| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
The Wistar Institute, Philadelphia, Pennsylvania 19104
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
ARMSs occur due to a highly specific chromosomal translocation event [t(2;13) (q35;q14)] that juxtaposes the DNA-binding domains of PAX3 with the transcriptional activation domain of FKHR (3) . In transfection assays, PAX3-FKHR, the causative oncogene in ARMS, functions as a more potent activator of transcription than the wild-type PAX3 (4) . Less frequently, another translocation [t(1;13) (p36;q14)] fuses the PAX7 DNA-binding domain to the same FKHR activation domain (5) . These studies suggest that these PAX proteins have sustained a gain of function that leads to ARMS tumorigenesis (2) . However, the PAX3-FKHR-activated target genes responsible for ARMS have not been defined.
The PAX gene family consists of nine members that are unified by the presence of the paired box DNA-binding domain and are subclassified based on their genomic organization. PAX proteins play regulatory roles in pattern formation during organogenesis (6) . Ectopic expression of several PAX genes in NIH/3T3 cells induces cellular transformation and tumor formation in nude mice, suggesting that deregulated expression of PAX proteins could play a role in human tumorigenesis (6 , 7) . Furthermore, suppression of apoptosis by PAX proteins is crucial for their complex developmental role and could account for their tumorigenic potential (8 , 9) . In accordance with this, antisense inhibition of PAX genes results in growth arrest and apoptosis in tumor cell lines (10, 11, 12) . Although evidence supports a role for PAX3 in protection of cells from apoptosis during development, the mechanism has not been determined (11) .
The developmental abnormalities and alterations in gene expression
observed in the splotch mouse model, which contains
mutations in the PAX3 DNA-binding domains, has suggested several
downstream target genes regulated by PAX3 (13
, 14)
.
Candidate targets include mi (15)
,
myoD and myogenin (16)
,
pax7 (11)
and others. Similarly, transfection
of the PAX3-FKHR fusion protein present in ARMS into heterologous cells
has been shown to up-regulate the expression of pdgfr-
and c-met, the receptor for hepatocyte scatter factor
(17)
. Whether any of these candidate genes play a role in
ARMS tumorigenesis remains to be clarified.
It is generally hypothesized that the enhanced transcriptional activation potential of PAX3-FKHR is responsible for ARMS. We have previously engineered synthetic PAX3 repressors using the KRAB repression domain and demonstrated that expression of a PAX3-KRAB repressor in the ARMS Rh30 cell line could inhibit malignant growth (18) . The KRAB domain functions as a potent DNA binding-dependent transcriptional repression module by recruiting the KAP-1 corepressor (19 , 20) . Other repression domains such as the SNAG domain from the GFI-1 proto-oncogene (21) and the WT-1 repression domain derived from the Wilms tumor gene (22) do not use the KAP-1 corepressor mechanism. The KRAB and the SNAG domains are well suited for the creation of engineered repressors due to their small size and strong repression potentials when fused to heterologous DNA-binding domains.
We were interested in developing conditional PAX3 repressors to examine the immediate consequences of repressing PAX3 target genes in ARMS cell clones. The use of conditional repressors avoids secondary changes in cells that might be selected by constitutive expression of transcriptional repressors. Several conditional eukaryotic expression systems based on either inducible transcription or conditional activity due to fusion to the HBD of steroid receptors have been developed (23) . Of these, the HBD fusion confers rapid temporal regulation to the functionality of heterologous proteins. Furthermore, specific mutations in the HBDs make these receptors very selective to synthetic ligands without being influenced by endogenous hormones (24) . HBD fusions with transcription factors including PAX5 (25, 26, 27) and enzymes such as STAT6 (28) have been successfully made to generate hormone-dependent conditional alleles.
In this study, we generated hormone-inducible, conditional alleles of a KRAB-PAX3 protein by fusing it to the HBD of the murine estrogen receptor ERTM, which exhibits selectivity to 4-OHT (24) . Hormone-dependent changes in biological properties such as growth in low-serum medium, apoptosis, anchorage-independent growth, and growth as tumors in SCID mice, were studied using ARMS Rh30 cell clones expressing the KRAB-PAX3-HBD repressors. The results of these experiments suggest that we have successfully used the inducible repressor strategy to down-regulate the set of PAX3 target genes that are activated by the PAX3-FKHR oncoprotein. Furthermore, we have used the conditional PAX3 repressors in ARMS cells to explore whether the cellular survival factor BCL-XL might be a PAX3 target gene and be involved in ARMS tumorigenesis. These studies represent a first step in the identification of important oncogenic targets in ARMS by creation of a biological system well suited for analysis using differential gene expression array technologies.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Expression Plasmids.
