| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Carcinogenesis |
Department of Radiation Genetics and Chemical Mutagenesis-MGC, Leiden University Medical Center, 2300 RA Leiden [S. W. P. W., L. H. F. M., A. A. v. Z., H. V.]; National Institute of Public Health and the Environment (RIVM), Laboratory of Health Effects Research, Department of Carcinogenesis, Mutagenesis and Genetics, [C. T. M. v. O., H. v. S.], Laboratory of Pathology and Immunobiology [R. B. B.], 3720 BA Bilthoven; Department of Cell Biology and Genetics-MGC, Erasmus University Rotterdam, 3000 DR Rotterdam [H. J. M. K., G. T. J. v. d. H.]; and J. A. Cohen Institute, Inter-University Institute for Radiopathology and Radiation Protection, 2300RA Leiden [L. H. F. M., A. A. v. Z., H. V.], the Netherlands
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMaterials and MethodsRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMaterials and MethodsRESULTSDISCUSSIONREFERENCES |
|---|
In humans, inherited defects in NER proteins are associated with at least three different photosensitive disorders: XP, CS, and TTD. Complementation studies with patient cell lines have revealed the existence of seven genes in XP (XPA-XPG), two in CS (CSA-CSB) and one in TTD (TTDA; Ref. 6 ).
In the NER pathway, both the XPA and XPC protein are involved in damage recognition. The XPA protein is involved in both subpathways of NER. Therefore, cells from XP-A patients are defective in both TCR and GGR. Because the XPC protein is necessary only for damage recognition in the global genome repair subpathway, cells from XP-C patients lack GGR but have normal TCR. XP patients have a >2000-fold increment in all forms of skin cancer, on the sun-exposed areas of the skin. The frequency of cancer is also elevated in some internal tissues, but to a much lesser extent (1 , 6) . Cells derived from CS patients display a selective defect in the TCR pathway, whereas GGR is unaffected (7 , 8) . CS patients typically suffer from developmental and neurological abnormalities, including neuro-dysmyelination, immature sexual development, mental retardation, and impaired physical development. Death results from a progressive neurological degeneration, in most cases before the age of 20. In CS patients, the skin is photosensitive, but in contrast to XP patients, CS patients have not been reported to develop skin cancer at an increased rate (9) .
Because cancer development is an in vivo process in which somatic mutations accumulate, the question arises whether the differences in cancer susceptibility between XP-A and XP-C on one hand and CS-B on the other, are reflected by differences in the extent of mutation induction and the kind of somatic mutations that occur. Mouse mutants, in which in vivo mutagenesis and carcinogenesis studies can be performed, have recently been generated for XP-A, XP-C and CS-B (10, 11, 12, 13) . XPA- and XPC-deficient mice clearly mimic the human XP disorder with respect to skin cancer predisposition (10, 11, 12 , 14) . CSB-deficient mice have a repair defect similar to the human syndrome but do not display the characteristic hallmarks of CS as dramatically as the human patients, inasmuch as only minor growth disturbance and neurological deficits have been noted (13) . In addition, CSB-/- mice, in contrast to CS patients, appeared to be cancer-prone after UV exposure. However, compared with XPA-/- and XPC-/- mice, a higher cumulative dose of UVB and a longer latency time is required in CSB-/- mice before they develop skin cancer (13) .
Previously, we have studied the relationship between carcinogen-induced DNA damage, induction of somatic mutations, and tumorigenesis in a complete NER-deficient background (15) . XPA-deficient mice were exposed to the mutagenic chemical B[a]P, which in mammalian cells is metabolized to the reactive metabolite BPDE. This reactive metabolite induces predominantly adducts at the N2 position of guanine and is known to be a potent carcinogen in rodents (15, 16, 17, 18) . BPDE-N2-dG adducts are mutagenic lesions (19) and substrate for NER in human cells (20) . A subchronical, oral B[a]P treatment of XPA-/- mice gave rise to enhanced MFs, both in the endogenous, transcriptionally active Hprt gene in splenic T-lymphocytes (21) and the inactive prokaryotic lacZ marker gene in the spleen (22) . Furthermore, XPA-/- mice appeared to be more susceptible to the carcinogenic effects of B[a]P resulting in an increased frequency of lymphomas compared with heterozygous or wild-type littermates (15) .
