohr V. A., Hanawalt P. C. Differential DNA repair in transcriptionally active and inactive proto- oncogenes: c-abl and c-mos. Cell, 45: 417-423, 1986.[Medline]
  6. Bootsma, D., Kraemer, K. H., Cleaver, J. E., and Hoeijmakers, J. H. J. Nucleotide excision repair syndromes: xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. In: C. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle (eds.), The Metabolic Basis of Inherited Disease. New York: McGraw-Hill, 1997.
  7. Venema J., Mullenders L. H. F., Natarajan A. T., Van Zeeland A. A., Mayne L. V. The genetic defect in Cockayne syndrome is associated with a defect in repair of UV-induced DNA damage in transcriptionally active DNA. Proc. Natl. Acad. Sci. USA, 87: 4707-4711, 1990.[Abstract/Free Full Text]
  8. Van Hoffen A., Natarajan A. T., Mayne L. V., Van Zeeland A. A., Mullenders L. H. F., Venema J. Deficient repair of the transcribed strand of active genes in Cockayne syndrome cells. Nucleic Acids Res., 21: 5890-5895, 1993.[Abstract/Free Full Text]
  9. Nance M. A., Berry S. A. Cockayne syndrome: review of 140 cases. Am. J. Med. Genet., 42: 68-84, 1992.[Medline]
  10. de Vries A., van Oostrom C. T., Hofhuis F. M., Dortant P. M., Berg R. J., de Gruijl F. R., Wester P. W., van Kreijl C. F., Capel P. J., van Steeg H. Increased susceptibility to ultraviolet-B and carcinogens of mice lacking the DNA excision repair gene XPA. Nature (Lond.), 377: 169-173, 1995.[Medline]
  11. Nakane H., Takeuchi S., Yuba S., Saijo M., Nakatsu Y., Murai H., Nakatsuru Y., Ishikawa T., Hirota S., Kitamura Y. High incidence of ultraviolet-B-or chemical-carcinogen-induced skin tumours in mice lacking the xeroderma pigmentosum group A gene. Nature (Lond.), 377: 165-168, 1995.[Medline]
  12. Sands A. T., Abuin A., Sanchez A., Conti C. J., Bradley A. High susceptibility to ultraviolet-induced carcinogenesis in mice lacking XPC. Nature (Lond.), 377: 162-165, 1995.[Medline]
  13. van der Horst G. T., van Steeg H., Berg R. J., van Gool A. J., de Wit J., Weeda G., Morreau H., Beems R. B., van Kreijl C. F., de Gruijl F. R., Bootsma D., Hoeijmakers J. H. Defective transcription-coupled repair in Cockayne syndrome B mice is associated with skin cancer predisposition. Cell, 89: 425-435, 1997.[Medline]
  14. Friedberg E. C., Cheo D. L., Meira L. B., Reis A. M. Cancer predisposition in mutant mice defective in the XPC DNA repair gene. Prog. Exp. Tumor Res., 35: 37-52, 1999.[Medline]
  15. de Vries A., Van Oostrum C. T. M., Dortant P. M., Beems R. B., Van Kreijl C. F., Capel P. J., Van Steeg H. Spontaneous liver tumours and benzo[a]pyrene-induced lymphomas in XPA-deficient mice. Mol. Carcinog., 19: 46-53, 1997.[Medline]
  16. Kroese, E. D., Dortant, P. M., Van Steeg, H., Van Ostrum, C. T. M., Van der Houven-Van Oordt, C. W., Van Kranen, H. J., de Vries, A., Wester, P., and Van Kreijl, C., F. Use of Eµ-PIM-1 transgenic mice for short-term in vivo carcinogenicity testing: lymphoma induction by benzo[a]pyrene, but not by TPA. Carcinogenesis (Lond.), 18: 975–980, 1997.
