Cancer Research CR Helping Patients  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J., III
[Cancer Research 60, 5803-5814, October 15, 2000]
© 2000 American Association for Cancer Research


Molecular Biology and Genetics

Hormone-dependent Tumor Regression in Vivo by an Inducible Transcriptional Repressor Directed at the PAX3-FKHR Oncogene1

Kasirajan Ayyanathan, William J. Fredericks, Carola Berking, Meenhard Herlyn, Christopher Balakrishnan, Edward Gunther and Frank J. Rauscher, III2

The Wistar Institute, Philadelphia, Pennsylvania 19104


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In alveolar rhabdomyosarcomas (ARMSs), a specific chromosomal translocation creates a fusion transcription factor, PAX3-FKHR, that is oncogenic due to transcriptional activation. As a strategy for down-regulation of PAX3-FKHR target genes, we created conditional PAX3 repressors by fusing the PAX3 DNA-binding motifs to the hormone binding domain (HBD) of the estrogen receptor and to the KRAB repression domain. We validated proper expression, specific DNA binding, corepressor interaction, and nuclear localization for the KRAB-PAX3-HBD protein and showed it to be a 4-hydroxytamoxifen-dependent transcriptional repressor of transiently transfected and integrated PAX3 reporters in ARMS cells. We established ARMS cell lines that exhibited stable expression of the conditional PAX3 repressor proteins and used them to down-regulate the malignant growth under low serum or anchorage-independent conditions in a hormone-dependent manner. Terminal deoxynucleotidyl transferase-mediated nick end labeling assays revealed that hormonal activation of the PAX3 repressors induced extensive apoptosis that correlated with down-regulation of BCL-XL expression. SCID mice that were engrafted with the KRAB-PAX3-HBD ARMS cell lines and were implanted with 4-hydroxytamoxifen timed-release pellets exhibited suppression of tumor growth and an altered vascularity that was not observed in the control mice. These observations strongly suggest that we have directly repressed the PAX3 target genes that are deregulated by the PAX3-FKHR oncogene in ARMS.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chromosomal translocations that result in the creation of chimeric transcription factors that deregulate specific target genes are a type of genetic alteration frequently associated with oncogenesis (1) . Different modes of deregulation include gain or loss of transcriptional activation or repression function. The model system, ARMS3 , chosen in this study provides a clear example for this phenomenon for human pediatric solid tumors (2) .

ARMSs occur due to a highly specific chromosomal translocation event [t(2;13) (q35;q14)] that juxtaposes the DNA-binding domains of PAX3 with the transcriptional activation domain of FKHR (3) . In transfection assays, PAX3-FKHR, the causative oncogene in ARMS, functions as a more potent activator of transcription than the wild-type PAX3 (4) . Less frequently, another translocation [t(1;13) (p36;q14)] fuses the PAX7 DNA-binding domain to the same FKHR activation domain (5) . These studies suggest that these PAX proteins have sustained a gain of function that leads to ARMS tumorigenesis (2) . However, the PAX3-FKHR-activated target genes responsible for ARMS have not been defined.

The PAX gene family consists of nine members that are unified by the presence of the paired box DNA-binding domain and are subclassified based on their genomic organization. PAX proteins play regulatory roles in pattern formation during organogenesis (6) . Ectopic expression of several PAX genes in NIH/3T3 cells induces cellular transformation and tumor formation in nude mice, suggesting that deregulated expression of PAX proteins could play a role in human tumorigenesis (6 , 7) . Furthermore, suppression of apoptosis by PAX proteins is crucial for their complex developmental role and could account for their tumorigenic potential (8 , 9) . In accordance with this, antisense inhibition of PAX genes results in growth arrest and apoptosis in tumor cell lines (10, 11, 12) . Although evidence supports a role for PAX3 in protection of cells from apoptosis during development, the mechanism has not been determined (11) .

The developmental abnormalities and alterations in gene expression observed in the splotch mouse model, which contains mutations in the PAX3 DNA-binding domains, has suggested several downstream target genes regulated by PAX3 (13 , 14) . Candidate targets include mi (15) , myoD and myogenin (16) , pax7 (11) and others. Similarly, transfection of the PAX3-FKHR fusion protein present in ARMS into heterologous cells has been shown to up-regulate the expression of pdgfr-{alpha} and c-met, the receptor for hepatocyte scatter factor (17) . Whether any of these candidate genes play a role in ARMS tumorigenesis remains to be clarified.

It is generally hypothesized that the enhanced transcriptional activation potential of PAX3-FKHR is responsible for ARMS. We have previously engineered synthetic PAX3 repressors using the KRAB repression domain and demonstrated that expression of a PAX3-KRAB repressor in the ARMS Rh30 cell line could inhibit malignant growth (18) . The KRAB domain functions as a potent DNA binding-dependent transcriptional repression module by recruiting the KAP-1 corepressor (19 , 20) . Other repression domains such as the SNAG domain from the GFI-1 proto-oncogene (21) and the WT-1 repression domain derived from the Wilms’ tumor gene (22) do not use the KAP-1 corepressor mechanism. The KRAB and the SNAG domains are well suited for the creation of engineered repressors due to their small size and strong repression potentials when fused to heterologous DNA-binding domains.

We were interested in developing conditional PAX3 repressors to examine the immediate consequences of repressing PAX3 target genes in ARMS cell clones. The use of conditional repressors avoids secondary changes in cells that might be selected by constitutive expression of transcriptional repressors. Several conditional eukaryotic expression systems based on either inducible transcription or conditional activity due to fusion to the HBD of steroid receptors have been developed (23) . Of these, the HBD fusion confers rapid temporal regulation to the functionality of heterologous proteins. Furthermore, specific mutations in the HBDs make these receptors very selective to synthetic ligands without being influenced by endogenous hormones (24) . HBD fusions with transcription factors including PAX5 (25, 26, 27) and enzymes such as STAT6 (28) have been successfully made to generate hormone-dependent conditional alleles.

In this study, we generated hormone-inducible, conditional alleles of a KRAB-PAX3 protein by fusing it to the HBD of the murine estrogen receptor ERTM, which exhibits selectivity to 4-OHT (24) . Hormone-dependent changes in biological properties such as growth in low-serum medium, apoptosis, anchorage-independent growth, and growth as tumors in SCID mice, were studied using ARMS Rh30 cell clones expressing the KRAB-PAX3-HBD repressors. The results of these experiments suggest that we have successfully used the inducible repressor strategy to down-regulate the set of PAX3 target genes that are activated by the PAX3-FKHR oncoprotein. Furthermore, we have used the conditional PAX3 repressors in ARMS cells to explore whether the cellular survival factor BCL-XL might be a PAX3 target gene and be involved in ARMS tumorigenesis. These studies represent a first step in the identification of important oncogenic targets in ARMS by creation of a biological system well suited for analysis using differential gene expression array technologies.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines.
The NIH/3T3 cell line was maintained in DMEM supplemented with 10% calf serum, 2 mM glutamine, 100 IU/ml penicillin, and 100 µg/ml streptomycin at 37°C in 5% CO2 under sterile conditions. The COS-1 cells were grown in Iscove’s modified Dulbecco’s medium containing 10% FBS and other components, as above. The parental Rh30 cell line and its clonal derivatives were maintained in RPMI 1640 containing 10% calf serum supplemented as above.