The previously described pcDNA3-PAX3-STOP plasmid, which expresses a
hybrid mouse-human PAX3 protein, was used as a base to construct the
KRAB-PAX3 wild-type and mutant fusion genes (4
, 18)
. This
plasmid was digested with HindIII and BamHI and
ligated to the wild-type or the mutant
(D18V19 changed to
A18A19) KRAB repression
domains (19)
. The KRAB domain-encoding fragments were
generated by PCR amplification from the pM1-KOX-1 template
(29)
and were derived as HindIII and
BamHI fragments encoding amino acids 190 of the KOX1 cDNA.
The 5' oligonucleotide primer incorporated a HindIII site
and a Kozak consensus immediately before the KOX-1 initiator methionine (5' primer, 5'-TTTTAAGCTTCCACCATGGATGCTAAGTCAC-3'). The 3'
oligonucleotide primer incorporated a BamHI site after amino
acid 90 of KOX-1 (3' primer, 5'-TTTTGGATCCAGTCTCTGAATCAGGATG-3'). The
resulting pcDNA3-KRAB-PAX3-STOP plasmid contains the KRAB domain,
followed by a small linker encoding amino acids GSGVP, followed by
amino acids 11381 of the PAX3 DNA-binding domain. After amino acid
381, the PAX3-STOP protein is terminated by a vector-derived stop codon
(18)
. The pcKRAB-PAX3-HBD plasmid was constructed by
fusing the HBD, ERTM of the murine estrogen
receptor, to pcKRAB-PAX3-STOP. The ERTM DNA was
generated by PCR amplification from the
pBS+ERTM plasmid
(24)
template using a pair of oligonucleotide primers
designed to incorporate flanking EcoRI sites (5' primer,
5'-GCATGAATTCTATGGGTGCTTCAGGAG-3'; 3' T3 promoter primer,
5'-AATTAACCCTCACTAAAGGG-3'). The PCR product was digested with
EcoRI and ligated to the unique EcoRI site just
5' of the vector-derived stop codon in the pcKRAB-PAX3-STOP plasmid to
create an in-frame fusion. The pcSNAG-PAX3-HBD plasmid was constructed
by fusing the HBD to the pcDNA3-SNAG-PAX3 plasmid, as described above.
The fragment encoding the SNAG domain was generated by overlapping PCR
amplification. The 5' primer was designed to incorporate an
EcoRI and a BamHI site, a Kozak consensus
sequence, and the SNAG domain sequences (encoding amino acids 115; 5'
primer, 5'-GAATTCGGATCC
ACCATGCCACGTTCTTTCCTGGTTAAATCTAAAAAAGCGCACTCTTACC-3'). The3'
primer contained the remaining portion of the SNAG domain (amino acids
1620 in an antisense orientation), followed by BglII and
SalI sites (3'-primer,
5'-GTCGACAGATCTGGAGTAGTCCGGACCCGGAGAACGCGGCTGGTGGTAAGAGTGCGCTTTTTTAG-3').
These two oligonucleotides were annealed and amplified to yield a
105-bp fragment that was used as a template in the PCR reaction with a
pair of flanking primers: (5'-GTCAGAATTCGGATCCACC-3'; and 3' primer,
5'-CCAAGTCGACAGATCTGGAG-3'). The resulting PCR product was digested
with BamHI and BglII and cloned into the
BamHI site in the pcDNA3-PAX3-STOP plasmid. The
general-purpose vector pcDNA3-KRAB-MNP-HBD was constructed in two
steps. First, the KRAB domain was amplified using the 5'
HindIII primer described above and a 3' primer that
incorporated a myc-epitope tag (EQKLISEEDL) and a nuclear
localization signal of the E1A gene (KRPRP) immediately
after amino acid 89 of the KRAB domain, followed by a BamHI
site. Next, the ERTM DNA was generated by PCR
amplification using a 5' primer designed to incorporate a polylinker
composed of BamHI, EcoRI, EcoRV, and
ClaI sites, and the 3' T3 primer. This fragment was cleaved
with BamHI and NotI, and then these two fragments
were cloned into the HindIII and NotI sites of
the pcDNA3 vector to generate the final construct. The nucleotide
sequences of all PCR-derived constructs were confirmed by sequencing
both strands. The previously described PAX reporter plasmid,
CD192(A-ins)-TK-LUC (30)
, was modified by incorporation
of a ZeocinR cassette derived as a
PvuII fragment from the pcDNA3.1Zeo plasmid (Invitrogen) to
create the CD192(A-ins)-TKLUC-ZeoR
plasmid.
COS-1 Transfection, Extract Preparation, and Immunoprecipitation.