  17. Hakura A., Tsutsui Y., Sonoda J., Kai J. K., Imade T., Shimada M., Sugihara Y., Mikami T. Comparison between in vivo mutagenicity and carcinogenicity in multiple organs by benzo[a]pyrene in the lacZ transgenic mouse (MutaMouse). Mutat. Res-Fundam. Mol. Mech. Mut., 398: 123-130, 1998.
  18. Hakura A., Sonoda J., Tsutsui Y., Mikami T., Imade T., Shimada M., Yaguchi S., Yamanaka M., Tomimatsu M., Tsukidate K. Toxicity profile of benzo[a]pyrene in the male lacZ transgenic mouse (MutaMouse) following oral administration for 5 consecutive days. Regul. Toxicol. Pharmacol., 27: 273-279, 1998.[Medline]
  19. Yang J. L., Maher V. M., McCormick J. J. Kinds of mutations formed when a shuttle vector containing adducts of (+/-)-7ß,8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10- tetrahydrobenzo[a]pyrene replicates in human cells. Proc. Natl. Acad. Sci. USA, 84: 3787-3791, 1987.[Abstract/Free Full Text]
  20. Maher, V. M., Curren, R. D., Ouelette, L. M., and McCormick, J. J. Role of DNA repair in the cytotoxic and mutagenic action of physical and chemical carcinogens. In: In Vitro Metabolic Activation in Mutagenesis Testing, pp. 313–336. Amsterdam: Elsevier/North-Holland, 1976.
  21. Bol S. A. M., van Steeg H., Jansen J. G., van Oostrom C., de Vries A., de Groot A. J. L., Tates A. D., Vrieling H., van Zeeland A. A., Mullenders L. H. F. Elevated frequencies of benzo(a)pyrene-induced Hprt mutations in internal tissue of XPA-deficient mice. Cancer Res., 58: 2850-2856, 1998.[Abstract/Free Full Text]
  22. de Vries A., Dollé M. E. T., Broekhof J. L. M., Muller J. J. A., Kroese E. D., van Kreijl C. F., Capel P. J. A., Vijg J., van Steeg H. Induction of DNA adducts and mutations in spleen, liver and lung of XPA-deficient/lacZ transgenic mice after oral treatment with benzo[a]pyrene: correlation with tumour development. Carcinogenesis (Lond.), 18: 2327-2332, 1997.[Abstract/Free Full Text]
  23. Miller S. A., Dykes D. D., Polesky H. F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16: 1215 1988.[Free Full Text]
  24. Boerrigter M. E. T. I., Dollé M. E. T., Martus H-J., Gossen J. A., Vijg J. Plasmid-based transgenic mouse model for studying in vivo mutations. Nature (Lond.), 377: 657-659, 1995.[Medline]
  25. Dollé M. E., Martus H. J., Gossen J. A., Boerrigter M. E., Vijg J. Evaluation of a plasmid-based transgenic mouse model for detecting in vivo mutations. Mutagenesis, 11: 111-118, 1996.[Abstract/Free Full Text]
  26. Gossen, J. A., Molijn, A. C., Douglas, G. R., and Vijg, J. Application of galactose-sensitive E. coli strains as selective hosts for LacZ- plasmids. Nucleic Acids Res., 20: 3254, 1992.