In this study, the effect of a deficiency in the TCR subpathway of NER on B[a]P-induced mutagenesis and carcinogenesis was investigated. Therefore, CSB-/- mice that are defective in TCR and can only perform GGR were subchronically exposed to B[a]P. After different exposure times, MFs were determined at both the Hprt and LacZ gene to compare mutation induction in an endogenous active gene with that in inactive DNA. The nature of B[a]P-induced Hprt mutations was determined to monitor a possible effect of the TCR deficiency on mutation strand specificity. Finally, tumor formation in B[a]P-treated CSB-deficient, heterozygous CSB+/- and wild-type mice was determined.
Whereas B[a]P-induced mutation induction at Hprt was enhanced in CSB-/- mice compared with wild-type mice, induction at LacZ was similar in all of the genotypes. Tumor incidences increased similarly in TCR-deficient CSB-/- mice and wild-type mice on B[a]P-treatment. Mutations in the bulk of the DNA seem to be a better predictive marker for carcinogen-induced tumorigenesis than mutations in genes that are actively transcribed.
|
Materials and Methods |
|---|
|
TopABSTRACTINTRODUCTIONMaterials and MethodsRESULTSDISCUSSIONREFERENCES |
|---|
CSB mice used in the Hprt mutation analysis experiments were all in C57Bl/6 genetic background (F8 generation) and were derived from crosses between heterozygous CSB+/- and homozygous knockout CSB-/- mice. Genotyping of mice was performed by PCR analysis of DNA isolated from tail tips. DNA isolation was carried out by the salting-out technique as described previously (23) . The three different PCR primers used were: CSB4, 5'-GCTGCTTATAATAATCCTCATCTCC-3'; CSB5, 5'-ATCTGCGTGTTCGAATTCGCCAATG-3'; and CSB6, 5'-GTCTTCTGATGACGTTAGCTATGAG-3'.
The PCR reaction was performed in a mix containing 6.7 mM MgCl2, 16.6 mM (NH4)2SO4, 5 mM 2-mercaptoethanol, 6.8 mM EDTA, 67 mM Tris-HCl (pH 8.8), 10% DMSO, 0.2 mM each of the four deoxyribonucleotide triphosphates, 20 pmol of each of the PCR primers, and 1.5 units of Amplitaq polymerase (Perkin-Elmer) in a total volume of 50 µl. After an initial denaturing step at 93°C for 5 min, 35 cycles of PCR were performed (1 min at 94°C, 1 min at 57°C, and 3 min at 72°C) in a Thermal Cycler (Perkin-Elmer).
The targeted allele (CSB6-CSB5) was identified as a 490-bp PCR product and the wild-type allele (CSB6-CSB4) as a 195-bp PCR product. In the lacZ mutation analysis experiments, both CSB-/- and CSB+/+ mice were crossed with C57Bl/6 pUR288 transgenic mice (line 60; Ref. 24 ). The primers used to detect the presence of the lacZ transgenes were: for lacZ 5', 5'-TGGCGTTACCCAACTTAATCGCCTTG-3'; and for lacZ 3': 5'-ATAACTGCCGTCACTCCAACGCAGCA-3'. Amplification of the lacZ gene gave rise to a fragment of approximately 500 bp.
Chronic Exposure of Mice to B[a]P
Wild-type (CSB+/+) and heterozygous
(CSB+/-) mice were considered as being
wild type for NER. Unless stated otherwise, no discrimination will be
made between these genotypes.
B[a]P was given to young adult mice (6–9 weeks old) being either wild type or CSB-/-. The mice were treated 3 times per week during 13 weeks by oral gavage at a dose of 13 mg/kg body weight. Control animals (both genotypes, both sexes) received only the solvent (0.1 ml soy oil). Body weights were recorded every 2 weeks, and the B[a]P stock solution concentrations were calculated accordingly. Total mice used were: untreated wild type, 14 males and 13 females; untreated CSB-/-, 6 males and 7 females; B[a]P-treated wild type, 18 males and 11 females; and B[a]P-treated CSB-/-, 6 males and 6 females.
All of the mice were monitored daily for a total observation period of 52 weeks starting from the beginning of the treatment. Animals that were moribund because of the treatment were killed, as were all of the surviving mice at the end of the observation period. All of the tissues were collected for histopathological analysis. Samples were embedded in paraffin wax and cut into 5-µm sections and were finally stained with H&E.