The expression plasmids depicted in Fig. 1A
were transfected into COS-1 cells for 6 h with a
mixture of DNA:lipofectAMINE in the ratio 1:6 in optiMEM, followed by
growth for 48 h in DMEM containing 10% FBS. Transfected cells
were metabolically labeled with 35S-methionine,
and the cell extracts prepared in radioimmunoprecipitation assay buffer
were subjected to immunoprecipitation analysis with
-KRAB,
-PAX3,
and
-HBD antibodies, as described previously (4
, 18)
.
|
3 µg/µl, prepared as described previously; Refs.
4
and 31
). For the antibody supershift
studies,
-KRAB or
-PAX3 IgG (2 µg/µl) was included in the
EMSA-binding reactions.
Northern Analysis for KRAB-PAX3-HBD Transcript.
Total RNA was isolated from Rh30-KPHBD-cl22 cells using the TRIzol
reagent (Life Technologies, Inc., Rockville, MD) and electrophoresed on
1% formaldehyde-agarose gels. Prior to RNA isolation, Rh30-KPHBD-cl22
cells were either un-induced (treated with 0.1% ethanol as a solvent
control) or induced with 500 nM 4-OHT. The gel was stained
with ethidium bromide to assess the integrity and equal loading of the
samples and then transferred to a nylon membrane (Hybond). The membrane
was prehybridized, hybridized with radiolabeled PAX3-KRAB probe, and
washed to a final stringency of 0.2x SSC, 0.2% SDS, at 65°C, before
autoradiography.
Indirect Immunofluorescence.
Subcellular localization of KRAB-PAX3 and KRAB-PAX3-HBD proteins in
Rh30, Rh30-pcDNA-cl5, and Rh30-KPHBD-cl22 cells grown on cover glasses
was conducted using previously described procedures for
immunofluorescence (31)
. After fixation with 1%
paraformaldehyde and permeabilization with 0.2% Triton X-100 (Sigma
Chemical Co.), the antigens were localized using
-PAX3 or
-HBD
primary rabbit antibodies, followed by detection with a secondary
biotinylated
-rabbit IgG and avidin-FITC (Vector Laboratories,
Inc.). The nuclei were counterstained for DNA with 0.5 µg/ml Hoechst
33258 (Sigma Chemical Co.) and the cells were visualized using a Leica
confocal laser-scanning microscope. The HC-20 antibody to the HBD of
the murine estrogen receptor was obtained from Santa Cruz Biotechnology
Inc.
Transient Transfections and Reporter Assays.
The transcription assays were performed on NIH/3T3 cells that were
transiently transfected with a LipofectAMINE mixture containing 1 or
2.5 µg of the expression plasmids (pcDNA3, pcKRAB-PAX3, and
pcKRAB-PAX3-HBD), 0.5 µg of CD192(A-ins)-TK-LUC, and 0.25 µg of
CMV-ß-D-galactosidase plasmids, as described previously
(18)
. Transfected cells were treated with 0.1% ethanol as
a solvent control for un-induced dishes or were induced with 500
nM 4-OHT (Research Biochemicals International, Natick, MA).
After 24 h, the cells were washed twice with Tris-buffered saline,
and the cell extracts were prepared in reporter lysis buffer and
assayed for luciferase and ß-galactosidase activities as described
(31)
.
Generation of Stable Rh30 Cell Clones.
Rh30 cell transfectants containing the conditional PAX3 repressor
plasmids depicted in Fig. 1A
or the pcDNA3 vector were
isolated as individual colonies using cloning rings and were expanded
into cell lines after selection for stable resistance to 500 µg/ml
G418 (Mediatech, Inc., Herndon, VA). Twenty-four independent cell lines
were tested for expression of the PAX3-HBD repressor proteins by
immunoprecipitation with
-PAX3 IgG. Dual-stable inducible PAX3
repressor/PAX3 reporter cell clones were generated in the
Rh30-KPHBD-cl22 cell line after transfection with the
CD192(A-ins)-TK-LUC-ZeoR plasmid and selection
with 500 µg/ml G418 and 100 µg/ml Zeocin. The PAX3 repressor/PAX3
reporter cell lines, designated as HBDLUC clones, were screened for
repression of luciferase after induction with 4-OHT. The luciferase
activities of the HBDLUC clones were normalized to a protein content of
1.0 A595 unit in the BioRad protein assay.
DD-PCR.
Gene expression profiles of un-induced and 4-OHT-induced
Rh30-KPHBD-cl22 cells were analyzed using DD-PCR. Total RNA was
isolated using the TRIzol reagent and poly(A)+
mRNA was purified using the oligo-(dT)25
Dynabeads (Dynal, Inc., Lake Success, NY). First-strand cDNA was
synthesized using the Life Technologies, Inc. cDNA synthesis system and
quantitated by spectrophotometry. Differential subtraction display PCR
was conducted as described (32)
, and the samples were
electrophoresed on a sequencing gel and autoradiographed.
Low-Serum and Poly-HEMA-MTT Assays.