  27. Tates A. D., van Dam F. J., de Zwart F. A., van Teylingen C. M. M., Natarajan A. T. Development of a cloning assay with high cloning efficiency to detect induction of 6-thioguanine-resistant lymphocytes in spleen of adult mice following in vivo inhalation exposure to 1,3-butadiene. Mutat. Res., 309: 299-306, 1994.[Medline]
  28. Wijnhoven S. W. P., van Sloun P. P. H., Kool H. J. M., Weeda G., Slater R., Lohman P. H. M., van Zeeland A. A., Vrieling H. Carcinogen-induced loss of heterozygosity at the Aprt locus in somatic cells of the mouse. Proc. Natl. Acad. Sci. USA, 95: 13759-13764, 1998.[Abstract/Free Full Text]
  29. Vrieling H., van Rooijen M. L., Groen N. A., Zdzienicka M. Z., Simons J. W., Lohman P. H., van Zeeland A. A. DNA strand specificity for UV-induced mutations in mammalian cells. Mol. Cell Biol., 9: 1277-1283, 1989.[Abstract/Free Full Text]
  30. van Oostrom C. T., Boeve M., van den Berg J., de Vries A., Dollé M. E., Beems R. B., van Kreijl C. F., Vijg J., van Steeg H. Effect of heterozygous loss of p53 on benzo[a]pyrene-induced mutations and tumors in DNA repair-deficient XPA mice. Environ. Mol. Mutagen., 34: 124-130, 1999.[Medline]
  31. van Sloun P. P. H., Wijnhoven S. W. P., Kool H. J. M., Slater R., Weeda G., van Zeeland A. A., Lohman P. H. M., Vrieling H. Determination of spontaneous loss of heterozygosity mutations in Aprt heterozygous mice. Nucleic Acids Res., 26: 4888-4894, 1998.[Abstract/Free Full Text]
  32. Chen R. H., Maher V. M., McCormick J. J. Effect of excision repair by diploid human fibroblasts on the kinds and locations of mutations induced by (+/-)-7ß,8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene in the coding region of the HPRT gene. Proc. Natl. Acad. Sci. USA, 87: 8680-8684, 1990.[Abstract/Free Full Text]
  33. Dobrovolsky V. N., Casciano D. A., Heflich R. H. Tk(+/-) mouse model for detecting in vivo mutation in an endogenous, autosomal gene. Mutat. Res-Fundam. Mol. Mech. Mut., 423: 125-136, 1999.
  34. Chen T., Aidoo A., Manjanatha M. G., Mittelstaedt R. A., Shelton S. D., Lyncook L. E., Casciano D. A., Heflich R. H. Comparison of mutant frequencies and types of mutations induced by thiotepa in the endogenous Hprt gene and transgenic lacI gene of Big Blue(R) rats. Mutat. Res-Fundam. Mol. Mech. Mut., 403: 199-214, 1998.
  35. Wei S. J., Chang R. L., Wong C. Q., Bhachech N., Cui X. X., Hennig E., Yagi H., Sayer J. M., Jerina D. M., Preston B. D. Dose-dependent differences in the profile of mutations induced by an ultimate carcinogen from benzo[a]pyrene. Proc. Natl. Acad. Sci. USA, 88: 11227-11230, 1991.[Abstract/Free Full Text]
  36. Wei S. J., Chang R. L., Bhachech N., Cui X. X., Merkler K. A., Wong C. Q., Hennig E., Yagi H., Jerina D. M., Conney A. H. Dose-dependent differences in the profile of mutations induced by (+)-7R,8S-dihydroxy-9S,10R-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene in the coding region of the hypoxanthine (guanine) phosphoribosyltransferase gene in Chinese hamster V-79 cells. Cancer Res., 53: 3294-3301, 1993.[Abstract/Free Full Text]
  37. Schiltz, M., Cui, X. X., Lu, Y-P, Yagi, H., Jerina, D. M., Zdzienicka, M. Z., Chang, R. L., Conney, A. H., and Wei, S-J. C. Characterization of the mutational profile of (+)-7R,8S-diydroxy-9S,10R-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene at the hypoxantine (guanine) phosphoribosyltransferase gene in repair-deficient Chinese hamster V-H1 cells. Carcinogenesis (Lond.), 20: 2279–2285, 1999.