Construction of Expression Plasmids.
The previously described pcDNA3-PAX3-STOP plasmid, which expresses a hybrid mouse-human PAX3 protein, was used as a base to construct the KRAB-PAX3 wild-type and mutant fusion genes (4 , 18) . This plasmid was digested with HindIII and BamHI and ligated to the wild-type or the mutant (D18V19 changed to A18A19) KRAB repression domains (19) . The KRAB domain-encoding fragments were generated by PCR amplification from the pM1-KOX-1 template (29) and were derived as HindIII and BamHI fragments encoding amino acids 1–90 of the KOX1 cDNA. The 5' oligonucleotide primer incorporated a HindIII site and a Kozak consensus immediately before the KOX-1 initiator methionine (5' primer, 5'-TTTTAAGCTTCCACCATGGATGCTAAGTCAC-3'). The 3' oligonucleotide primer incorporated a BamHI site after amino acid 90 of KOX-1 (3' primer, 5'-TTTTGGATCCAGTCTCTGAATCAGGATG-3'). The resulting pcDNA3-KRAB-PAX3-STOP plasmid contains the KRAB domain, followed by a small linker encoding amino acids GSGVP, followed by amino acids 11–381 of the PAX3 DNA-binding domain. After amino acid 381, the PAX3-STOP protein is terminated by a vector-derived stop codon (18) . The pcKRAB-PAX3-HBD plasmid was constructed by fusing the HBD, ERTM of the murine estrogen receptor, to pcKRAB-PAX3-STOP. The ERTM DNA was generated by PCR amplification from the pBS+ERTM plasmid (24) template using a pair of oligonucleotide primers designed to incorporate flanking EcoRI sites (5' primer, 5'-GCATGAATTCTATGGGTGCTTCAGGAG-3'; 3' T3 promoter primer, 5'-AATTAACCCTCACTAAAGGG-3'). The PCR product was digested with EcoRI and ligated to the unique EcoRI site just 5' of the vector-derived stop codon in the pcKRAB-PAX3-STOP plasmid to create an in-frame fusion. The pcSNAG-PAX3-HBD plasmid was constructed by fusing the HBD to the pcDNA3-SNAG-PAX3 plasmid, as described above. The fragment encoding the SNAG domain was generated by overlapping PCR amplification. The 5' primer was designed to incorporate an EcoRI and a BamHI site, a Kozak consensus sequence, and the SNAG domain sequences (encoding amino acids 1–15; 5' primer, 5'-GAATTCGGATCC ACCATGCCACGTTCTTTCCTGGTTAAATCTAAAAAAGCGCACTCTTACC-3'). The3' primer contained the remaining portion of the SNAG domain (amino acids 16–20 in an antisense orientation), followed by BglII and SalI sites (3'-primer, 5'-GTCGACAGATCTGGAGTAGTCCGGACCCGGAGAACGCGGCTGGTGGTAAGAGTGCGCTTTTTTAG-3'). These two oligonucleotides were annealed and amplified to yield a 105-bp fragment that was used as a template in the PCR reaction with a pair of flanking primers: (5'-GTCAGAATTCGGATCCACC-3'; and 3' primer, 5'-CCAAGTCGACAGATCTGGAG-3'). The resulting PCR product was digested with BamHI and BglII and cloned into the BamHI site in the pcDNA3-PAX3-STOP plasmid. The general-purpose vector pcDNA3-KRAB-MNP-HBD was constructed in two steps. First, the KRAB domain was amplified using the 5' HindIII primer described above and a 3' primer that incorporated a myc-epitope tag (EQKLISEEDL) and a nuclear localization signal of the E1A gene (KRPRP) immediately after amino acid 89 of the KRAB domain, followed by a BamHI site. Next, the ERTM DNA was generated by PCR amplification using a 5' primer designed to incorporate a polylinker composed of BamHI, EcoRI, EcoRV, and ClaI sites, and the 3' T3 primer. This fragment was cleaved with BamHI and NotI, and then these two fragments were cloned into the HindIII and NotI sites of the pcDNA3 vector to generate the final construct. The nucleotide sequences of all PCR-derived constructs were confirmed by sequencing both strands. The previously described PAX reporter plasmid, CD19–2(A-ins)-TK-LUC (30) , was modified by incorporation of a ZeocinR cassette derived as a PvuII fragment from the pcDNA3.1Zeo plasmid (Invitrogen) to create the CD19–2(A-ins)-TKLUC-ZeoR plasmid.

COS-1 Transfection, Extract Preparation, and Immunoprecipitation.
The expression plasmids depicted in Fig. 1ACitation were transfected into COS-1 cells for 6 h with a mixture of DNA:lipofectAMINE in the ratio 1:6 in optiMEM, followed by growth for 48 h in DMEM containing 10% FBS. Transfected cells were metabolically labeled with 35S-methionine, and the cell extracts prepared in radioimmunoprecipitation assay buffer were subjected to immunoprecipitation analysis with {alpha}-KRAB, {alpha}-PAX3, and {alpha}-HBD antibodies, as described previously (4 , 18) .



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. A, chimeric repressor plasmids. The KRAB-PAX3-HBD plasmid combines the KRAB repression domain with the ERTM HBD of the estrogen receptor by fusion to the PAX3 paired box (PB) and homeodomain (HD) DNA-binding motifs. The KRAB(DV)-PAX3-HBD plasmid contains a mutant KRAB domain, which lacks repression potential. The SNAG-PAX3-HBD plasmid harbors the SNAG domain; a repression module derived from the GFI-1 gene. B, the CD19–2(A-ins)-TK-LUC-ZeoR reporter plasmid is described in "Materials and Methods." C, the pcDNA3-KRAB-MNP-HBD plasmid is a novel expression vector for the construction of conditional transcriptional repressor fusion proteins using the KRAB repression domain and the ERTM HBD. The resulting conditional repressors would be myc epitope-tagged (M) and nuclear-localized (N) and would repress a set of endogenous target genes specified by the DNA-binding domain of choice fused in-frame into the polylinker (P).

 
EMSA.
The DNA-binding potentials of KRAB-PAX3 and KRAB-PAX3-HBD proteins were assessed by EMSA performed using 32P-labeled e5 DNA probe, as described previously (4 , 31) . The KRAB-PAX3 and KRAB-PAX3-HBD proteins used for EMSA were synthesized using the Promega TnT T7 transcription and translation system. In parallel reactions, 35S-labeled proteins were prepared and analyzed by 10% SDS-PAGE and fluorography to confirm and normalize specific in vitro synthesis. For the corepressor supershift studies, COS-1 nuclear extract was used as a source of the KAP-1 corepressor (~3 µg/µl, prepared as described previously; Refs. 4 and 31 ). For the antibody supershift studies, {alpha}-KRAB or {alpha}-PAX3 IgG (2 µg/µl) was included in the EMSA-binding reactions.

Northern Analysis for KRAB-PAX3-HBD Transcript.
Total RNA was isolated from Rh30-KPHBD-cl22 cells using the TRIzol reagent (Life Technologies, Inc., Rockville, MD) and electrophoresed on 1% formaldehyde-agarose gels. Prior to RNA isolation, Rh30-KPHBD-cl22 cells were either un-induced (treated with 0.1% ethanol as a solvent control) or induced with 500 nM 4-OHT. The gel was stained with ethidium bromide to assess the integrity and equal loading of the samples and then transferred to a nylon membrane (Hybond). The membrane was prehybridized, hybridized with radiolabeled PAX3-KRAB probe, and washed to a final stringency of 0.2x SSC, 0.2% SDS, at 65°C, before autoradiography.

Indirect Immunofluorescence.
Subcellular localization of KRAB-PAX3 and KRAB-PAX3-HBD proteins in Rh30, Rh30-pcDNA-cl5, and Rh30-KPHBD-cl22 cells grown on cover glasses was conducted using previously described procedures for immunofluorescence (31) . After fixation with 1% paraformaldehyde and permeabilization with 0.2% Triton X-100 (Sigma Chemical Co.), the antigens were localized using {alpha}-PAX3 or {alpha}-HBD primary rabbit antibodies, followed by detection with a secondary biotinylated {alpha}-rabbit IgG and avidin-FITC (Vector Laboratories, Inc.). The nuclei were counterstained for DNA with 0.5 µg/ml Hoechst 33258 (Sigma Chemical Co.) and the cells were visualized using a Leica confocal laser-scanning microscope. The HC-20 antibody to the HBD of the murine estrogen receptor was obtained from Santa Cruz Biotechnology Inc.

Transient Transfections and Reporter Assays.
The transcription assays were performed on NIH/3T3 cells that were transiently transfected with a LipofectAMINE mixture containing 1 or 2.5 µg of the expression plasmids (pcDNA3, pcKRAB-PAX3, and pcKRAB-PAX3-HBD), 0.5 µg of CD19–2(A-ins)-TK-LUC, and 0.25 µg of CMV-ß-D-galactosidase plasmids, as described previously (18) . Transfected cells were treated with 0.1% ethanol as a solvent control for un-induced dishes or were induced with 500 nM 4-OHT (Research Biochemicals International, Natick, MA). After 24 h, the cells were washed twice with Tris-buffered saline, and the cell extracts were prepared in reporter lysis buffer and assayed for luciferase and ß-galactosidase activities as described (31) .

Generation of Stable Rh30 Cell Clones.
Rh30 cell transfectants containing the conditional PAX3 repressor plasmids depicted in Fig. 1ACitation or the pcDNA3 vector were isolated as individual colonies using cloning rings and were expanded into cell lines after selection for stable resistance to 500 µg/ml G418 (Mediatech, Inc., Herndon, VA). Twenty-four independent cell lines were tested for expression of the PAX3-HBD repressor proteins by immunoprecipitation with {alpha}-PAX3 IgG. Dual-stable inducible PAX3 repressor/PAX3 reporter cell clones were generated in the Rh30-KPHBD-cl22 cell line after transfection with the CD19–2(A-ins)-TK-LUC-ZeoR plasmid and selection with 500 µg/ml G418 and 100 µg/ml Zeocin. The PAX3 repressor/PAX3 reporter cell lines, designated as HBDLUC clones, were screened for repression of luciferase after induction with 4-OHT. The luciferase activities of the HBDLUC clones were normalized to a protein content of 1.0 A595 unit in the BioRad protein assay.