The growth assays of Rh30, Rh30-KPHBD-cl22, Rh30-SPHBD-cl8, and
Rh30-K(DV)PHBD-cl24 cell lines in low-serum (0.1% FBS) medium was
conducted in 24-well tissue culture plates and was repeated twice with
at least 10 replicates. The anchorage-independent growth of parental
Rh30 and Rh30-KPHBD-cl22 cells was evaluated using poly-HEMA-coated
plates. In both assays, the proportion of viable cells at each time
point was determined by MTT assay, as described previously
(33)
.
Apoptosis Assays.
Apoptosis assays were performed using the ApoAlert DNA Fragmentation
and the ApoAlert Annexin V Assay kits according to the manufacturers
instructions (Clontech Laboratories, Inc.). Assays were conducted on
SCID mouse tumor sections or on Rh30-KPHBD-cl22 cells that were grown
on coverslips in low-serum medium under either un-induced (0.1%
ethanol) or 4-OHT-induced conditions (500 nM, 48 h).
The polyclonal rabbit antibody for immunoblot detection of
BCL-XL (bcl-x, Ab-1) and the antibody for
detection of human
-tubulin as a loading control were obtained from
Oncogene Research Products (Cambridge, MA).
Semiquantitative RT-PCR Analysis.
For RT-PCR analysis, RNA was isolated from the un-induced or the
4-OHT-induced Rh30-KPHBD-cl22 and Rh30-SPHBD-cl8 cells grown in
low-serum medium using the TRIzol reagent. The reverse transcription
reactions were performed on 5 µg of total RNA using oligo-dT primers
with the Ready-To-Go You-Prime First-Strand Synthesis Beads (Pharmacia
Biotech). The PCR reactions were carried out with 2.5 µl of reverse
transcription reactions as templates. A pair of primers specific for
the human BCL-XL transcript (5' primer,
5'-CAGCAGCAGTTTGGATGC-3'; 3'-primer, 5'-CCACAGTCATGC CCG TC-3') was
used to amplify the 448-bp product. A specific primer pair (5'-primer,
5'-TCAGCGCAGGGGCGCCCGGTTCTT T-3'; and 3'-primer,
5'-ATCGACAAGACCGGCTTCCATCCGA-3') was used to amplify the 345-bp product
from the NeoR gene. A pair of primers
specific for the HBD of the murine estrogen receptor (5'-primer,
5'-GCGACGGGCCCATGGGTGCTTCAG G-3'; and 3'-primer,
5'GGTGGGCCCCTGATATCACAAGTCCTCTTCAGAAATGAGCTTTTGCTCGATCGTGTTGGGGAAGCC-3')
was used to amplify a 1010-bp product from the SCID mouse tumor samples
that were derived from Rh30-KPHBD-cl22 cells.
Tumor Growth Inhibition Assays in SCID Mice.
The tumorigenic potentials of Rh30-pcDNA-cl5 and Rh30-KPHBD-cl22 cell
lines were evaluated after s.c. injection into female CB17-SCID mice, 6
weeks of age. Evidence of tumor growth became apparent after 10 days,
at which time the mice were divided into two groups of five mice each
(un-induced and 4-OHT induced). The mice of the 4-OHT-induced group
were implanted with 35-mg timed-release pellets specified to maintain a
200-nM circulating concentration of 4-OHT for 21 days
(Innovative Research of America, Sarasota, FL). Improved implant
success was ensured by application of DERMABOND topical skin adhesive
(Ethicon, Inc., Somerville, NJ) over the wounds. Alternate day
measurements of tumor volumes were made using a tumorimeter (Cancer
Technologies, Inc., Tucson, AZ). After 3 weeks, the mice were
sacrificed and the wet weights of the tumors were recorded. A portion
of each tumor was fixed in formalin for H&E staining and
histopathological evaluation.
| RESULTS |
|---|
|
|
|---|
Characteristics of Engineered Repressor Proteins.