  38. Berg R. J. W., Ruven H. J. T., Sands A. T., de Gruyl F. R., Mullenders L. H. F. Defective global genome repair in XPC mice is associated with skin cancer susceptibility but not with sensitivity to UVB-induced erythema and edema. J. Investig. Dermatol., 110: 405-409, 1998.[Medline]
  39. Ljungman M., Zhang F. F. Blockage of RNA polymerase as a possible trigger for UV light-induced apoptosis. Oncogene, 13: 823-831, 1996.[Medline]
  40. Van Gijssel, H. E. Blockage of initiation of transcription as a trigger for p53 accumulation by genotoxic compounds. Mechanisms of p53 (in)activation and hepatocarcinogenesis in the rat: the role of DNA adducts, Mdm2 and Bcl-2. Thesis, Leiden University, pp. 96–111, 1999.
  41. Berg R. J. W., Rebel H., van der Horst G. T. J., van Kranen H. J., Mullenders L. H. F., van Vloten W. A., de Gruijl F. R. Impact of global genome repair versus transcription-coupled repair on ultraviolet carcinogenesis in hairless mice. Cancer Res., 60: 2858-2863, 2000.[Abstract/Free Full Text]
  42. Hwang B. J., Ford J. M., Hanawalt P. C., Chu G. Expression of the p48 xeroderma pigmentosum gene is p53-dependent and is involved in global genomic repair. Proc. Nat. Acad. Sci. USA, 96: 424-428, 1999.[Abstract/Free Full Text]
  43. Hwang B. J., Toering S., Francke U., Chu G. p48 activates a UV-damaged-DNA binding factor and is defective in xeroderma pigmentosum group E cells that lack binding activity. Mol. Cell. Biol., 18: 4391-4399, 1998.[Abstract/Free Full Text]
  44. Ruven H. J. T., Berg R. J. W., Seelen M. J., Dekkers J. A. J. M., Lohman P. H. M., Mullenders L. H. F., van Zeeland A. A. Ultraviolet-induced cyclobutane pyrimidine dimers are selectively removed from transcriptionally active genes in the epidermis of the hairless mouse. Cancer Res., 53: 1642-1645, 1993.[Abstract/Free Full Text]
  45. de Vries A., Berg R. J. W., Wijnhoven S., Westerman A., Wester P. W., van Kreijl C. F., Capel P. J. A., de Gruijl F. R., van Kranen H. J., van Steeg H. XPA deficiency in hairless mice causes a shift in skin tumor types and mutational target genes after exposure to low doses of UVB. Oncogene, 16: 2205-2212, 1998.[Medline]
  46. Vrieling H., Wijnhoven S., van Sloun P., Kool H., Giphart-Gassler M., van Zeeland A. Heterozygous Aprt mouse model: detection and study of a broad range of autosomal somatic mutations in vivo. Environ. Mol. Mutagen., 34: 84-89, 1999.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
X. Xu, J. L. Page, J. A. Surtees, H. Liu, S. Lagedrost, Y. Lu, R. Bronson, E. Alani, A. Yu. Nikitin, and R. S. Weiss
Broad Overexpression of Ribonucleotide Reductase Genes in Mice Specifically Induces Lung Neoplasms
Cancer Res., April 15, 2008; 68(8): 2652 - 2660.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
I. M. Kooter, J. L. A. Pennings, P. H. B. Fokkens, D. L. A. C. Leseman, A. J. F. Boere, M. E. Gerlofs-Nijland, F. R. Cassee, J. A. C. Schalk, T. J. H. Orzechowski, M. M. Schaap, et al.