DD-PCR.
Gene expression profiles of un-induced and 4-OHT-induced Rh30-KPHBD-cl22 cells were analyzed using DD-PCR. Total RNA was isolated using the TRIzol reagent and poly(A)+ mRNA was purified using the oligo-(dT)25 Dynabeads (Dynal, Inc., Lake Success, NY). First-strand cDNA was synthesized using the Life Technologies, Inc. cDNA synthesis system and quantitated by spectrophotometry. Differential subtraction display PCR was conducted as described (32) , and the samples were electrophoresed on a sequencing gel and autoradiographed.

Low-Serum and Poly-HEMA-MTT Assays.
The growth assays of Rh30, Rh30-KPHBD-cl22, Rh30-SPHBD-cl8, and Rh30-K(DV)PHBD-cl24 cell lines in low-serum (0.1% FBS) medium was conducted in 24-well tissue culture plates and was repeated twice with at least 10 replicates. The anchorage-independent growth of parental Rh30 and Rh30-KPHBD-cl22 cells was evaluated using poly-HEMA-coated plates. In both assays, the proportion of viable cells at each time point was determined by MTT assay, as described previously (33) .

Apoptosis Assays.
Apoptosis assays were performed using the ApoAlert DNA Fragmentation and the ApoAlert Annexin V Assay kits according to the manufacturer’s instructions (Clontech Laboratories, Inc.). Assays were conducted on SCID mouse tumor sections or on Rh30-KPHBD-cl22 cells that were grown on coverslips in low-serum medium under either un-induced (0.1% ethanol) or 4-OHT-induced conditions (500 nM, 48 h). The polyclonal rabbit antibody for immunoblot detection of BCL-XL (bcl-x, Ab-1) and the antibody for detection of human {alpha}-tubulin as a loading control were obtained from Oncogene Research Products (Cambridge, MA).

Semiquantitative RT-PCR Analysis.
For RT-PCR analysis, RNA was isolated from the un-induced or the 4-OHT-induced Rh30-KPHBD-cl22 and Rh30-SPHBD-cl8 cells grown in low-serum medium using the TRIzol reagent. The reverse transcription reactions were performed on 5 µg of total RNA using oligo-dT primers with the Ready-To-Go You-Prime First-Strand Synthesis Beads (Pharmacia Biotech). The PCR reactions were carried out with 2.5 µl of reverse transcription reactions as templates. A pair of primers specific for the human BCL-XL transcript (5' primer, 5'-CAGCAGCAGTTTGGATGC-3'; 3'-primer, 5'-CCACAGTCATGC CCG TC-3') was used to amplify the 448-bp product. A specific primer pair (5'-primer, 5'-TCAGCGCAGGGGCGCCCGGTTCTT T-3'; and 3'-primer, 5'-ATCGACAAGACCGGCTTCCATCCGA-3') was used to amplify the 345-bp product from the NeoR gene. A pair of primers specific for the HBD of the murine estrogen receptor (5'-primer, 5'-GCGACGGGCCCATGGGTGCTTCAG G-3'; and 3'-primer, 5'GGTGGGCCCCTGATATCACAAGTCCTCTTCAGAAATGAGCTTTTGCTCGATCGTGTTGGGGAAGCC-3') was used to amplify a 1010-bp product from the SCID mouse tumor samples that were derived from Rh30-KPHBD-cl22 cells.

Tumor Growth Inhibition Assays in SCID Mice.
The tumorigenic potentials of Rh30-pcDNA-cl5 and Rh30-KPHBD-cl22 cell lines were evaluated after s.c. injection into female CB17-SCID mice, 6 weeks of age. Evidence of tumor growth became apparent after 10 days, at which time the mice were divided into two groups of five mice each (un-induced and 4-OHT induced). The mice of the 4-OHT-induced group were implanted with 35-mg timed-release pellets specified to maintain a 200-nM circulating concentration of 4-OHT for 21 days (Innovative Research of America, Sarasota, FL). Improved implant success was ensured by application of DERMABOND topical skin adhesive (Ethicon, Inc., Somerville, NJ) over the wounds. Alternate day measurements of tumor volumes were made using a tumorimeter (Cancer Technologies, Inc., Tucson, AZ). After 3 weeks, the mice were sacrificed and the wet weights of the tumors were recorded. A portion of each tumor was fixed in formalin for H&E staining and histopathological evaluation.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Conditional PAX3 Repressors and Integrated Reporter.
We have previously demonstrated that we could engineer a PAX3 transcriptional repressor by fusing the KRAB domain to the PAX3 DNA-binding domains. We found that constitutive expression of a PAX3-KRAB protein could inhibit the malignant growth of ARMS cells (18) . In the present study, a KRAB-PAX3 plasmid was converted to a conditional repressor, KRAB-PAX3-HBD, by fusion of the ERTM domain in-frame to the COOH terminus (Fig. 1A)Citation . The ERTM domain is a well-established, tamoxifen-selective, mutant version of the HBD of the murine estrogen receptor that confers hormone-dependent functionality to heterologous fusion proteins (24) . The KRAB(DV)-PAX3-HBD protein features a mutant KRAB repression domain that lacks transcriptional repression potential and is a useful control to confirm that the elicited biological responses depend on a functional repression module (19) . Furthermore, by stable integration of the 6x CD19–2(A-ins)-TK-LUC luciferase reporter plasmid (Fig. 1B)Citation , we have created inducible PAX3 repressor/reporter (HBDLUC) cell lines that permit convenient monitoring of the repression function in a chromatin-mediated state. The modular nature of the engineered repressor is shown by the use of another conditional repressor plasmid, SNAG-PAX3-HBD, which was created using the SNAG repression module of the GFI-1 gene (21) .4 Clearly, the use of engineered repressors is not limited to the set of target genes selected by the PAX3 DNA-binding domains as in this study. The general purpose KRAB-MNP-HBD vector (Fig. 1C)Citation was designed for use with other DNA-binding domains of interest that could be inserted into the poly-linker between the KRAB repression domain and the ERTM domain. This plasmid features incorporation of a nuclear localization signal and a c-myc epitope tag to aid in detection. The resulting conditional chimeric repressors can be applied for repression of the set of endogenous target genes of choice determined by the inserted DNA binding motif.

Characteristics of Engineered Repressor Proteins.
Immunoprecipitation analysis of transfected COS-1 cell extracts using both {alpha}-KRAB and {alpha}-PAX3 IgGs (Fig. 2A)Citation demonstrates that the pcKRAB-PAX3 (55 kDa) and pcKRAB-PAX3-HBD (88 kDa) proteins are expressed in vivo at the size predicted by their cDNAs and are recognized by the appropriate antibodies. The EMSA analysis (Fig. 2B)Citation indicated the presence of clear binary complexes of both KRAB-PAX3:e5DNA and KRAB-PAX3-HBD:e5DNA, which confirmed that both KRAB-PAX3 and KRAB-PAX3-HBD proteins exhibited the anticipated DNA-binding properties. We have previously shown, by competition with unlabeled homologous oligonucleotide, that binding of PAX3 protein to the e5 binding site probe is specific (4) . Furthermore, these binary complexes were confirmed to contain the predicted proteins because they were efficiently super-shifted when {alpha}-KRAB or {alpha}-PAX3 IgG was included during the DNA-binding reactions (data not shown). It was also evident that the KRAB domain present in the binary complex was amenable for protein-protein interactions because ternary complexes of KRAB-PAX3:KAP-1:e5DNA or KRAB-PAX3-HBD:KAP-1:e5DNA were observed when COS-1 nuclear extract was included in the gel-shift reaction as a source of the KAP-1 corepressor (20) . We have also found that the SNAG-PAX3-HBD protein efficiently binds the e5 DNA probe but does not form a ternary complex with KAP-1 (data not shown). As would be expected with the ERTM posttranslational regulation system, we have shown that similar levels of KRAB-PAX3-HBD transcript are expressed in Rh30-KPHBD-cl22 cells grown under both un-induced and 4-OHT-induced conditions (Fig. 2C)Citation . Immunofluorescence microscopy indicated that in the absence of hormone the KRAB-PAX3-HBD protein was predominantly cytoplasmic (Fig. 10ACitation , top), but after induction with 4-OHT it was located in the nucleus (Fig. 10ACitation , bottom).