Immunoprecipitation analysis of transfected COS-1 cell extracts using
both
-KRAB and
-PAX3 IgGs (Fig. 2A)
demonstrates that the pcKRAB-PAX3 (55 kDa) and
pcKRAB-PAX3-HBD (88 kDa) proteins are expressed in vivo at
the size predicted by their cDNAs and are recognized by the appropriate
antibodies. The EMSA analysis (Fig. 2B)
indicated the
presence of clear binary complexes of both KRAB-PAX3:e5DNA and
KRAB-PAX3-HBD:e5DNA, which confirmed that both KRAB-PAX3 and
KRAB-PAX3-HBD proteins exhibited the anticipated DNA-binding
properties. We have previously shown, by competition with unlabeled
homologous oligonucleotide, that binding of PAX3 protein to the e5
binding site probe is specific (4)
. Furthermore, these
binary complexes were confirmed to contain the predicted proteins
because they were efficiently super-shifted when
-KRAB or
-PAX3
IgG was included during the DNA-binding reactions (data not shown). It
was also evident that the KRAB domain present in the binary complex was
amenable for protein-protein interactions because ternary complexes of
KRAB-PAX3:KAP-1:e5DNA or KRAB-PAX3-HBD:KAP-1:e5DNA were observed when
COS-1 nuclear extract was included in the gel-shift reaction as a
source of the KAP-1 corepressor (20)
. We have also found
that the SNAG-PAX3-HBD protein efficiently binds the e5 DNA probe but
does not form a ternary complex with KAP-1 (data not shown). As would
be expected with the ERTM posttranslational
regulation system, we have shown that similar levels of KRAB-PAX3-HBD
transcript are expressed in Rh30-KPHBD-cl22 cells grown under both
un-induced and 4-OHT-induced conditions (Fig. 2C)
.
Immunofluorescence microscopy indicated that in the absence of hormone
the KRAB-PAX3-HBD protein was predominantly cytoplasmic (Fig. 10A
, top), but after induction with 4-OHT it was
located in the nucleus (Fig. 10A
, bottom).
|
|
|
|
|
Growth Properties of Conditional PAX3 Repressor ARMS Cell Lines.
To further substantiate the inducible PAX3 repressor Rh30 cell lines as
pertinent model systems for the study of PAX-3-FKHR target genes
in ARMS, we used the Rh30-KPHBD-cl22 cell line to examine whether
KRAB-PAX3-HBD would function as a conditional repressor of ARMS
malignant growth. Growth properties of Rh30 and Rh30-KPHBD-cl22 cells
were studied in the presence or absence of 4-OHT under full-serum
(10%) and reduced-serum (0.1%) conditions. The growth in full serum
was not significantly changed relative to growth of a parallel
un-induced culture on activation of KRAB-PAX3-HBD protein by 4-OHT
(data not shown). However, under low-serum conditions, a significant
reduction in the number of viable Rh30-KPHBD-cl22 cells over a 10-day
period was observed when the KRAB-PAX3-HBD repressor was activated by
4-OHT and growth was evaluated by MTT assay (Fig. 6B)
. Rh30-SPHBD-cl8 cells expressing the SNAG-PAX3-HBD protein
manifested similar hormone-dependent inhibition of cell growth (Fig. 6C)
. As expected, Rh30-K(DV)PHBD-cl24 cells did not show any
growth retardation under either conditions (Fig. 6D)
,
similar to parental Rh30 cells (Fig. 6A)
. Growth of
un-induced Rh30-KPHBD-cl22 cells (Fig. 6B)
was also similar
to that of Rh30 cell line (Fig. 6A)
. These results clearly
indicate that conversion of the inactive repressor protein to an active
form by 4-OHT is responsible for this growth inhibition in
Rh30-KPHBD-cl22 and Rh30-SPHBD-cl8 cells. The malignant phenotype of
the Rh30-KPHBD-cl22 cells was further examined in poly-HEMA-coated
tissue culture plates to evaluate anchorage-independent growth
potential. As expected, the parental Rh30 cell line exhibited abundant
growth under the conditions of the poly-HEMA assay, and the growth was
equivalent under un-induced and 4-OHT-induced conditions (Fig. 6E)
. In marked contrast, the Rh30-KPHBD-cl22 cell line
showed a dramatic suppression of growth potential only on 4-OHT
treatment (Fig. 6F)
.
|
These findings suggested that the KRAB-PAX3-HBD protein might have
repressed a PAX3 target gene linked to protection from apoptosis,
consistent with the role described for PAX proteins during development
(10
, 11)
. It has previously been reported that PAX8 can
promote cell survival by activating antiapoptotic factors of the BCL
family (8)
. We evaluated expression of the
BCL-XL survival factor in Rh30-KPHBD-cl22 cells
that were grown in low serum under un-induced or 4-OHT-induced
conditions. Immunoblot analysis of whole cell lysates indicated that
the BCL-XL protein levels from 4-OHT-induced
cells were decreased compared with un-induced cells (Fig. 7A)
. RT-PCR analysis using
BCL-XL-specific primers indicated a reduced
amplification of the BCL-XL product from
reactions from 4-OHT-induced samples compared with the un-induced
samples. These data indicate that activation of KRAB-PAX3-HBD protein
results in repression of BCL-XL transcription
(Fig. 7B)
.
|
Hormone-dependent Suppression of Tumorigenesis in SCID Mice.