Short-Term B[a]P Treatment of Mice
Short-term treatment with B[a]P was performed using
8–10-week-old mice of both sexes. Mice were treated as described above
with a dose of 13 mg/kg body weight B[a]P dissolved in 0.1
ml of soy-oil, three times a week during 0, 5, 9, or 13 weeks. For the
Hprt MF analysis, mice were killed 3 weeks after the last
treatment. The number of treated animals in the different dose groups
varied between 5 and 7 mice. The control groups of mice consisted of 5
CSB-/- (2 male and 3 female) mice and 7
CSB+/- (4 male and 3 female) mice that
received the solvent only for 9 weeks. For the lacZ MF
analysis, mice were killed 3 days after the last treatment. The
lacZ MF was determined in 6 animals (3 males and 3 females).
From control groups in this lacZ experiment, two mice of
each genotype were killed at 5 and 9 weeks after start of the treatment
(in total, 2 males and 2 females). Body weights were recorded biweekly,
and concentrations of B[a]P were calculated according to
these weights. Splenocytes were isolated directly from the sacrificed
animal for Hprt mutation analysis and were stored at
-80°C. Collected tissues for lacZ mutation analysis were
frozen at -80°C prior to DNA isolation.
lacZ Mutation Analysis
Genomic DNA was isolated from tissues as described by
Dollé et al. (25)
. A detailed description
of rescuing pUR288 plasmids from genomic mouse DNA and electroporation
of rescued plasmids into electro-competent Escherichia coli
cells strain C (
lacZ, galE-;
Ref. 26
) was provided previously (22)
.
Isolation and Culturing of Splenic T-Lymphocytes
Priming and cloning of T-lymphocytes was performed in a culture
medium as described by Tates et al. (27)
with
some minor modifications. The serum-free medium DCCM-1 was replaced by
AIM-V (Life Technologies, Inc.) To the medium, antibiotics were added:
100 units/ml penicillin and 100 µg/ml streptomycin sulfate.
Additional details about the isolation, freezing, and thawing of mouse splenocytes as well as the priming of the cells with Concavalin A and the selection of the Hprt-deficient mutants with 6-thioguanine have been described previously (28) . Calculation of cloning efficiencies and MFs was performed as described by Tates et al. (27) .
Molecular Characterization of 6-TG-resistant T-Lymphocyte Clones
Isolation of Hprt Mutant Clones.
6-TG-resistant clones were selected from 10
CSB-/- mice and 10
CSB+/- heterozygous littermates. The
clones were diluted 1:3 in culture medium containing 6-TG (2.5
µg/ml). After 3–4 days of culturing, cells were collected and
centrifuged, and cell pellets were washed with PBS and either frozen at
-80°C or directly processed to isolate RNA.
RNA Extraction and cDNA Synthesis.
For RNA isolation, the cells were lysed in 100 µl of TRIzol (Life
Technologies), and, subsequently, chloroform extraction was performed
after the addition of 40 µl of pure chloroform. After precipitation
of the RNA by adding 30 µl of isopropanol and subsequent
centrifugation for 5 min at 4°C, the pellet was washed with 100 µl
of ethanol 70%, after which it could be stored at -20°C. RNA was
resuspended in 18 µl of anneal buffer [250 mM KCl, 10
mM Tris-HCl (pH 8.3), and 1 mM EDTA] and,
together with 40 pmol of Hprt-cDNA primer
(GCAGCAACTGACATTTCTAAA), was incubated at 65°C for 3 min to allow
annealing of the primer to the Hprt mRNA strand. After this,
the sample was split in two, and cDNA synthesis was performed as
described previously (29)
.
Amplification of Hprt cDNA by the PCR.
Three µl of synthesized cDNA was used to amplify the coding region of
the Hprt gene in a total volume of 100 µl containing 20
µl of a 5x PCR buffer [500 mM KCl, 100
mM Tris-HCl (pH 8.3), 15 mM
MgCl2], 4 µl of a dNTP mix (2.5
mM), 1 unit of Amplitaq polymerase
(Perkin-Elmer), and 20 pmol of each of the PCR primers. For the first
round of amplification the PCR primers were hprt-mus2
(AAAAAGCTTTACTAGGCAGATGG) and zee1-mus (GGCTTCCTCC TCAGAC CGT). After
an initial denaturation step for 5 min at 93°C, 35 cycles of
PCR were performed (1 min at 94°C, 1 min at 50°C, and 3 min at
72°C), followed by a final extension step of 8 min at 72°C. One
µl of amplified DNA was used in a reamplification reaction of 25
cycles with an annealing temperature of 55°C using primers hprt-mus1
(TTTTTGCCGCGAGCCGACC) and san2m13 (CGACGTTGTAAAACGACGGCCAGTG
CAGATTCAACTTGCGCTC). Ten µl of the reamplified DNA was used for
sequence analysis with the Thermo Sequenase fluorescent labeled primer
cycle sequencing kit containing 7-deaza-dGTP
(Amersham/Pharmacia/Biotech) on an automated laser fluorescence
sequencer (Amersham).