Ozone induces clear cellular and molecular responses in the mouse lung independently of the transcription-coupled repair status
J Appl Physiol, March 1, 2007; 102(3): 1185 - 1192.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. R. Laposa, E. J. Huang, and J. E. Cleaver
Increased apoptosis, p53 up-regulation, and cerebellar neuronal degeneration in repair-deficient Cockayne syndrome mice
PNAS, January 23, 2007; 104(4): 1389 - 1394.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-K. Leung, K.-M. Lau, J. Mobley, Z. Jiang, and S.-M. Ho
Overexpression of Cytochrome P450 1A1 and Its Novel Spliced Variant in Ovarian Cancer Cells: Alternative Subcellular Enzyme Compartmentation May Contribute to Carcinogenesis
Cancer Res., May 1, 2005; 65(9): 3726 - 3734.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. G. Jansen, A. Tsaalbi-Shtylik, P. Langerak, F. Calléja, C. M. Meijers, H. Jacobs, and N. de Wind
The BRCT domain of mammalian Rev1 is involved in regulating DNA translesion synthesis
Nucleic Acids Res., January 13, 2005; 33(1): 356 - 365.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. M. Hoogervorst, C. Th. M. van Oostrom, R. B. Beems, J. van Benthem, S. Gielis, J. P. Vermeulen, P. W. Wester, J. G. Vos, A. de Vries, and H. van Steeg
p53 Heterozygosity Results in an Increased 2-Acetylaminofluorene-Induced Urinary Bladder but not Liver Tumor Response in DNA Repair-Deficient Xpa Mice
Cancer Res., August 1, 2004; 64(15): 5118 - 5126.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S.-Y. Chen, J.-R. V. Lin, R. Darbha, P. Lin, T.-Y. Liu, and Y.-M. A. Chen
Glycine N-Methyltransferase Tumor Susceptibility Gene in the Benzo(a)pyrene-Detoxification Pathway
Cancer Res., May 15, 2004; 64(10): 3617 - 3623.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. T. Russo, M. F. Blasi, F. Chiera, P. Fortini, P. Degan, P. Macpherson, M. Furuichi, Y. Nakabeppu, P. Karran, G. Aquilina, et al.
The Oxidized Deoxynucleoside Triphosphate Pool Is a Significant Contributor to Genetic Instability in Mismatch Repair-Deficient Cells
Mol. Cell. Biol., January 1, 2004; 24(1): 465 - 474.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Claij, A. van der Wal, M. Dekker, L. Jansen, and H. te Riele
DNA Mismatch Repair Deficiency Stimulates N-Ethyl-N-nitrosourea-induced Mutagenesis and Lymphomagenesis
Cancer Res., May 1, 2003; 63(9): 2062 - 2066.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. A. Amundson, R. A. Lee, C. A. Koch-Paiz, M. L. Bittner, P. Meltzer, J. M. Trent, and A. J. Fornace Jr
Differential Responses of Stress Genes to Low Dose-Rate {gamma} Irradiation
Mol. Cancer Res., April 1, 2003; 1(6): 445 - 452.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
C. S. Cooper
Smoking, lung cancers and their TP53 mutations
Mutagenesis, July 1, 2002; 17(4): 279 - 280.
[Full Text] [PDF]


Home page
Cancer Res.Home page
J.-H. Yoon, L. E. Smith, Z. Feng, M.-s. Tang, C.-S. Lee, and G. P. Pfeifer
Methylated CpG Dinucleotides Are the Preferential Targets for G-to-T Transversion Mutations Induced by Benzo[a]pyrene Diol Epoxide in Mammalian Cells: Similarities with the p53 Mutation Spectrum in Smoking-associated Lung Cancers
Cancer Res., October 1, 2001; 61(19): 7110 - 7117.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. W.P. Wijnhoven, H. J.M. Kool, L. H.F. Mullenders, R. Slater, A. A. van Zeeland, and H. Vrieling
DMBA-induced toxic and mutagenic responses vary dramatically between NER-deficient Xpa, Xpc and Csb mice
Carcinogenesis, July 1, 2001; 22(7): 1099 - 1106.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Hainaut and G. P. Pfeifer
Patterns of p53 G{->}T transversions in lung cancers reflect the primary mutagenic signature of DNA-damage by tobacco smoke
Carcinogenesis, March 1, 2001; 22(3): 367 - 374.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wijnhoven, S. W. P.
Right arrow Articles by van Steeg, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wijnhoven, S. W. P.
Right arrow Articles by van Steeg, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online