Our previous studies had demonstrated that PAX3-KRAB expression could
suppress Rh30 cell tumorigenesis in SCID mice (18)
. Thus,
we were interested in whether conditional suppression of tumorigenesis
in vivo could be demonstrated using the newly established
conditional PAX3 repressor cell line Rh30-KPHBD-cl22. We generated
tumors by injecting SCID mice with Rh30-pcDNA-cl5 or Rh30-KPHBD-cl22
cells. After a 10-day period to establish tumor growth, half of the
mice having comparably sized tumors were implanted with slow-release
pellets containing the 4-OHT inducer. Subsequently, tumor measurements
were made at regular intervals for 3 weeks, and these results over time
are shown in Fig. 8A
for Rh30-pcDNA-cl5 mice and in Fig. 8B
for
Rh30-KPHBD-cl22 mice. Data for the measured tumor volumes are presented
in Fig. 8C
. After sacrifice, tumors were isolated by
dissection, and their wet weights are plotted in Fig. 8D
.
These results agree with the tumor volume estimates and clearly
indicate that in the presence of 4-OHT only the Rh30-KPHBD-cl22 mice
showed a reduction in tumor growth, whereas the Rh30-pcDNA-cl5 mice did
not. The mice bearing the Rh30-pcDNA-cl5 and the Rh30-KPHBD-cl22 tumors
were photographed before sacrifice (Fig. 9A)
. RT-PCR analysis of tumor RNA using the HBD 5' and 3'
primers indicated that only Rh30-KPHBD-cl22 (-/+ 4-OHT)-injected mice
expressed the KRAB-PAX3-HBD transcript (Fig. 9B)
.
Furthermore, the tumors from the un-induced or 4-OHT-induced pcDNA-cl5
mice and the un-induced KPHBD-cl22 mice contained many blood vessels in
the H&E-stained tumor tissue sections (Fig. 10C)
. On the contrary, in the 4-OHT-induced KPHBD-cl22 mice
significantly fewer blood vessels were evident. It is presently unknown
whether the reduced angiogenesis is directly related to the
KRAB-PAX3-HBD protein or a secondary consequence of the reduced tumor
burden. TUNEL assays performed on the tumor sections from the negative
control mice (un-induced or 4-OHT-induced pcDNA-cl5 mice and the
un-induced KPHBD-cl22 mice) showed a similar low level of staining,
indicating very little apoptosis in vivo (Fig. 10D)
. However, an enhanced streptavidin-FITC staining was
observed in the tumor sections from the 4-OHT-induced KPHBD-cl22 mice,
indicative of KRAB-PAX3-HBD-induced apoptotic cell death in
vivo.
|
|
| DISCUSSION |
|---|
|
|
|---|
Our confidence in the conditional repressors applied in this study is supported by the following principal results that support their effective dominant negative function. First, the KRAB-PAX3-HBD and SNAG-PAX3-HBD proteins were fully competent in binding to the e5 target DNA in EMSA analysis. The super-shift experiments showed that the KRAB-PAX3-HBD protein was also fully capable of binding the KAP-1 corepressor, which is a prerequisite for KRAB-mediated transcriptional repression (20) . Conditional repressors using the SNAG domain do not rely on KAP-1 association, thus, may have an extended applicability in biological systems in which KAP-1 is not present, such as in insect cells, or in certain differentiated cell types (31) . Second, the ability of the KRAB-PAX3-HBD and SNAG-PAX3-HBD conditional repressors to induce transcriptional repression was tightly regulated by the ligand, 4-OHT. Moreover, the degree of transcriptional repression achieved by the conditional KRAB-PAX3-HBD repressor was as potent as the repression observed with the constitutive KRAB-PAX3 repressor, implying that fusion of the ER HBD did not interfere with the expected function. Third, in Rh30 stable clones, the KRAB-PAX3-HBD and the SNAG-PAX3-HBD protein expression levels were higher than that of the endogenous PAX3-FKHR protein; hence, the repressors would be expected to have a competitive advantage for PAX3-FKHR target genes. Fourth, the conditional PAX3 repressor proteins exhibited hormone-dependent nuclear localization, which may account for the hormone-dependent biological effects in Rh30 cells. Fifth, the KRAB-PAX3-HBD and SNAG-PAX3-HBD proteins exhibited potent repression of either transiently transfected or integrated reporter genes in Rh30 ARMS cells. The conditional repressors were as effective in repression of integrated reporter plasmids as transiently transfected reporter plasmid. Furthermore, the repression of endogenous genes by the conditional repressors was confirmed by the DD-PCR analysis. In all cases, the conditional repression was dominant over any activation mediated by the endogenous PAX3-FKHR. In addition, there was a striking correlation between the expression levels of the PAX3 repressors and the degree of transcriptional repression. Sixth, the conditional PAX3 repressors exhibited hormone-dependent suppression of characteristic malignant properties such as: (a) growth in low serum; (b) anchorage-independent growth; and (c) tumorigenicity in SCID mice. Furthermore, both the KRAB-based as well as the SNAG-based conditional PAX3 repressors exhibited similar inhibitory properties, demonstrating that the growth inhibition did not depend on a particular type of repression mechanism. Finally, the temporal control afforded by the conditional PAX3 repressor allowed observation of immediate changes in growth under low-serum conditions that led us to demonstrate that the KRAB-PAX3-HBD protein induces apoptosis.