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMaterials and MethodsRESULTSDISCUSSIONREFERENCES |
|---|
and Fig. 1A
, it is clear that the lacZ MF increased
gradually in all of the organs tested and that there was no significant
difference between the two different genotypes. The increase was
dose-dependent and ranged from 5 to 8 x 10-5 in untreated mice up to 
60 x 10-5 in wild-type
(CSB+/-) and in
CSB-/- mice that had been treated with
B[a]P for 13 weeks.
|
|
);
Ref. 15
].
B[a]P-induced Hprt MFs.
To detect a possible effect of a deficiency in TCR on mutagenesis,
mutation studies have to be performed in a gene that is actively
transcribed. Therefore, MFs were determined at the X-chromosomal
Hprt gene in splenic T-lymphocytes. For these experiments,
CSB-/- and heterozygous
(CSB+/-) mice (C57Bl/6 genetic background,
F8 generation) were exposed to B[a]P for 5, 9, and 13
weeks. Three weeks after the final treatment, splenocytes were
isolated, and Hprt MFs were determined at the different time
points (Fig. 1C
; Table 2
).
|
) per dose-group varied between 17.5 (±1.2%) and 22.5
(±1.7%), and was not influenced by the B[a]P exposure or
the CSB genotype. The background MF of 0.5 ± 0.3 x 10-6 in
CSB+/- mice and 0.9 ± 0.6 x 10-6 in
CSB-/- mice is in the normal range of
Hprt spontaneous MFs in the mouse (31)
. After
treatment with B[a]P, both CSB-deficient and
heterozygous CSB+/- mice showed a clear
dose-dependent increase in Hprt MF compared with untreated
mice of the same genotype. However, B[a]P was
significantly more mutagenic at Hprt in the
CSB-deficient mice than in heterozygous littermates at the
two latest time points (Fig. 1C
; Table 2
). A somewhat more
pronounced mutation response was previously found at Hprt in
T-lymphocytes of B[a]P-treated XPA mice
that were deficient in both TCR and GGR of NER (Fig. 1D
;
Ref. 21
).
Hprt Mutational Spectrum Analysis.
The metabolically active form of B[a]P, BPDE, is known to
form bulky adducts at purines in the DNA, predominantly at guanine
residues. B[a]P diolepoxide adducts are preferentially and
strand-specifically repaired from the HPRT gene of
human diploid fibroblasts (32)
. For mouse cells, it is
still unknown whether BPDE-induced lesions are repaired preferentially
and strand-specifically. As described above, we observed a
significantly larger increase in MF in B[a]P-treated
CSB-deficient mice that are unable to perform TCR than in
heterozygous CSB+/- littermates, which
suggests that BPDE adducts in the transcribed strand of Hprt
are preferentially repaired by TCR. To investigate whether the
mutational spectrum of B[a]P-induced mutants as well as
the strand specificity of mutations was influenced by the
CSB deficiency, 6-TG-resistant clones of untreated as well
as B[a]P-treated mice of both genotypes were subcultured
and further processed for DNA sequencing analysis.
In all, 62 Hprt mutants of
CSB-/- mice and 36 Hprt
mutants of CSB+/- mice that had been
treated for 9 and 13 weeks were sequenced (Table 3)
. Identical mutations found within one animal, were considered to
result from clonal expansion. Both in the group of
CSB-/- and
CSB+/- mutants, 50% of the mutants
contained independent mutations (Table 3)
. Furthermore, also in
untreated mice, clonal expansion of mutant cells was observed.