View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, characterization of KRAB-PAX3 and KRAB-PAX3-HBD proteins expressed in COS-1 cells that were transiently transfected with the pcDNA3, pcKRAB-PAX3, and pcKRAB-PAX3-HBD expression plasmids and metabolically labeled with 35S-methionine. Whole cell lysates prepared in radioimmunoprecipitation assay buffer were immunoprecipitated using preimmune-, or {alpha}-PAX3-, and {alpha}-KRAB-IgGs and analyzed by SDS-PAGE and fluorography. KRAB-PAX3 (Mr 55,000) and KRAB-PAX3-HBD (Mr 88,000) proteins are indicated by the half-arrows. B, DNA-binding properties of KRAB-PAX3 and KRAB-PAX3-HBD proteins. Recombinant KRAB-PAX3 and KRAB-PAX3-HBD proteins were synthesized in vitro and used in gel shift assays using 32P-labeled e5 probe. For KRAB: PAX3: KAP-1 complex analysis, the binding reactions contained 1 µl (~3 µg) of COS-1 nuclear extract as a source of the KAP-1 corepressor. Binary complexes (KRAB-PAX3:e5DNA and KRAB-PAX3-HBD:e5DNA) and ternary complexes (KRAB-PAX3: KAP-1:e5DNA and KRAB-PAX3-HBD:KAP-1:e5DNA) are indicated on the autoradiogram. FP, free probe. C, expression of the KRAB-PAX3-HBD transcript in Rh30-KPHBD-cl22 cells. Northern blot analysis of 20 µg of total RNA from un-induced and 4-OHT-induced Rh30-KPHBD-cl22 cells. The positions of the 28S and 18S rRNA species are indicated (top). The ethidium bromide-stained gel is shown to control for loading (bottom).

 


View larger version (65K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 10. A, immunofluorescent localization of the KRAB-PAX3-HBD protein with {alpha}-HBD antibody in Rh30-KPHBD-cl22 cells under un-induced (top) or 4-OHT-induced conditions (bottom). B, TUNEL assays of Rh30-KPHBD-cl22 cells that were grown in low-serum medium under un-induced (top) or 4-OHT-induced conditions (bottom). C, H&E-stained tumor sections from SCID mice with Rh30-pcDNA-cl5 tumors (left) and Rh30-KPHBD-cl22 tumors (right) under un-induced (top) or 4-OHT-induced (bottom) conditions. Note the diminished vascularity in Rh30-KPHBD-cl22 mice that were implanted with the 4-OHT time-release pellets. D, TUNEL assays of tumor tissue sections from SCID mice with Rh30-pcDNA-cl5 tumors (left) and Rh30-KPHBD-cl22 tumors (right) under un-induced (top) or 4-OHT-induced (bottom) conditions.

 
Hormone-dependent Luciferase Repression.
Transcriptional repression assays that were carried out in NIH/3T3 cells transiently transfected with the KRAB-PAX3 plasmid showed constitutive repression that depended on the dose of the input expression plasmid but not on the presence of 4-OHT. In contrast, cells transfected with 1 µg of the KRAB-PAX3-HBD plasmid exhibited a significant dependence on the presence of 4-OHT to repress the luciferase reporter and typically manifested a 10-fold repression (Fig. 3)Citation . A hormone-independent repression was also observed at a high input dose (2.5 µg) of KRAB-PAX3-HBD plasmid. As expected, the vector-transfected cells showed no repression (Fig. 3)Citation . Overall, our characterization of the KRAB-PAX3-HBD repressor indicated proper expression, DNA-binding activity, and a significant degree of hormone-dependent transcriptional repression activity in NIH/3T3 cells. NIH/3T3 cells do not express PAX3, hence, lack any endogenous PAX3-dependent transcriptional activation function (data not shown; Ref. 34 ).



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Transcriptional repression of the PAX reporter plasmid by the pcKRAB-PAX3-HBD is hormone dependent. NIH/3T3 cells were transiently transfected with indicated expression plasmids along with a constant amount of the CD19–2(A-ins)-TK-LUC reporter and CMV-ß-D-galactosidase plasmids. Transfected cultures were induced with 500 nM 4-OHT or treated with 0.1% ethanol as a solvent control for 24 h. The luciferase activities were normalized using ß-D-galactosidase activity.

 
Conditional PAX3 Repressor in ARMS Stable Cell Lines.
Our primary interest, however, was to evaluate the conditional PAX3 repressor in Rh30 ARMS cell lines that express the endogenous PAX3-FKHR oncogenic transcriptional activator. Therefore, we generated stable Rh30 cell clones, which expressed the conditional PAX3 repressors and then evaluated their repression potentials after transient transfection of the CD19–2(A-ins)-TK-LUC reporter plasmid. In contrast to the 10-fold repression observed in transiently transfected NIH/3T3 cells (Fig. 3)Citation , in Rh30 cells the repression achieved ranged from 2–4-fold, consistent with the presence of a competing endogenous activation due to PAX3-FKHR. Hormone-dependent repression of the reporter plasmid was observed in all of the Rh30-KPHBD clones (e.g., -cl11, cl13, cl19, and cl22; Fig. 4BCitation ) that correlated well with the expression levels of the KRAB-PAX3-HBD fusion protein (Fig. 4A)Citation . The observed conditional transcriptional repression appeared to be dominant over transcriptional activation elicited by the endogenous PAX3-FKHR oncogene. Similarly, all of the SNAG-PAX3-HBD-expressing Rh30 cell clones (e.g., -cl4, cl7, cl8, and cl24; Fig. 4FCitation ) showed a good correlation between hormone-dependent repression of luciferase activities and expression levels of the SNAG-PAX3-HBD protein (Fig. 4E)Citation . As expected, the Rh30 cell clones (e.g., -cl3, cl13, and cl24; Fig. 4CCitation ) that expressed the mutant KRAB(DV)-PAX3-HBD repressor protein (Fig. 4C)Citation showed no repression (Fig. 4D)Citation . Thus, repression was found to completely depend on the presence of a functional repression domain (KRAB or SNAG) but was not restricted to a particular type of repression mechanism.



View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. A, C, and E, immunoprecipitation analysis of PAX3 repressor protein expression in stable Rh30 cell clones using {alpha}-PAX3 antibody. The endogenous PAX3-FKHR fusion protein and the chimeric PAX3 repressor proteins are indicated. A, KRAB-PAX3-HBD protein expression in clones cl11, cl13, cl19, and cl22. C, aKRAB(DV)-PAX3-HBD protein expression in clones cl3, cl13, and cl24. E, SNAG-PAX3-HBD protein expression in clones cl4, cl7, cl8, and cl24. B, D, and F, hormone-dependent transcriptional repression of luciferase activity in conditional PAX3 repressor Rh30 cell clones transiently transfected with the CD19–2(A-ins)-TK-LUC reporter plasmid. B, Rh30-KPHBD clones, cl11, cl13, cl19, and cl22. D, Rh30-K(DV)PHBD clones, cl3, cl13, and cl24. F, Rh30-SPHBD cell clones, cl4, cl7, cl8, and cl24. IVT, in vitro translated protein.

 
Repression of the Integrated PAX3 Reporter and Endogenous Genes.
Our intended goal was to apply the PAX3 conditional repressor strategy to specifically down-regulate endogenous target genes that are activated by the PAX3-FKHR oncogene. Hence, we produced stable cell clones containing both the KRAB-PAX3-HBD plasmid (NeoR) and the CD19–2(A-ins)-TK-LUC reporter plasmid (ZeoR), designated as HBDLUC cell lines. This allowed us to correlate repression of an integrated artificial reporter gene target with reversion of ARMS malignant growth characteristics and changes in expression of endogenous PAX3 target genes. Several independent clonal cell lines were tested for hormone-dependent repression of the chromatin-integrated luciferase gene, and the results obtained for a selected number of clones are depicted in Fig. 5ACitation , which shows that the normalized luciferase activities varied from 103 –106 luciferase units. The fold repression ranged from >1.5–5 for different clonal cell lines (Fig. 5B)Citation . The variation observed between clones most likely reflects differences in reporter copy number and integration site. The range of repression potentials obtained with the chromatin-integrated reporter clones are consistent with those observed in transient assays in Rh30 cells (Fig. 4)Citation , further supporting the contention that the PAX3 repressors could dominantly repress endogenous genes despite the presence of the PAX3-FKHR protein.



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. A, hormone-dependent repression of an integrated CD19–2(A-ins)-TK-LUC-reporter gene. The dual-stable HBDLUC Rh30 cell lines that contain the inducible PAX3 repressor/PAX3 reporter alleles were assayed for repression of luciferase activities after induction with 4-OHT. B, the fold-repression, defined as the ratio between the un-induced and 4-OHT-induced luciferase values, is depicted for several independent HBDLUC clones.