The hormone-dependent apoptosis exhibited in the conditional PAX3 repressor Rh30 cell lines under low-serum conditions is entirely consistent with previous studies in which an antisense approach was used to down-regulate PAX3-FKHR in Rh30 ARMS cells (10) . Furthermore, it has been clearly demonstrated that down-regulation of PAX3 function, either by mutation in splotch mice (14) , or by reduced expression in diabetic mice (36) , leads to extensive apoptosis. It is well established that many of the PAX family proteins function during organogenesis to protect cells from apoptosis (9 , 11 , 14) . Previous studies have linked the antiapoptotic function of PAX8 to activation of the BCL family protein, BCL-2 (8) . Our studies have demonstrated that the KRAB-PAX3-HBD protein can down-regulate expression of the BCL-XL cellular survival factor and induce apoptosis in Rh30 cell lines in vitro and in SCID mice in vivo. These observations suggest that PAX3-FKHR may contribute to oncogenesis in ARMS by activating the antiapoptotic BCL-XL survival factor. One advantage of the ER system for studying transcription factors like KRAB-PAX3-HBD is that activation of the ER-fusion protein can occur in the absence of de novo protein synthesis. Thus, in the presence of protein synthesis inhibitors such as cycloheximide, a distinction can be made between directly regulated target genes and those secondary targets whose regulation depends on transcription and translation of a primary target gene. Our data supports the hypothesis that BCL-XL is a direct PAX3 target gene, because the repression by KRAB-PAX3-HBD was largely insensitive to inhibition by cycloheximide. Recent studies have confirmed that PAX3 and PAX3-FKHR can directly regulate the BCL-XL via direct binding to the promoter (37) .
It is likely that regulation of apoptosis by PAX3 may involve several other mechanisms in addition to BCL-XL. Recent expression profiling has shown that PAX3-FKHR can activate expression of the SLUG protein (34) . Other studies have shown that SLUG plays an antiapoptotic role in E2A-HLF-induced tumorigenesis (38) . In addition, PAX3 is known to regulate c-MET, the receptor for the hepatocyte growth factor/scatter factor, which has also been implicated in apoptosis (39 , 40) . It is interesting that apoptosis was only observed when the KRAB-PAX3-HBD protein was activated under low-serum conditions, implying that the Rh30 cells may only depend on PAX3-FKHR for protection against apoptosis when deprived of certain factors present in serum. Substantial evidence supports a role for growth factor signaling in ARMS. PAX3-FKHR has been shown to activate expression of insulin-like growth factor II, which has a well-established role in ARMS malignant growth (34 , 41) . Other studies have defined a role for the wild-type FKHR protein in linking insulin signaling to a cellular proapoptotic response (41 , 42) . It is not known whether PAX3-FKHR exerts any dominant-negative effect on the wild-type FKHR protein derived from the nontranslocated allele in ARMS. Protection from apoptosis by PAX3-FKHR is likely to be a key oncogenic mechanism in ARMS that will require further identification and validation of the essential target genes.
Our demonstration that KRAB-PAX3-HBD Rh30 cell tumors show pronounced hormone-dependent inhibition of growth confirms our previous findings and emphasizes that in ARMS the tumorigenic potential is dependent on PAX3-FKHR. In SCID mice experiments, use of the timed-release pellets allowed maintenance of the blood levels of 4-OHT and activation of the conditional repressor throughout the course of the experiment. The tumors that grew from control cells without the repressor or from Rh30-KPHBD-cl22 cells without the 4-OHT inducer were heavily vascularized. It is interesting that only the Rh30-KPHBD-cl22 tumors derived from the 4-OHT-treated mice showed very little evidence of vascularization in the H&E-stained tumor sections. We are currently investigating whether the KRAB-PAX3-HBD protein may have repressed angiogenic factors.