Therefore, clonal expansion occurred frequently in mice, regardless of
the CSB genotype and the B[a]P treatment. Among
the independent mutations, 17 (53%) of the
CSB-/- mutants and 15 (75%) of the
CSB+/- mutants were bp substitutions, and
9 (28%) of the CSB-/- mutants and 3
(15%) of the CSB+/- mutants were splice
mutations, in which one or more exons were lacking from the amplified
Hprt-cDNA (Table 3)
. The majority of the recovered base
substitutions were GC
TA transversions, both in
CSB-/- and
CSB+/- (6 of 17 and 9 of 15,
respectively). In the CSB -/- group,
other base substitutions also occurred frequently, which resulted in a
more diverse mutational spectrum than in the
CSB+/- group. If we assume that base
substitutions at G residues were caused by mutational bypass of
N2-G-BPDE adducts, then the location of the adducted G and,
subsequently, a possible strand-specificity of repair can be
determined. In all of the 13 mutants of
CSB+/- mice containing a G mutation, the G
was present in the nontranscribed strand, whereas in
CSB-/- mice, 2 of 12 Hprt
mutants were presumably caused by an adducted G in the transcribed
strand.
|
B[a]P-induced Tumors in CSB- and
Wild-Type Mice.
One of the most intriguing differences between patients affected by XP
and those with CS is that patients with XP develop sunlight-induced
skin cancers at a much higher frequency than normal individuals,
whereas CS patients do not exhibit an increased tumor incidence. We
have previously shown (13)
that CSB mice, in
contrast to CS patients, do have a predisposition to develop UV-induced
skin cancer, although to a much weaker extent than
XPA-deficient mice.
To further explore the issue of cancer predisposition in CS, we exposed
CSB mice to B[a]P p.o. Mice were treated by
gavage at a dose of 13 mg/kg body weight, three times a week for a
total period of 13 weeks. The same dose regimen was used previously in
an experiment with XPA-deficient mice (15)
.
After the treatment was stopped, we followed the mice for another 39
weeks to monitor tumor development. The results of this study are
summarized in Table 4
. The B[a]P dose used, appeared to be carcinogenic to both
wild-type- and CSB-/- mice. Of the
wild-type mice 17 (59%) of 29 developed tumors, which is significantly
higher (P = 0.0023; Fisher’s one-sided exact
test) compared with the untreated control mice, of which 5 (19%) of 27
developed tumors during the same observation period of 52 weeks. In
untreated CSB-/- mice
(n = 13), we did not find any tumors, but
after B[a]P treatment, tumor incidence in
CSB-/- mice was significantly enhanced
statistically (P = 0.0017); 7 (58%) of 12
mice carried tumors. Only two mice died intercurrently because of tumor
development—a wild-type B[a]P-treated mouse with
forestomach squamous cell carcinoma and a CSB
B[a]P-treated mouse with a skin histiocytic sarcoma, at 39
and 37 weeks after start of the treatment, respectively. Consequently,
most tumors were discovered at the end of the observation period (52
weeks). The major tumor site was, as expected, the forestomach,
followed by lung bronchiolo-alveolar adenomas and (histiocytic)
sarcomas (see Table 4
). The tumor spectra of wild-type and
CSB mice were essentially the same. However, in contrast to
our previous study (15)
, we did not observe
treatment-related lymphoma induction. Nevertheless, no statistically
significant difference in tumor induction between wild-type and
CSB-/- mice was found
(P = 0.6). Therefore, we can conclude that
CSB- and wild-type mice are equally sensitive in terms of
tumor development after oral treatment with B[a]P.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMaterials and MethodsRESULTSDISCUSSIONREFERENCES |
|---|
A deficiency in TCR results in a reduced rate of the removal of lesions from the transcribed strand of active genes and, thus, should lead to enhanced mutation induction in actively transcribed genes. In line with this hypothesis, the oral treatment of CSB mice with B[a]P gave rise to a 3-fold enhanced MF at the actively transcribed Hprt gene in CSB-deficient mice compared with their heterozygous littermates. Because the repair efficiency of the GGR subpathway of NER is not diminished in CSB mice, no effect on mutation induction by B[a]P would be expected at transcriptionally inactive loci. Indeed, no increase in the induction of lacZ gene mutations was found in spleen, liver, or lung of B[a]P-treated CSB-/- mice compared with that found in repair-proficient littermates. In contrast, in XPA-/- mice in which NER activity is completely abolished, increased MFs at both the active Hprt gene and the inactive lacZ gene in the spleen were found (21 , 22) . Thus, whereas the increase in MF at the inactive lacZ gene in XPA mice indicates removal of B[a]P adducts by GGR, the elevated MF at Hprt in CSB mice suggests that TCR enhances removal of B[a]P adducts from actively transcribed genes. The effect of mutation induction in the Hprt gene appeared to be more pronounced in XPA mice (21) than in CSB mice, which can be explained by the ability of CSB mice to perform GGR of B[a]P-induced lesions at transcribed genes.
For human diploid fibroblasts, it has been shown that B[a]P-DNA adducts were preferentially removed from the transcribed strand of the HPRT gene (32) , which coincided with a strong strand-specific induction of mutations at adducted guanines in the nontranscribed strand.
To investigate the effect of a TCR deficiency on B[a]P-induced mutation specificity and strand distribution in the mouse, we determined the nature of 32 and 20 independent Hprt mutants from CSB-/- and CSB+/- mice, respectively. The Hprt MF was about 10- to 20-fold above the background (in wild-type and CSB-/- mice, respectively), which indicated that the contribution of spontaneous mutants is negligible and the vast majority of mutations were caused by the treatment.
The predominant types of mutations induced by B[a]P in
cultured mammalian cells are base substitutions at G residues
(32
, 35)
, although at low doses of B[a]P, a
significant fraction (38%) of the mutations at the Hprt
gene in hamster cells are base changes at A residues (36)
.
In the present study, the mutational spectra in
CSB-/- and
CSB+/- mice were quite similar, although
the fraction of GCTA transversions was somewhat lower in the
CSB-deficient background than in wild-type mice. Whereas all
of the 13 G mutations from CSB+/- mice had
the presumed adducted guanine in the nontranscribed strand of
Hprt, 2 of 12 G mutations in
CSB-/- mice were in the transcribed
strand, which indicated preferential removal of B[a]P
adducts from the transcribed strand of the Hprt gene in the
mouse. In agreement with this result is the recent finding that the
high strand-specificity for mutation-induction by BPDE at the
Hprt gene in NER-proficient hamster cells (>99% of the G
mutations at the nontranscribed strand), disappeared in a NER-deficient
background (37)
.
On oral B[a]P treatment, tumor incidences increased in
both wild-type and CSB-deficient animals, but no significant
differences in tumor frequencies were observed in the TCR-deficient
CSB-/- mice compared with wild types. In
contrast, B[a]P-treated XPA-deficient mice
developed internal tumors more rapidly and at higher frequency compared
with XPA+/+ and
XPA+/- mice (15)
. The
spontaneous tumor frequency seemed to be lower in
CSB-/- mice than in wild-type mice (Table 4)
. However, this difference was not statistically significant
(P = 0.12, Fisher’s one-sided exact test).
The observation that CSB mice did not show increased cancer frequencies after B[a]P treatment was not unexpected. Human CS patients, in contrast to XP patients, have not been reported to be cancer prone (9) , which suggests that the defect in GGR in XP patients is predominantly responsible for the high cancer frequency. The TCR deficiency of XP-A and CS-B cells on the other hand, has been proposed to be responsible for the induction of p53-dependent apoptosis after UV (38 , 39) and N-acetoxy-2-aminofluorene exposure (40) .
It has previously been reported that CSB-deficient mice, in contrast to human CS patients, show an increased susceptibility to UV-induced skin cancer. However, compared with XPA and XPC mice, a higher cumulative dose of UVB was required and a longer latency time of tumor development was observed in CSB mice (13) . In fact, as recently determined in hairless SKH-HR1 mice exposed to UVB, inactivation of the CSB gene appeared to accelerate the UVB-induced skin carcinogenesis by a factor 2, whereas in XPA and XPC mice, this factor is 4 and 3, respectively (41) . The discrepancy between mouse and human CS could be related to the more efficient repair of CPDs by the GGR pathway in human skin fibroblasts compared with rodents. In contrast to mice, GGR in humans is apparently able to compensate for a defective TCR leading to unchanged cancer predisposition in CS patients. The global genome repair of CPD in human skin fibroblasts is dependent on the p48 xeroderma pigmentosum (i.e., XPE) gene, a gene required for damaged DNA-binding activity (42) . Hamster cell lines that do not express p48, fail to repair CPD from nontranscribed DNA (43) . The same repair characteristics for CPD have been observed in skin epidermal cells of NER-proficient hairless mice (44) . In line with this, skin fibroblasts of the mouse lack p48 expression, in contrast to internal tissues like testis, ovary, spleen and liver (unpublished results). Thus, the absence of p48 expression (and consequently the lack of GGR of CPD) in mouse skin cells is a determinant in the susceptibility to UV-induced skin cancer. Furthermore, the induction of tumors after chemical treatment is far less pronounced than after UV in CSB-defective mice as previously shown for 7,12-dimethyl-1,2-benz[a]anthracene (13) .
The diverse spectrum of tumor types found in B[a]P-treated CSB-/- mice in this study is similar to that reported for B[a]P-treated wild-type, XPA-/-, p53+/- as well as XPA/p53 double knockout mice (30) . When B[a]P is administered by gavage, the forestomach is a major target organ for B[a]P-induced tumorigenesis. In all of the genotypes reported previously, a large proportion of the B[a]P-induced tumors were forestomach papillomas. It is thus quite remarkable that this group of tumors was absent in B[a]P-treated CSB-deficient mice. It has been shown for UV-induced skin papillomas in XPA mice that these tumors disappear after high, repeated UV exposures (Ref. 45 and references therein). It could be that papillomas in CSB mice are extremely sensitive to the repeated B[a]P treatment and that these neoplasms go into apoptosis before they progress to more malignant forestomach carcinomas. However, if apoptosis is triggered by the absence of TCR, it leaves unexplained why XPA mice developed these tumors (30) .
When the XPA and CSB mutagenesis and carcinogenesis data are examined together, MFs at inactive loci (like lacZ) appear to be a better predictive early marker for B[a]P-induced tumorigenesis than MFs at active loci (like Hprt). Lesions at the inactive lacZ gene are repaired solely by GGR, whereas lesions at the active Hprt gene are substrate for both the TCR and GGR pathways, which suggests that the GGR pathway of NER plays an important role in the prevention of cancer. Indeed, as mentioned before, XP patients with a defect in GGR (XP-A and XP-C) develop cancer at an increased rate, whereas CS patients do not. Moreover, XP-A and XP-C patients are equally cancer-prone, although XP-C patients have active TCR.
The correlation made in this study between mutation induction at an inactive locus and cancer induction is based on genetic changes that can be recovered at lacZ, probably mainly bp substitutions. Larger types of genetic changes causing LOH, such as mitotic recombinational events, cannot be recovered by the lacZ assay and, thus, go undetected. It may be that these types of chromosomal changes, which are known to be important events in the development of some types of cancer, are triggered by the damage remaining in the genome overall and cause the increased cancer susceptibility in humans and mice that have a deficiency in GGR. The autosomal Aprt gene is a suitable locus to detect carcinogen-induced LOH events in somatic cells of the mouse (27 , 31 , 46) . Therefore, we are currently using the Aprt heterozygous mouse model to investigate whether a causal relationship between the induction of LOH and tumor induction exists. To this end, Aprt-NER-deficient double transgenic mice are treated with chemical carcinogens to study both mutagenic (including LOH) and carcinogenic events in one and the same animal.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 This work was supported financially by the Dutch
Cancer Society Project 96-1321. 
2 To whom requests for reprints should be
addressed, at Department of Radiation Genetics and Chemical
Mutagenesis-MGC, Leiden University Medical Center, P. O. Box 9503,
2300 RA Leiden, the Netherlands. Phone: 31-715276148; Fax:
31-715221615; E-mail: H.Vrieling{at}LUMC.nl
3 The abbreviations used are: NER,
nucleotide excision repair; B[a]P,
benzo[a]pyrene; CS, Cockayne syndrome; XP, xeroderma
pigmentosum; TCR, transcription-coupled repair; GGR, global genome
repair; CSB, CS group B correcting gene;
Hprt, hypoxanthine phosporibosyl transferase gene; TTD,
trichothiodystrophy; BPDE,
(±)-7ß,8
-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene;
6-TG, 6-thioguanine; MF, mutant frequency; CPD, cyclobutane pyrimidine
dimer; LOH, loss of heterozygosity.
Received 1/31/00. Accepted 8/16/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMaterials and MethodsRESULTSDISCUSSIONREFERENCES |
|---|
-dihydroxy-9,10-epoxy-7,8,9,10- tetrahydrobenzo[a]pyrene replicates in human cells. Proc. Natl. Acad. Sci. USA, 84: 3787-3791, 1987.-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene in the coding region of the HPRT gene. Proc. Natl. Acad. Sci. USA, 87: 8680-8684, 1990.This article has been cited by other articles:
|
|
 |
|
  X. Xu, J. L. Page, J. A. Surtees, H. Liu, S. Lagedrost, Y. Lu, R. Bronson, E. Alani, A. Yu. Nikitin, and R. S. Weiss Broad Overexpression of Ribonucleotide Reductase Genes in Mice Specifically Induces Lung Neoplasms Cancer Res., April 15, 2008; 68(8): 2652 - 2660. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. M. Kooter, J. L. A. Pennings, P. H. B. Fokkens, D. L. A. C. Leseman, A. J. F. Boere, M. E. Gerlofs-Nijland, F. R. Cassee, J. A. C. Schalk, T. J. H. Orzechowski, M. M. Schaap, et al. Ozone induces clear cellular and molecular responses in the mouse lung independently of the transcription-coupled repair status J Appl Physiol, March 1, 2007; 102(3): 1185 - 1192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. R. Laposa, E. J. Huang, and J. E. Cleaver Increased apoptosis, p53 up-regulation, and cerebellar neuronal degeneration in repair-deficient Cockayne syndrome mice PNAS, January 23, 2007; 104(4): 1389 - 1394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-K. Leung, K.-M. Lau, J. Mobley, Z. Jiang, and S.-M. Ho Overexpression of Cytochrome P450 1A1 and Its Novel Spliced Variant in Ovarian Cancer Cells: Alternative Subcellular Enzyme Compartmentation May Contribute to Carcinogenesis Cancer Res., May 1, 2005; 65(9): 3726 - 3734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. G. Jansen, A. Tsaalbi-Shtylik, P. Langerak, F. Calléja, C. M. Meijers, H. Jacobs, and N. de Wind The BRCT domain of mammalian Rev1 is involved in regulating DNA translesion synthesis Nucleic Acids Res., January 13, 2005; 33(1): 356 - 365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Hoogervorst, C. Th. M. van Oostrom, R. B. Beems, J. van Benthem, S. Gielis, J. P. Vermeulen, P. W. Wester, J. G. Vos, A. de Vries, and H. van Steeg p53 Heterozygosity Results in an Increased 2-Acetylaminofluorene-Induced Urinary Bladder but not Liver Tumor Response in DNA Repair-Deficient Xpa Mice Cancer Res., August 1, 2004; 64(15): 5118 - 5126. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Y. Chen, J.-R. V. Lin, R. Darbha, P. Lin, T.-Y. Liu, and Y.-M. A. Chen Glycine N-Methyltransferase Tumor Susceptibility Gene in the Benzo(a)pyrene-Detoxification Pathway Cancer Res., May 15, 2004; 64(10): 3617 - 3623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Russo, M. F. Blasi, F. Chiera, P. Fortini, P. Degan, P. Macpherson, M. Furuichi, Y. Nakabeppu, P. Karran, G. Aquilina, et al. The Oxidized Deoxynucleoside Triphosphate Pool Is a Significant Contributor to Genetic Instability in Mismatch Repair-Deficient Cells Mol. Cell. Biol., January 1, 2004; 24(1): 465 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Claij, A. van der Wal, M. Dekker, L. Jansen, and H. te Riele DNA Mismatch Repair Deficiency Stimulates N-Ethyl-N-nitrosourea-induced Mutagenesis and Lymphomagenesis Cancer Res., May 1, 2003; 63(9): 2062 - 2066. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Amundson, R. A. Lee, C. A. Koch-Paiz, M. L. Bittner, P. Meltzer, J. M. Trent, and A. J. Fornace Jr Differential Responses of Stress Genes to Low Dose-Rate {gamma} Irradiation Mol. Cancer Res., April 1, 2003; 1(6): 445 - 452. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Cooper Smoking, lung cancers and their TP53 mutations Mutagenesis, July 1, 2002; 17(4): 279 - 280. [Full Text] [PDF]
|
|
|
|
|
|
J.-H. Yoon, L. E. Smith, Z. Feng, M.-s. Tang, C.-S. Lee, and G. P. Pfeifer Methylated CpG Dinucleotides Are the Preferential Targets for G-to-T Transversion Mutations Induced by Benzo[a]pyrene Diol Epoxide in Mammalian Cells: Similarities with the p53 Mutation Spectrum in Smoking-associated Lung Cancers Cancer Res., October 1, 2001; 61(19): 7110 - 7117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. W.P. Wijnhoven, H. J.M. Kool, L. H.F. Mullenders, R. Slater, A. A. van Zeeland, and H. Vrieling DMBA-induced toxic and mutagenic responses vary dramatically between NER-deficient Xpa, Xpc and Csb mice Carcinogenesis, July 1, 2001; 22(7): 1099 - 1106. [Abstract] [Full Text] [PDF]
|
|
|
|
, MFs in wild-type mice; 
, MFs in
NER-deficient mice. A and C, MFs in
CSB-deficient mice compared with wild-type mice;
B and D, MFs in
XPA-deficient mice and wild-type mice as described
previously