 
Our studies have indicated that repression of PAX3-FKHR target genes is a strategy for reversion of malignant growth of ARMS cells. Thus, we have established a relevant system to model the conditional repression of endogenous PAX3-FKHR target genes. To demonstrate that hormone-dependent repression of endogenous genes was occurring in this ARMS cell system, DD-PCR analysis was performed using RNA made from un-induced and 4-OHT-induced Rh30-KPHBD-cl22 cells. When different combinations of anchor and arbitrary primers were used, the DD-PCR products displayed significant expression pattern differences (data not shown). Isolation and characterization of these differentially expressed mRNA species is currently under investigation, and candidate genes are being evaluated for functional relevance to the malignant phenotype of ARMS.

Growth Properties of Conditional PAX3 Repressor ARMS Cell Lines.
To further substantiate the inducible PAX3 repressor Rh30 cell lines as pertinent model systems for the study of PAX-3-FKHR target genes in ARMS, we used the Rh30-KPHBD-cl22 cell line to examine whether KRAB-PAX3-HBD would function as a conditional repressor of ARMS malignant growth. Growth properties of Rh30 and Rh30-KPHBD-cl22 cells were studied in the presence or absence of 4-OHT under full-serum (10%) and reduced-serum (0.1%) conditions. The growth in full serum was not significantly changed relative to growth of a parallel un-induced culture on activation of KRAB-PAX3-HBD protein by 4-OHT (data not shown). However, under low-serum conditions, a significant reduction in the number of viable Rh30-KPHBD-cl22 cells over a 10-day period was observed when the KRAB-PAX3-HBD repressor was activated by 4-OHT and growth was evaluated by MTT assay (Fig. 6B)Citation . Rh30-SPHBD-cl8 cells expressing the SNAG-PAX3-HBD protein manifested similar hormone-dependent inhibition of cell growth (Fig. 6C)Citation . As expected, Rh30-K(DV)PHBD-cl24 cells did not show any growth retardation under either conditions (Fig. 6D)Citation , similar to parental Rh30 cells (Fig. 6A)Citation . Growth of un-induced Rh30-KPHBD-cl22 cells (Fig. 6B)Citation was also similar to that of Rh30 cell line (Fig. 6A)Citation . These results clearly indicate that conversion of the inactive repressor protein to an active form by 4-OHT is responsible for this growth inhibition in Rh30-KPHBD-cl22 and Rh30-SPHBD-cl8 cells. The malignant phenotype of the Rh30-KPHBD-cl22 cells was further examined in poly-HEMA-coated tissue culture plates to evaluate anchorage-independent growth potential. As expected, the parental Rh30 cell line exhibited abundant growth under the conditions of the poly-HEMA assay, and the growth was equivalent under un-induced and 4-OHT-induced conditions (Fig. 6E)Citation . In marked contrast, the Rh30-KPHBD-cl22 cell line showed a dramatic suppression of growth potential only on 4-OHT treatment (Fig. 6F)Citation .



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Hormone-dependent inhibition of malignant growth. The growth rate of Rh30 stable cell lines in low-serum medium in the presence or absence of 4-OHT was monitored over a 10-day period by MTT assay and plotted as A550 versus Time (in days). A, Rh30 cells; B, Rh30-KPHBD-cl22 cells; C, Rh30-SPHBD-cl8 cells; D, Rh30-K(DV)PHBD-cl24 cells. MTT assay of anchorage-independent growth in poly-HEMA-coated dishes under un-induced or 4-OHT-induced conditions. E, Rh30 cells; F, Rh30-KPHBD-cl22 cells.

 
Our data indicate that activation of the KRAB-PAX3-HBD repressor renders the Rh30-KPHBD-cl22 cells very sensitive to inhibition of growth in low-serum medium as evidenced by a loss of cell viability by day 8 (Fig. 6B)Citation . The PAX3 repressor also inhibited growth under anchorage-independent conditions as seen above, however, there was no evidence of drastic cell loss. We were interested to know whether the difference in growth kinetics observed between the two different assays could be due to apoptosis. Hence, we carried out two independent apoptosis assays (TUNEL and Annexin V) using Rh30-KPHBD-cl22 cells that were grown in low serum under un-induced or 4-OHT-induced conditions. On 4-OHT induction, the TUNEL assays showed a significant increase in the proportion of cells stained with streptavidin-FITC (Fig. 10B)Citation . This enhanced staining reflects incorporation of biotin-16-dUTP at DNA strand breaks and is a sensitive indication of apoptotic cell death. The level of nuclear staining by propidium iodide was the same in the presence or absence of 4-OHT induction, ruling out nonspecific cytotoxicity (data not shown). Enhanced immunodetection of Annexin V was also observed after 4-OHT induction (data not shown), supporting the correlation between KRAB-PAX3-HBD activity and apoptosis in low-serum culture.

These findings suggested that the KRAB-PAX3-HBD protein might have repressed a PAX3 target gene linked to protection from apoptosis, consistent with the role described for PAX proteins during development (10 , 11) . It has previously been reported that PAX8 can promote cell survival by activating antiapoptotic factors of the BCL family (8) . We evaluated expression of the BCL-XL survival factor in Rh30-KPHBD-cl22 cells that were grown in low serum under un-induced or 4-OHT-induced conditions. Immunoblot analysis of whole cell lysates indicated that the BCL-XL protein levels from 4-OHT-induced cells were decreased compared with un-induced cells (Fig. 7A)Citation . RT-PCR analysis using BCL-XL-specific primers indicated a reduced amplification of the BCL-XL product from reactions from 4-OHT-induced samples compared with the un-induced samples. These data indicate that activation of KRAB-PAX3-HBD protein results in repression of BCL-XL transcription (Fig. 7B)Citation .



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. A, BCL-XL expression in Rh30-SPHBD-cl8 (Lanes 1 and 2) and Rh30-KPHBD-cl22 cell lysates (Lanes 3 and 4) obtained after growth in low-serum medium (0.1%) under un-induced (Lanes 1 and 3) and 4-OHT-induced (Lanes 2 and 4) conditions. Depicted are immunoblot analyses of 100 µg of whole cell lysates using {alpha}-BCL-XL-specific antibody (top). Expression of {alpha}-tubulin in the same lysates was assessed as a control for equal loading (bottom). Semiquantitative RT-PCR analysis for BCL-XL (top) and NeoR (bottom) transcripts under un-induced and 4-OHT-induced conditions in the absence of cycloheximide (B) and in the presence of 50 µg/ml cycloheximide (C).

 
To test whether the KRAB-PAX3-HBD protein is a direct repressor of BCL-XL, Rh30-KPHBD-cl22 cells were induced with 4-OHT for 10 h in the presence of cycloheximide. The RT-PCR analyses (Fig. 7C)Citation indicated that amplification of the BCL-XL product continued to be diminished compared with the un-induced controls. However, the BCL-XL product generated from the cycloheximide-treated sample was not repressed as fully as the 4-OHT-induced, noncycloheximide-treated sample. This diminution may be attributed to a reduced level of the KRAB-PAX3-HBD protein after the cycloheximide treatment (data not shown). Overall, these results suggest that repression of the BCL-XL product does not require de novo protein synthesis and BCL-XL is a probable candidate for a direct target gene of PAX3-KRAB-HBD.

Hormone-dependent Suppression of Tumorigenesis in SCID Mice.
Our previous studies had demonstrated that PAX3-KRAB expression could suppress Rh30 cell tumorigenesis in SCID mice (18) . Thus, we were interested in whether conditional suppression of tumorigenesis in vivo could be demonstrated using the newly established conditional PAX3 repressor cell line Rh30-KPHBD-cl22. We generated tumors by injecting SCID mice with Rh30-pcDNA-cl5 or Rh30-KPHBD-cl22 cells. After a 10-day period to establish tumor growth, half of the mice having comparably sized tumors were implanted with slow-release pellets containing the 4-OHT inducer. Subsequently, tumor measurements were made at regular intervals for 3 weeks, and these results over time are shown in Fig. 8ACitation for Rh30-pcDNA-cl5 mice and in Fig. 8BCitation for Rh30-KPHBD-cl22 mice. Data for the measured tumor volumes are presented in Fig. 8CCitation . After sacrifice, tumors were isolated by dissection, and their wet weights are plotted in Fig. 8DCitation . These results agree with the tumor volume estimates and clearly indicate that in the presence of 4-OHT only the Rh30-KPHBD-cl22 mice showed a reduction in tumor growth, whereas the Rh30-pcDNA-cl5 mice did not. The mice bearing the Rh30-pcDNA-cl5 and the Rh30-KPHBD-cl22 tumors were photographed before sacrifice (Fig. 9A)Citation . RT-PCR analysis of tumor RNA using the HBD 5' and 3' primers indicated that only Rh30-KPHBD-cl22 (-/+ 4-OHT)-injected mice expressed the KRAB-PAX3-HBD transcript (Fig. 9B)Citation . Furthermore, the tumors from the un-induced or 4-OHT-induced pcDNA-cl5 mice and the un-induced KPHBD-cl22 mice contained many blood vessels in the H&E-stained tumor tissue sections (Fig. 10C)Citation . On the contrary, in the 4-OHT-induced KPHBD-cl22 mice significantly fewer blood vessels were evident. It is presently unknown whether the reduced angiogenesis is directly related to the KRAB-PAX3-HBD protein or a secondary consequence of the reduced tumor burden. TUNEL assays performed on the tumor sections from the negative control mice (un-induced or 4-OHT-induced pcDNA-cl5 mice and the un-induced KPHBD-cl22 mice) showed a similar low level of staining, indicating very little apoptosis in vivo (Fig. 10D)Citation . However, an enhanced streptavidin-FITC staining was observed in the tumor sections from the 4-OHT-induced KPHBD-cl22 mice, indicative of KRAB-PAX3-HBD-induced apoptotic cell death in vivo.



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Hormone-dependent suppression of tumorigenic growth of Rh30 cell clones in SCID mice by activation of the KRAB-PAX3-HBD repressor protein. Fifteen CB17 SCID mice received s.c. injections of Rh30-pcDNA-cl5 or Rh30-KPHBD-cl22 clonal cell lines. Tumor-bearing mice (five each) either were induced by implantation of slow release 4-OHT pellets or were un-induced. Progression of tumor volumes for Rh30-pcDNA-cl5 (pcDNA; A) and Rh30-KPHBD-cl22 (KPHBD; B) mice. Solid symbols represent 4-OHT-induced mice, whereas open symbols indicate un-induced mice. Volumes (C) and wet weights (D) of the dissected tumors.

 


View larger version (93K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. A, un-induced and 4-OHT-induced tumors in SCID mice bearing Rh30-pcDNA-cl5 or Rh30-KPHBD-cl22 cell tumors. The site of implantation of 4-OHT pellets is indicated by the arrows. B, RT-PCR analysis of tumors derived from Rh30-KPHBD-cl22 SCID mice (un-induced: Lanes 1, 2, and 3; 4-OHT-induced: Lanes 4, 5, and 6) and of tumors derived from Rh30-pcDNA-cl5 control mice (un-induced: Lanes 7, 8, and 9; 4-OHT-induced: Lanes 10, 11, and 12). The arrow indicates the specific product from the pcKRAB-PAX3-HBD plasmid (KPHBD).

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we have generated ARMS cell lines with conditional PAX3 repressors to establish a system to understand the biological role and identify endogenous target genes of the PAX3-FKHR oncoprotein. The conditional PAX3 repressors were generated by fusing the KRAB or SNAG repression domains and PAX3 DNA-binding motifs to the tamoxifen-selective ERTM HBD of the estrogen receptor. We believe that application of our conditional repressors to the ARMS model system is especially relevant for evaluating the cellular pathways aberrantly regulated by the PAX3-FKHR protein. One important advantage of using the ERTM system is that rapid activation of the transcription factor-ER fusion protein can be achieved by a simple ligand-mediated on/off mechanism (24 , 35) . Thus, the immediate consequences of the KRAB-PAX3-HBD repressor on biological properties contributing to malignant growth and tumorigenesis can be studied without selection for secondary mechanisms.

Our confidence in the conditional repressors applied in this study is supported by the following principal results that support their effective dominant negative function. First, the KRAB-PAX3-HBD and SNAG-PAX3-HBD proteins were fully competent in binding to the e5 target DNA in EMSA analysis. The super-shift experiments showed that the KRAB-PAX3-HBD protein was also fully capable of binding the KAP-1 corepressor, which is a prerequisite for KRAB-mediated transcriptional repression (20) . Conditional repressors using the SNAG domain do not rely on KAP-1 association, thus, may have an extended applicability in biological systems in which KAP-1 is not present, such as in insect cells, or in certain differentiated cell types (31) . Second, the ability of the KRAB-PAX3-HBD and SNAG-PAX3-HBD conditional repressors to induce transcriptional repression was tightly regulated by the ligand, 4-OHT. Moreover, the degree of transcriptional repression achieved by the conditional KRAB-PAX3-HBD repressor was as potent as the repression observed with the constitutive KRAB-PAX3 repressor, implying that fusion of the ER HBD did not interfere with the expected function. Third, in Rh30 stable clones, the KRAB-PAX3-HBD and the SNAG-PAX3-HBD protein expression levels were higher than that of the endogenous PAX3-FKHR protein; hence, the repressors would be expected to have a competitive advantage for PAX3-FKHR target genes. Fourth, the conditional PAX3 repressor proteins exhibited hormone-dependent nuclear localization, which may account for the hormone-dependent biological effects in Rh30 cells. Fifth, the KRAB-PAX3-HBD and SNAG-PAX3-HBD proteins exhibited potent repression of either transiently transfected or integrated reporter genes in Rh30 ARMS cells. The conditional repressors were as effective in repression of integrated reporter plasmids as transiently transfected reporter plasmid. Furthermore, the repression of endogenous genes by the conditional repressors was confirmed by the DD-PCR analysis. In all cases, the conditional repression was dominant over any activation mediated by the endogenous PAX3-FKHR. In addition, there was a striking correlation between the expression levels of the PAX3 repressors and the degree of transcriptional repression. Sixth, the conditional PAX3 repressors exhibited hormone-dependent suppression of characteristic malignant properties such as: (a) growth in low serum; (b) anchorage-independent growth; and (c) tumorigenicity in SCID mice. Furthermore, both the KRAB-based as well as the SNAG-based conditional PAX3 repressors exhibited similar inhibitory properties, demonstrating that the growth inhibition did not depend on a particular type of repression mechanism. Finally, the temporal control afforded by the conditional PAX3 repressor allowed observation of immediate changes in growth under low-serum conditions that led us to demonstrate that the KRAB-PAX3-HBD protein induces apoptosis.

The hormone-dependent apoptosis exhibited in the conditional PAX3 repressor Rh30 cell lines under low-serum conditions is entirely consistent with previous studies in which an antisense approach was used to down-regulate PAX3-FKHR in Rh30 ARMS cells (10) . Furthermore, it has been clearly demonstrated that down-regulation of PAX3 function, either by mutation in splotch mice (14) , or by reduced expression in diabetic mice (36) , leads to extensive apoptosis. It is well established that many of the PAX family proteins function during organogenesis to protect cells from apoptosis (9 , 11 , 14) . Previous studies have linked the antiapoptotic function of PAX8 to activation of the BCL family protein, BCL-2 (8) . Our studies have demonstrated that the KRAB-PAX3-HBD protein can down-regulate expression of the BCL-XL cellular survival factor and induce apoptosis in Rh30 cell lines in vitro and in SCID mice in vivo. These observations suggest that PAX3-FKHR may contribute to oncogenesis in ARMS by activating the antiapoptotic BCL-XL survival factor. One advantage of the ER system for studying transcription factors like KRAB-PAX3-HBD is that activation of the ER-fusion protein can occur in the absence of de novo protein synthesis. Thus, in the presence of protein synthesis inhibitors such as cycloheximide, a distinction can be made between directly regulated target genes and those secondary targets whose regulation depends on transcription and translation of a primary target gene. Our data supports the hypothesis that BCL-XL is a direct PAX3 target gene, because the repression by KRAB-PAX3-HBD was largely insensitive to inhibition by cycloheximide. Recent studies have confirmed that PAX3 and PAX3-FKHR can directly regulate the BCL-XL via direct binding to the promoter (37) .

It is likely that regulation of apoptosis by PAX3 may involve several other mechanisms in addition to BCL-XL. Recent expression profiling has shown that PAX3-FKHR can activate expression of the SLUG protein (34) . Other studies have shown that SLUG plays an antiapoptotic role in E2A-HLF-induced tumorigenesis (38) . In addition, PAX3 is known to regulate c-MET, the receptor for the hepatocyte growth factor/scatter factor, which has also been implicated in apoptosis (39 , 40) . It is interesting that apoptosis was only observed when the KRAB-PAX3-HBD protein was activated under low-serum conditions, implying that the Rh30 cells may only depend on PAX3-FKHR for protection against apoptosis when deprived of certain factors present in serum. Substantial evidence supports a role for growth factor signaling in ARMS. PAX3-FKHR has been shown to activate expression of insulin-like growth factor II, which has a well-established role in ARMS malignant growth (34 , 41) . Other studies have defined a role for the wild-type FKHR protein in linking insulin signaling to a cellular proapoptotic response (41 , 42) . It is not known whether PAX3-FKHR exerts any dominant-negative effect on the wild-type FKHR protein derived from the nontranslocated allele in ARMS. Protection from apoptosis by PAX3-FKHR is likely to be a key oncogenic mechanism in ARMS that will require further identification and validation of the essential target genes.

Our demonstration that KRAB-PAX3-HBD Rh30 cell tumors show pronounced hormone-dependent inhibition of growth confirms our previous findings and emphasizes that in ARMS the tumorigenic potential is dependent on PAX3-FKHR. In SCID mice experiments, use of the timed-release pellets allowed maintenance of the blood levels of 4-OHT and activation of the conditional repressor throughout the course of the experiment. The tumors that grew from control cells without the repressor or from Rh30-KPHBD-cl22 cells without the 4-OHT inducer were heavily vascularized. It is interesting that only the Rh30-KPHBD-cl22 tumors derived from the 4-OHT-treated mice showed very little evidence of vascularization in the H&E-stained tumor sections. We are currently investigating whether the KRAB-PAX3-HBD protein may have repressed angiogenic factors.

We believe that our conditional PAX3 repressor strategies have targeted a major oncogenic mechanism in ARMS, protection from apoptosis by PAX3-FKHR. Characterization of repressed target genes that comprise the PAX3-FKHR "oncogenic transcriptome" in ARMS identified by differential display RT-PCR analysis is our current focus.


    ACKNOWLEDGMENTS
 
We are grateful to Dr. Satish Parimoo (Skin Biology, Johnson & Johnson, Skillman, NJ) for providing reagents and guidance with DD-PCR protocols. We thank Dr. Beat Schafer for the 6xCD19–2 (A-ins)-TK-LUC reporter plasmid. We thank Trevor Littlewood (ICRF, London) for the HBD-ERTM plasmid. Richelle Takemoto and Rachel Beurmann of Dr. Meenhard Herlyn’s laboratory at the Wistar Institute provided assistance with tumorigenicity studies in SCID mice. We are grateful to members of Dr. Frank Rauscher’s laboratory for helpful suggestions and comments.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 K. A. was supported by the American Cancer Society NP-954 Research Training Grant. W. J. F. was supported by Wistar Basic Cancer Research Training Grant CA09171. F. J. R. is supported in part by NIH Grants CA52009, Core Grant CA10815, DK49210, GM54220, DAMD17-96-1-6141, ACS NP-954, the Irving A. Hansen Memorial Foundation, the Mary A. Rumsey Memorial Foundation, and the Pew Scholars Program in the Biomedical Sciences. Back

2 To whom requests for reprints should be addressed, at The Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104. Phone: (215) 898-0995; Fax: (215) 898-3929; E-mail: rauscher{at}wista.wistar.upenn.edu Back

3 The abbreviations used are: ARMS, alveolar rhabdomyosarcoma; 4-OHT, 4hydroxytamoxifen; EMSA, electrophoretic mobility shift assay; RT-PCR, reverse transcription-PCR; DD-PCR, differential display RT-PCR; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling; HBD, hormone-binding domain; FBS, fetal bovine serum; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. Back

4 Unpublished results. Back

Received 5/ 5/00. Accepted 8/17/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rauscher, F. J., III., and Vogt, P. K. Chromosomal translocations and oncogenic transcription factors. Current Topics in Microbiology and Immunology, vol. 220, pp.1–166. Berlin, Heidelberg: Springer-Verlag, 1997.
  2. Barr F. G. The role of chimeric paired box transcription factors in the pathogenesis of pediatric rhabdomysarcoma. Cancer Res., 59: 1711s-1715s, 1999.
  3. Galili, N., Davis, R. J., Fredericks, W. J., Mukhopadhyay, S., Rauscher, F. J., III., Emanuel, B. S., Rovera, G., and Barr, F. G. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma [published erratum appears in Nat. Genet., 6: 214, 1994]. Nat Genet., 5: 230–235, 1993.
  4. Fredericks W. J., Galili N., Mukhopadhyay S., Rovera G., Bennicelli J., Barr F. G., Rauscher F. J., III. The PAX3-FKHR fusion protein created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent transcriptional activator than PAX3. Mol. Cell. Biol., 15: 1522-1535, 1995.[Abstract]
  5. Davis R. J., Barr F. G. Fusion genes resulting from alternative chromosomal translocations are overexpressed by gene-specific mechanisms in alveolar rhabdomyosarcoma. Proc. Natl. Acad. Sci. USA, 94: 8047-8051, 1997.[Abstract/Free Full Text]
  6. Mansouri A. The role of Pax3 and Pax7 in development and cancer. Crit. Rev. Oncog., 9: 141-149, 1998.[Medline]
  7. Maulbecker C. C., Gruss P. The oncogenic potential of Pax genes. EMBO J., 12: 2361-2367, 1993.[Medline]
  8. Hewitt S. M., Hamada S., Monarres A., Kottical L. V., Saunders G. F., McDonnell T. J. Transcriptional activation of the bcl-2 apoptosis suppressor gene by the paired box transcription factor PAX8. Anticancer Res., 17: 3211-3215, 1997.[Medline]
  9. Ostrom L., Tang M. J., Gruss P., Dressler G. R. Reduced Pax2 gene dosage increases apoptosis and slows the progression of renal cystic disease. Dev. Biol., 219: 250-258, 2000.[Medline]
  10. Bernasconi M., Remppis A., Fredericks W. J., Rauscher F. J., III., Schafer B. W. Induction of apoptosis in rhabdomyosarcoma cells through down- regulation of PAX proteins. Proc. Natl. Acad. Sci. USA, 93: 13164-9, 1996.[Abstract/Free Full Text]
  11. Borycki A. G., Li J., Jin F., Emerson C. P., Epstein J. A. Pax3 functions in cell survival and in pax7 regulation. Development, 126: 1665-1674, 1999.[Abstract]
  12. Reeves F. C., Burdge G. C., Fredericks W. J., Rauscher F. J., III., Lillycrop K. A. Induction of antisense Pax-3 expression leads to the rapid morphological differentiation of neuronal cells and an altered response to the mitogenic growth factor bFGF. J. Cell Sci., 112: 253-261, 1999.[Abstract]
  13. Goulding M., Lumsden A., Paquette A. J. Regulation of Pax-3 expression in the dermomyotome and its role in muscle development. Development, 120: 957-971, 1994.[Abstract]
  14. Dickman E. D., Rogers R., Conway S. J. Abnormal skeletogenesis occurs coincident with increased apoptosis in the Splotch (Sp2H) mutant: putative roles for Pax3 and PDGFR{alpha} in rib patterning. Anat. Rec., 255: 353-361, 1999.[Medline]
  15. Watanabe A., Takeda K., Ploplis B., Tachibana M. Epistatic relationship between Waardenburg syndrome genes MITF and PAX3. Nat. Genet., 18: 283-286, 1998.[Medline]
  16. Arnold H. H., Winter B. Muscle differentiation: more complexity to the network of myogenic regulators. Curr. Opin. Genet. Dev., 8: 539-544, 1998.[Medline]
  17. Epstein J. A., Song B., Lakkis M., Wang C. Tumor-specific PAX3-FKHR transcription factor, but not PAX3, activates the platelet-derived growth factor {alpha} receptor. Mol. Cell. Biol., 18: 4118-4130, 1998.[Abstract/Free Full Text]
  18. Fredericks W. J., Ayyanathan K., Friedman J. R., Rauscher F. J., III. An engineered PAX3-KRAB transcriptional repressor inhibits the malignant phenotype of alveolar rhabdomyosarcoma cells harboring the PAX3-FKHR oncogene. Mol. Cell. Biol., 20: 5019-5031, 2000.[Abstract/Free Full Text]
  19. Margolin J. F., Friedman J. R., Meyer W. K., Vissing H., Thiesen H. J., Rauscher F. J., III. Kruppel-associated boxes are potent transcriptional repression domains. Proc. Natl. Acad. Sci. USA, 91: 4509-4513, 1994.[Abstract/Free Full Text]
  20. Friedman J. R., Fredericks W. J., Jensen D. E., Speicher D. W., Huang X. P., Neilson E. G., Rauscher F. J., III. KAP-1, a novel corepressor for the highly conserved KRAB repression domain. Genes Dev., 10: 2067-2078, 1996.[Abstract/Free Full Text]
  21. Grimes H. L., Chan T. O., Zweidler-McKay P. A., Tong B., Tsichlis P. N. The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin-2 withdrawal. Mol. Cell. Biol., 16: 6263-6272, 1996.[Abstract]
  22. Madden S. L., Cook D. M., Morris J. F., Gashler A., Sukhatme V. P., Rauscher F. J., III. Transcriptional repression mediated by the WT1 Wilms tumor gene product. Science (Washington DC), 253: 1550-1553, 1991.[Abstract/Free Full Text]
  23. Wang Y., Xu J., Pierson T., O’Malley B. W., Tsai S. Y. Positive and negative regulation of gene expression in eukaryotic cells with an inducible transcriptional regulator. Gene Ther., 4: 432-441, 1997.[Medline]
  24. Littlewood T. D., Hancock D. C., Danielian P. S., Parker M. G., Evan G. I. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res., 23: 1686-1690, 1995.[Abstract/Free Full Text]
  25. Nutt S. L., Morrison A. M., Dorfler P., Rolink A., Busslinger M. Identification of BSAP (Pax-5) target genes in early B-cell development by loss- and gain-of-function experiments. EMBO J., 17: 2319-2333, 1998.[Medline]
  26. Kruse U., Iacovoni J. S., Goller M. E., Vogt P. K. Hormone-regulatable neoplastic transformation induced by a Jun-estrogen receptor chimera. Proc. Natl. Acad. Sci. USA, 94: 12396-12400, 1997.[Abstract/Free Full Text]
  27. Alarcon R. M., Rupnow B. A., Graeber T. G., Knox S. J., Giaccia A. J. Modulation of c-Myc activity and apoptosis in vivo. Cancer Res., 56: 4315-4319, 1996.[Abstract/Free Full Text]
  28. Milocco L. H., Haslam J. A., Rosen J., Seidel H. M. Design of conditionally active STATs: insights into STAT activation and gene regulatory function. Mol. Cell. Biol., 19: 2913-2920, 1999.[Abstract/Free Full Text]
  29. Thiesen H. J., Meyer W. Krab domains analyzed in human Cys/His-type zinc-finger proteins KOX 1, KOX 8, and KOX 19. Ann. NY Acad. Sci., 684: 243-245, 1993.[Medline]
  30. Schafer B. W., Czerny T., Bernasconi M., Genini M., Busslinger M. Molecular cloning and characterization of a human PAX-7 cDNA expressed in normal and neoplastic myocytes. Nucleic Acids Res., 22: 4574-4582, 1994.[Abstract/Free Full Text]
  31. Ryan R. F., Schultz D. C., Ayyanathan K., Singh P. B., Friedman J. R., Fredericks W. J., Rauscher F. J., III. KAP-1 corepressor protein interacts and colocalizes with heterochromatic and euchromatic HP1 proteins: a potential role for Kruppel-associated box-zinc finger proteins in heterochromatin-mediated gene silencing. Mol. Cell. Biol., 19: 4366-4378, 1999.[Abstract/Free Full Text]
  32. Pardinas J. R., Combates N. J., Prouty S. M., Stenn K. S., Parimoo S. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes. Anal. Biochem., 257: 161-168, 1998.[Medline]
  33. Fukazawa H., Mizuno S., Uehara Y. A microplate assay for quantitation of anchorage-independent growth of transformed cells. Anal. Biochem., 228: 83-90, 1995.[Medline]
  34. Khan J., Bittner M. L., Saal L. H., Teichmann U., Azorsa D. O., Gooden G. C., Pavan W. J., Trent J. M., Meltzer P. S. cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene. Proc. Natl. Acad. Sci. USA, 96: 13264-13269, 1999.[Abstract/Free Full Text]
  35. Chambraud B., Berry M., Redeuilh G., Chambon P., Baulieu E. E. Several regions of human estrogen receptor are involved in the formation of receptor-heat shock protein 90 complexes. J. Biol. Chem., 265: 20686-20691, 1990.[Abstract/Free Full Text]
  36. Fine E. L., Horal M., Chang T. I., Fortin G., Leoken M. R. Evidence that elevated glucose causes altered gene expression, apoptosis, and neural tube defects in a mouse model of diabetic pregnancy. Diabetes, 48: 2454-2462, 1999.[Abstract]
  37. Margue C. M., Bernasconi M., Barr F. G., Schafer B. W. Transcriptional modulation of the anti-apoptotic protein BCL-XL by the paired box transcription factors PAX3 and PAX3/FKHR. Oncogene, 19: 2921-2929, 2000.[Medline]
  38. Inukai T., Inoue A., Kurosawa H., Goi K., Shinjyo T., Ozawa K., Mao M., Inaba T., Look A. T. SLUG, a ces-1-related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Molecular Cell., 4: 343-352, 1999.[Medline]
  39. Bardelli A., Longati P., Albero D., Goruppi S., Schneider C., Ponzetto C., Comoglio P. M. HGF receptor associates with the anti-apoptotic protein BAG-1 and prevents cell death. EMBO J., 15: 6205-6212, 1996.[Medline]
  40. Fan S., Wang J. A., Yuan R. Q., Rockwell S., Andres J., Zlatapolskiy A., Goldberg I. D., Rosen E. M. Scatter factor protects epithelial and carcinoma cells against apoptosis induced by DNA-damaging agents. Oncogene, 17: 131-141, 1998.[Medline]
  41. Wang W., Kumar P., Epstein J., Helman L., Moore J. V., Kumar S. Insulin-like growth factor II and PAX3-FKHR cooperate in the oncogenesis of rhabdomyosarcoma. Cancer Res., 58: 4426-4433, 1998.[Abstract/Free Full Text]
  42. Tang E. D., Nunez G., Barr F. G., Guan K. L. Negative regulation of the forkhead transcription factor FKHR by Akt. J. Biol. Chem., 274: 16741-6, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
R. Amstutz, M. Wachtel, H. Troxler, P. Kleinert, M. Ebauer, T. Haneke, C. Oehler-Janne, D. Fabbro, F. K. Niggli, and B. W. Schafer
Phosphorylation Regulates Transcriptional Activity of PAX3/FKHR and Reveals Novel Therapeutic Possibilities
Cancer Res., May 15, 2008; 68(10): 3767 - 3776.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Ayyanathan, H. Peng, Z. Hou, W. J. Fredericks, R. K. Goyal, E. M. Langer, G. D. Longmore, and F. J. Rauscher III
The Ajuba LIM Domain Protein Is a Corepressor for SNAG Domain Mediated Repression and Participates in Nucleocytoplasmic Shuttling
Cancer Res., October 1, 2007; 67(19): 9097 - 9106.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. M. McKinnon, M. A. Ravier, and G. A. Rutter
FoxO1 Is Required for the Regulation of Preproglucagon Gene Expression by Insulin in Pancreatic {alpha}TC1-9 Cells
J. Biol. Chem., December 22, 2006; 281(51): 39358 - 39369.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Bulliard, M. Wiznerowicz, I. Barde, and D. Trono
KRAB Can Repress Lentivirus Proviral Transcription Independently of Integration Site
J. Biol. Chem., November 24, 2006; 281(47): 35742 - 35746.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. P. Sripathy, J. Stevens, and D. C. Schultz
The KAP1 Corepressor Functions To Coordinate the Assembly of De Novo HP1-Demarcated Microenvironments of Heterochromatin Required for KRAB Zinc Finger Protein-Mediated Transcriptional Repression
Mol. Cell. Biol., November 15, 2006; 26(22): 8623 - 8638.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Nabarro, N. Himoudi, A. Papanastasiou, K. Gilmour, S. Gibson, N. Sebire, A. Thrasher, M. P. Blundell, M. Hubank, G. Canderan, et al.
Coordinated oncogenic transformation and inhibition of host immune responses by the PAX3-FKHR fusion oncoprotein
J. Exp. Med., November 21, 2005; 202(10): 1399 - 1410.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
K. Ayyanathan, M. S. Lechner, P. Bell, G. G. Maul, D. C. Schultz, Y. Yamada, K. Tanaka, K. Torigoe, and F. J. Rauscher III
Regulated recruitment of HP1 to a euchromatic gene induces mitotically heritable, epigenetic gene silencing: a mammalian cell culture model of gene variegation
Genes & Dev., August 1, 2003; 17(15): 1855 - 1869.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Demirpence, A. Semlali, J. Oliva, P. Balaguer, E. Badia, M.-J. Duchesne, J.-C. Nicolas, and M. Pons
An Estrogen-responsive Element-targeted Histone Deacetylase Enzyme Has an Antiestrogen Activity That Differs from That of Hydroxytamoxifen
Cancer Res., November 15, 2002; 62(22): 6519 - 6528.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. C. Schultz, K. Ayyanathan, D. Negorev, G. G. Maul, and F. J. Rauscher III
SETDB1: a novel KAP-1-associated histone H3, lysine 9-specific methyltransferase that contributes to HP1-mediated silencing of euchromatic genes by KRAB zinc-finger proteins
Genes & Dev., April 15, 2002; 16(8): 919 - 932.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Anderson, A. Ramsay, S. Gould, and K. Pritchard-Jones
PAX3-FKHR Induces Morphological Change and Enhances Cellular Proliferation and Invasion in Rhabdomyosarcoma
Am. J. Pathol., September 1, 2001; 159(3): 1089 - 1096.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ayyanathan, K.
Right arrow Articles by Rauscher, F. J., III


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online