We believe that our conditional PAX3 repressor strategies have targeted a major oncogenic mechanism in ARMS, protection from apoptosis by PAX3-FKHR. Characterization of repressed target genes that comprise the PAX3-FKHR "oncogenic transcriptome" in ARMS identified by differential display RT-PCR analysis is our current focus.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 K. A. was supported by the American Cancer
Society NP-954 Research Training Grant. W. J. F. was supported
by Wistar Basic Cancer Research Training Grant CA09171. F. J. R. is
supported in part by NIH Grants CA52009, Core Grant CA10815, DK49210,
GM54220, DAMD17-96-1-6141, ACS NP-954, the Irving A. Hansen Memorial
Foundation, the Mary A. Rumsey Memorial Foundation, and the Pew
Scholars Program in the Biomedical Sciences. ![]()
2 To whom requests for reprints should be
addressed, at The Wistar Institute, 3601 Spruce Street, Philadelphia,
PA 19104. Phone: (215) 898-0995; Fax: (215) 898-3929; E-mail: rauscher{at}wista.wistar.upenn.edu ![]()
3 The abbreviations used are: ARMS, alveolar
rhabdomyosarcoma; 4-OHT, 4hydroxytamoxifen; EMSA, electrophoretic
mobility shift assay; RT-PCR, reverse transcription-PCR; DD-PCR,
differential display RT-PCR; TUNEL, terminal deoxynucleotidyl
transferase-mediated nick end labeling; HBD, hormone-binding domain;
FBS, fetal bovine serum; MTT,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. ![]()
Received 5/ 5/00. Accepted 8/17/00.
| REFERENCES |
|---|
|
|
|---|
in rib patterning. Anat. Rec., 255: 353-361, 1999.[Medline]
receptor. Mol. Cell. Biol., 18: 4118-4130, 1998.This article has been cited by other articles:
![]() |
R. Amstutz, M. Wachtel, H. Troxler, P. Kleinert, M. Ebauer, T. Haneke, C. Oehler-Janne, D. Fabbro, F. K. Niggli, and B. W. Schafer Phosphorylation Regulates Transcriptional Activity of PAX3/FKHR and Reveals Novel Therapeutic Possibilities Cancer Res., May 15, 2008; 68(10): 3767 - 3776. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ayyanathan, H. Peng, Z. Hou, W. J. Fredericks, R. K. Goyal, E. M. Langer, G. D. Longmore, and F. J. Rauscher III The Ajuba LIM Domain Protein Is a Corepressor for SNAG Domain Mediated Repression and Participates in Nucleocytoplasmic Shuttling Cancer Res., October 1, 2007; 67(19): 9097 - 9106. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. McKinnon, M. A. Ravier, and G. A. Rutter FoxO1 Is Required for the Regulation of Preproglucagon Gene Expression by Insulin in Pancreatic {alpha}TC1-9 Cells J. Biol. Chem., December 22, 2006; 281(51): 39358 - 39369. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Bulliard, M. Wiznerowicz, I. Barde, and D. Trono KRAB Can Repress Lentivirus Proviral Transcription Independently of Integration Site J. Biol. Chem., November 24, 2006; 281(47): 35742 - 35746. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Sripathy, J. Stevens, and D. C. Schultz The KAP1 Corepressor Functions To Coordinate the Assembly of De Novo HP1-Demarcated Microenvironments of Heterochromatin Required for KRAB Zinc Finger Protein-Mediated Transcriptional Repression Mol. Cell. Biol., November 15, 2006; 26(22): 8623 - 8638. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nabarro, N. Himoudi, A. Papanastasiou, K. Gilmour, S. Gibson, N. Sebire, A. Thrasher, M. P. Blundell, M. Hubank, G. Canderan, et al. Coordinated oncogenic transformation and inhibition of host immune responses by the PAX3-FKHR fusion oncoprotein J. Exp. Med., November 21, 2005; 202(10): 1399 - 1410. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ayyanathan, M. S. Lechner, P. Bell, G. G. Maul, D. C. Schultz, Y. Yamada, K. Tanaka, K. Torigoe, and F. J. Rauscher III Regulated recruitment of HP1 to a euchromatic gene induces mitotically heritable, epigenetic gene silencing: a mammalian cell culture model of gene variegation Genes & Dev., August 1, 2003; 17(15): 1855 - 1869. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Demirpence, A. Semlali, J. Oliva, P. Balaguer, E. Badia, M.-J. Duchesne, J.-C. Nicolas, and M. Pons An Estrogen-responsive Element-targeted Histone Deacetylase Enzyme Has an Antiestrogen Activity That Differs from That of Hydroxytamoxifen Cancer Res., November 15, 2002; 62(22): 6519 - 6528. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Schultz, K. Ayyanathan, D. Negorev, G. G. Maul, and F. J. Rauscher III SETDB1: a novel KAP-1-associated histone H3, lysine 9-specific methyltransferase that contributes to HP1-mediated silencing of euchromatic genes by KRAB zinc-finger proteins Genes & Dev., April 15, 2002; 16(8): 919 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Anderson, A. Ramsay, S. Gould, and K. Pritchard-Jones PAX3-FKHR Induces Morphological Change and Enhances Cellular Proliferation and Invasion in Rhabdomyosarcoma Am. J. Pathol., September 1, 2001; 159(3): 1089 - 1096. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |