
[Cancer Research 60, 6061-6067, November 1, 2000]
© 2000 American Association for Cancer Research
Experimental Therapeutics |
Tumor Cell-selective Cytotoxicity of Matrix Metalloproteinase-activated Anthrax Toxin
Shihui Liu,
Sarah Netzel-Arnett,
Henning Birkedal-Hansen and
Stephen H. Leppla1
Oral Infection and Immunity Branch [S. L., S. H. L.] and Matrix Metalloproteinase Unit [S. N-A., H. B-H.], National Institute of Dental and Craniofacial Research, NIH, Bethesda, Maryland 20892
 |
ABSTRACT
|
|---|
Matrix metalloproteinases (MMPs) are overexpressed in a variety of tumor
tissues and cell lines, and their expression is highly correlated to
tumor invasion and metastasis. To exploit these characteristics in the
design of tumor cell-selective cytotoxins, we constructed two mutated
anthrax toxin protective antigen (PA) proteins in which the furin
protease cleavage site is replaced by sequences selectively cleaved by
MMPs. These MMP-targeted PA proteins were activated rapidly and
selectively on the surface of MMP-overexpressing tumor cells. The
activated PA proteins caused internalization of a recombinant
cytotoxin, FP59, consisting of anthrax toxin lethal factor residues
1254 fused to the ADP-ribosylation domain of
Pseudomonas exotoxin A. The toxicity of the mutated PA
proteins for MMP-overexpressing cells was blocked by hydroxamate
inhibitors of MMPs, including BB94, and by a tissue inhibitor of matrix
metalloproteinases (TIMP-2). The mutated PA proteins killed
MMP-overexpressing tumor cells while sparing nontumorigenic normal
cells when these were grown together in a coculture model, indicating
that PA activation occurred on the tumor cell surface and not in the
supernatant. This method of achieving cell-type specificity is
conceptually distinct from, and potentially synergistic with, the more
common strategy of retargeting a protein toxin by fusion to a growth
factor, cytokine, or antibody.
 |
INTRODUCTION
|
|---|
Tumor cell-selective cytotoxins have been created by replacing the
receptor-recognition domains of bacterial and plant protein toxins with
cytokines, growth factors, and antibodies (1)
. The protein
toxins used contain an enzymatic domain that acts in the cytosol to
inhibit protein synthesis and a domain that achieves translocation of
this catalyst from a vesicular compartment to the cytosol, as well as
the cell-targeting domain that is replaced or altered so as to achieve
tumor cell specificity. Certain of these "immunotoxins" derived
from diphtheria toxin, Pseudomonas exotoxin A, and ricin
have shown efficacy and have been approved for clinical use. However, a
recurrent problem with these materials is that therapeutic doses
typically damage other tissues and cells (2)
. This is not
surprising because very few of the tumor cell surface receptors or
antigens that are targeted are totally absent from normal tissue.
Therefore, even in the best cases, some toxin uptake will occur in
normal bystander cells. Because these toxins act catalytically, even a
small amount of internalized toxin can seriously damage normal tissue.
Even a single molecule delivered to the cytosol can kill a cell
(3)
.
Several strategies have been used to improve the therapeutic indices of
immunotoxins. However, attempts have rarely been made to exploit
characteristics unique to the particular toxins. Many protein toxins
require proteolytic cleavage to separate the catalytic domain from the
receptor-binding and translocation domains (4)
. Anthrax
toxin is unique in that proteolytic cleavage must occur on the cell
surface to achieve binding and internalization of a catalytic
polypeptide. Anthrax toxin is a three-part toxin secreted by
Bacillus anthracis consisting of
PA2
(Mr 83,000), LF
(Mr 90,000), and EF
(Mr 89,000; Refs. 5, 6, 7
).
These three proteins are individually nontoxic. PA binds to an
unidentified receptor (8)
and is cleaved at the sequence
RKKR167 by cell-surface furin or furin-like
proteases (9
, 10)
. The COOH-terminal
Mr 63,000 fragment (PA63) remains
bound to receptor, associates to form a heptamer, and binds LF and EF
(6
, 11, 12, 13)
. The resulting oligomeric complex is
internalized by endocytosis (14)
, produces a channel in
the endosomal membrane, and translocates LF and EF to the cytosol. LF
and EF induce cytotoxic events in the cytosol through their respective
enzymatic actions. The combination of PA + LF, named anthrax
lethal toxin, lyses mouse macrophages (15
, 16)
, and kills
animals (17
, 18)
. These effects result from the
proteolytic action of LF on mitogen-activated protein kinase kinases
and possibly other cytosolic proteins (19
, 20)
. The
combination of PA+ EF, named edema toxin, damages cells because of the
intracellular adenylate cyclase activity of EF (21)
.
LF and EF have substantial sequence homology at aa 1250
(7)
. This region constitutes the PA-binding domain
(22)
. LF aa 1254 (LFn) are sufficient to achieve
translocation of "passenger" polypeptides to the cytosol of cells
in a PA-dependent process (23
, 24)
. Thus, an LFn fusion to
the ADP-ribosylation domain of Pseudomonas exotoxin A, named
FP59, kills any cell type possessing PA receptors (24
, 25)
. FP59 may be used as a potent cytotoxic agent when delivered
to the target cells with a target-specific PA.
The unique requirement that PA be activated on the target cell surface
provides an opportunity to re-engineer this protein to make its
activation dependent on eukaryotic cell surface proteases. In
particular, it should be possible to exploit the fact that many tumor
cells overexpress certain cell surface-associated proteases. MMPs
constitute a family of zinc-dependent, multidomain, neutral
endopeptidases that play a leading role in both the normal tissue
remodeling and pathological destruction of the extracellular matrix
(26)
. Family members include secreted and membrane bound
collagenases, stromelysins, gelatinases, and membrane-type
metalloproteinases (26)
. MMPs are overexpressed in a
variety of tumor tissues and tumor cell lines and are highly correlated
to tumor invasion and metastasis (27)
. Of the MMPs, MMP-2
(gelatinase A), MMP-9 (gelatinase B), and membrane-type 1 MMP (MT1-MMP)
are reported to be most related to invasion and metastasis in various
human cancers (27
, 28)
. Current models view MMPs as acting
during tumor invasion and metastasis by breaking down tissue
extracellular matrix and dissolving epithelial and endothelial basement
membranes, thereby enabling tumor cells to invade through stroma and
blood vessels. Certain MMPs may also participate in tumor
neoangiogenesis because they are selectively up-regulated in
proliferating endothelial cells in tumor tissues (29)
.
Furthermore, a group of incompletely characterized MMPs can contribute
to the sustained growth of established tumor foci by the ectodomain
cleavage of membrane-bound pro-forms of growth factors, releasing
peptides that are mitogens for tumor cells and/or tumor vascular
endothelial cells (30
, 31) .
The catalytic activities of MMPs are highly regulated. The MMPs are
expressed as zymogens, which are activated by proteolysis of an
NH2-terminal propeptide that blocks the active
site cleft (32
, 33)
. Additionally, a family of proteins,
the TIMPs, function as highly effective MMP inhibitors
(Ki
10-10
M; Ref. 34
). Through these control
mechanisms, the activities of MMPs appear to be restricted to the
surface of tumor cells, where they may play a key role in the
degradative events associated with invasion and metastasis.
Recognition of the role of MMPs in tumor development and metastasis has
encouraged the development of synthetic inhibitors of MMPs as potential
therapeutic agents (35
, 36)
. Some of these agents are
already used in cancer treatment (36)
. The efficacy of
these MMP-directed agents argues that other strategies targeting MMPs
may provide selective antitumor agents. In the work described here, we
constructed two mutated anthrax PA proteins, PA-L1 and PA-L2, in which
the furin recognition site is replaced by sequences susceptible to
cleavage by MMP-2 and MMP-9. When combined with FP59, these PA proteins
showed selective killing of MMP-overexpressing human tumor cell lines
including fibrosarcoma HT1080 cells, breast cancer MDA-MB-231 cells,
and melanoma A2058 cells.
 |
MATERIALS AND METHODS
|
|---|
Reagents.
Enzymes for DNA manipulation and modification were purchased from New
England Biolabs (Beverly, MA). FP59 and a soluble form of furin were
prepared in our laboratory as described (37)
. Activated
MMP-2 and TIMP-2 were gifts from Dr. William Stetler-Stevenson
(NIH, Bethesda, MD) and active MMP-9 was purchased from Calbiochem (San
Diego, CA). MMP inhibitors BB94 (Batimastat) and BB2516 (Marimastat)
were gifts from British Biotechnology Ltd. (Oxford, United
Kingdom), and GM6001 was a gift from Dr. Richard E. Galardy
(Glycomed, Inc., Alameda, CA) (38)
. Rabbit anti-PA
polyclonal antibody (#5308) was made in our laboratory. Rabbit
anti-MT-MMP1 (AB815) was purchased from Chemicon International, Inc.
(Temecula, CA).
Construction of PA MMP Substrate Proteins.
A modified overlap PCR method was used to construct the mutated PA
proteins PA-L1 and PA-L2 in which the furin site is replaced by the
gelatinase substrate sequences GPLGMLSQ and GPLGLWAQ, respectively. The
PA expression plasmid pYS5 (39)
was used as template. We
used 5' primer F, AAAGGAGAACGTATATGA
(Shine-Dalgarno and start codons are underlined), and the
phosphorylated primer R1, pTGAGTTCGAAGATTTTTGTTTTAATTCTGG, annealing to
the sequence corresponding to
P154-S163, to amplify a
fragment designated "N." We used the mutagenic phosphorylated
primer H1,
pGGACCATTAGGAATGTGGAGTCAAAGTACAAGTGCTGGACCTACGGTTCCAG,
encoding the gelatinase substrate GPLGMLSQ and
S168-P176, and reverse
primer R2, ACGTTTATCTCTTATTAAAAT, annealing to the sequence encoding
I589-R595, to amplify a
mutagenic fragment "M1." We used a phosphorylated mutagenic primer
H2, pGGACCATTAGGATTATGGGCACAAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding
gelatinase substrate GPLGLWAQ and
S168-P176, and reverse
primer R2, to amplify a mutagenic fragment "M2." Primers F and R2
were used to amplify the ligated products of N + M1, and
N + M2, respectively, resulting in the mutagenized fragments
L1 and L2, in which the coding sequence for the furin site
(RKKR167) is replaced by gelatinase substrate
sequences GPLGMLSQ and GPLGLWAQ, respectively. The
HindIII/PstI digests of L1 and L2 were cloned
between the HindIII and PstI sites of pYS5. The
resulting expression plasmids were named pYS-PA-L1 and pYS-PA-L2, and
their expression products, the PA mutated proteins, were accordingly
named PA-L1 and PA-L2.
Expression and Purification of PA, PA-L1, and PA-L2.
To express PA, PA-L1, and PA-L2, the expression plasmids pYS5,
pYS-PA-L1, and pYS-PA-L2 were transformed into nonvirulent strain
B. anthracis UM23C11 and grown in FA medium
(39)
with 20 µg/ml of kanamycin for 16 h at 37°C.
PA proteins were purified by ammonium sulfate precipitation, followed
by chromatography on a MonoQ column (Amersham Pharmacia Biotech,
Piscataway, NJ), as described previously (40)
.
In Vitro Cleavage of PA, PA-L1, and PA-L2 by
MMP-2, MMP-9, and Furin.
Reaction mixtures of 50 µl containing 5 µg of the PA proteins were
incubated at 37°C with 5 µl of soluble furin or 0.2 µg of active
MMP. Furin cleavage was done in 25 mM HEPES (pH 7.4), 150
mM NaCl, 0.2 mM EDTA, 0.2 mM EGTA,
100 µg/ml ovalbumin, 1.0 mM CaCl2,
and 1.0 mM MgCl2. Cleavage with MMPs
was done in 50 mM HEPES (pH 7.5), 10 mM
CaCl2, 200 mM NaCl, 0.05% (v/v)
Brij-35, and 50 µM ZnSO4. Aliquots
(5 µl) withdrawn at intervals were separated by PAGE using 1020%
gradient Tris-glycine gel (Novex, San Diego, CA) and electroblotted to
a nitrocellulose membrane (Novex). Cleavage was assessed by Western
blotting with a rabbit anti-PA antibody. Membranes were blocked with
5% (w/v) nonfat milk, incubated sequentially with rabbit anti-PA
polyclonal antibody (#5308) and horseradish peroxidase-conjugated goat
antirabbit antibody (sc-2004; Santa Cruz Biotechnology, Inc., Santa
Cruz, CA), and developed with TMB Stabilized Substrate (Promega Corp.,
Madison, WI).
Cells and Culture Medium.
Vero cells, COS-7 cells, human fibrosarcoma HT1080 cells, human
melanoma A2058 cells, and human breast cancer MDA-MB-231 cells were
obtained from American Type Culture Collection (Manassas, Virginia).
All cells were grown in DMEM with 0.45% glucose, 10% FCS, 2
mM glutamine, and 50 µg/ml gentamicin. Cells were
maintained at 37°C in a 5% CO2 environment.
Preparation of Cell Extracts and Conditioned Media for Gelatin
Zymography.
Cells were grown to 80100% confluence in
75-cm2
flasks, washed twice with serum-free DMEM,
and lysed for 10 min on ice with 1 ml/flask of 0.5% (v/v) Triton X-100
in 0.1 M Tris-HCl (pH 8.0). Lysates collected by scraping
with a rubber policeman were centrifuged at 10,000 rpm for 10 min at
4°C, and the protein concentrations of the supernatants were
determined by the BCA procedure (Pierce, Rockford, IL) and adjusted to
1 mg/ml with lysis buffer. For collection of conditioned media, the
cells were incubated for 24 h with 4 ml/flask of serum-free DMEM.
The culture supernatants were harvested, and cellular debris was
removed by centrifugation at 10,000 rpm for 10 min at 4°C.
Gelatin Zymography.
To enrich and assay gelatinases, cell extracts (1 ml) and amounts of
conditioned media derived from the same number of cells were incubated
at 4°C for 1 h in an end-over-end mixer with 50 µl of
gelatin-Sepharose 4B (Amersham Pharmacia Biotech, Piscataway, NJ)
equilibrated with 50 mM Tris-HCl (pH 7.5), 150
mM NaCl, 5 mM CaCl2,
0.02% (v/v) Tween 20, and 10 mM EDTA. After four washes
with 1 ml of equilibration buffer containing 200 mM NaCl,
the beads were eluted with 30 µl of 4x nonreducing SDS sample
buffer. The supernatants were loaded onto 10% gelatin zymogram gels
(Novex). After electrophoresis, gels were developed using the buffers
and procedures specified by Novex.
Cytotoxicity Assay with MTT.
Cells were seeded into 96-well plates at
25% confluence. The next
day, cells were washed twice with serum-free DMEM to remove residual
serum. Serial dilutions of PA, PA-L1, or PA-L2 (01000 ng/ml) combined
with FP59 (50 ng/ml) in serum-free DMEM were added to the cells to give
a total volume of 200 µl/well. In some experiments, MMP inhibitors
were added 30 or 60 min prior to toxin addition. In some experiments,
cells was incubated with the toxins for 6 h, after which the
medium was replaced with fresh DMEM supplemented with 10% FCS. Other
cells were incubated in the serum-free DMEM for the full extent of the
toxin treatment, usually 48 h. Cell viability was then assayed by
adding 50 µl of 2.5 mg/ml MTT. The cells were incubated with MTT for
45 min at 37°C, the medium was removed, and the blue pigment produced
by viable cells was solubilized with 100 µl/well of 0.5% (w/v) SDS,
25 mM HCl, in 90% (v/v) isopropanol. The plates were
vortexed, and the oxidized MTT was measured as
A570 using a microplate reader.
Cytotoxicity Assay in a Coculture System.
A coculture model was designed to mimic the in vivo
condition to verify whether PA-L1 and PA-L2 kill MMP-overexpressing
tumor cells while not affecting MMP nonexpressing cells. Vero, HT1080,
A2058, and MDA-MB-231 cells were cultured in separate chambers of
eight-chamber slides (Nalge Nunc International, Naperville, IL) to
80100% confluence. The cells were washed twice with serum-free DMEM,
the chamber partition was removed, and the slide was put into a culture
dish with serum-free medium, so that all of the cells were bathed in
the same medium. PA, PA-L1, or PA-L2 (300 ng/ml) and FP59 (50 ng/ml)
were added individually or in combination and cells were exposed for
48 h. Then MTT (0.5 mg/ml) was added for 45 min at 37°C, the
partitions were remounted, and the oxidized MTT in each chamber was
dissolved to determine the viability of each cell type.
Binding and Processing of PA, PA-L1, and PA-L2 by Cultured Cells.
Cells were grown in 24-well plates to 80100% of confluence and
washed twice with serum-free DMEM to remove residual serum. Then the
cells were incubated with 1000 ng/ml of PA, PA-L1, or PA-L2 at 37°C
in serum-free DMEM for different lengths of time. When TIMP-2 was
tested, it was incubated with cells for 1 h before the PA proteins
were added. The cells were washed three times to remove unbound PA
proteins. Cells were lysed in 100 µl/well modified RIPA lysis buffer
[50 mM Tris-HCl (pH 7.4), 1% NP40, 0.25% sodium
deoxycholate, 150 mM NaCl, 1 mM EDTA, 1
mM phenylmethylsulfonyl fluoride, and 1 µg/ml each of
aprotinin, leupeptin, and pepstatin] on ice for 10 min. Equal amounts
of protein from cell lysates were separated by PAGE using 1020%
gradient Tris-glycine gels (Novex). Western blotting to detect PA and
its cleavage products was performed as described above.
Construction and Transfection of MT1-MMP cDNA into COS-7 Cells.
A cDNA encoding human MT1-MMP was a generous gift of Dr.
Motoharu Seiki (University of Tokyo, Tokyo, Japan). The MT1-MMP coding
sequence was isolated by digestion with TthIII, the ends
were filled in with Pfu, and the fragment was inserted into
the SmaI site of the mammalian expression vector pEGFPN1
(Clontech Laboratories, Palo Alto, CA). The protein expressed from this
plasmid contains MT1-MMP at the NH2 terminus of
EGFP (red shifted variant of green fluorescent protein). COS-7 cells
(2 x 105 per dish) were
transfected with the expression vector (2 µg) using 10 µg of
SuperFect (Qiagen, Valencia, CA). Cells were incubated for 3 h
with the DNA-SuperFect complex in the presence of serum and
antibiotic-containing medium, washed, and grown in fresh
serum-containing medium for 48 h. Thereafter, cells were grown in
medium containing 500 µg/ml G418 (Life Technologies, Rockville, MD).
Cells expressing the MT1-MMP-EGFP fusion protein, named COSgMT1, were
sorted from nonexpressing cells by flow cytometry with a FACStar Plus
(Becton Dickinson), using excitation at 488 nm. Expression of
MT1-MMP-EGFP was assessed by Western blotting using a specific
antiserum (AB815, Chemicon International, Temecula, CA).
 |
RESULTS
|
|---|
Generation of Mutated PA Proteins That Can Be Cleaved by MMPs.
The crystal structure of PA shows that the furin cleavage site,
RKKR167, is in a surface-exposed, flexible loop
composed of aa 162175 (41)
. Cleavage in this loop by
furin-like proteases is essential to toxicity. We constructed mutated
PA proteins in which the furin-sensitive sequence is replaced by the
MMP-sensitive sequences GPLGMLSQ and GPLGLWAQ, designated L1 and L2,
respectively (Fig. 1A)
. These two sequences were shown to be favored gelatinase
substrates by examining the rates of hydrolysis of >50 synthetic
oligopeptides (42
, 43)
. The octapeptide sequences selected
are excellent substrates for MMP-2 and MMP-9 but are also susceptible
to other MMP species (42
, 43)
, including MT1-MMP
(44)
. These two sequences were modeled after the MMP
cleavage site in the
1 chain of type I collagen and contain
substitutions that enhanced cleavage by MMP-2 and MMP-9 (L1) or by
multiple members of the MMP family (L2).

View larger version (74K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Production of mutated PA proteins that can be specifically
cleaved by gelatinases. A, schematic representation of
MMP substrate PA proteins. The furin cleavage site RKKR was replaced
with gelatinase substrate sequences GPLGMLSQ in PA-L1 and GPLGLWAQ in
PA-L2. Arrows, sites cleaved by furin and the
gelatinases. BD, Western blot analyses to show
cleavage of PA (B), PA-L1 (C), and PA-L2
(D) by MMP-2, MMP-9, and furin. Proteins were incubated
with MMP-2, MMP-9, and furin for the times indicated, and samples were
analyzed by Western blotting with rabbit polyclonal antibody against
PA.
|
|
Plasmids encoding the mutated proteins PA-L1 and PA-L2 were constructed
by a modified overlap PCR method, cloned into the Escherichia
coli-Bacillus shuttle vector pYS5, and efficiently expressed in
B. anthracis UM23C1-1. The expression products were secreted
into the culture supernatants at 2050 mg/l. The mutated PA proteins
were purified by ammonium sulfate precipitation, followed by MonoQ
chromatography. The purified, mutated PA proteins PA-L1 and PA-L2
comigrated with PA in SDS-PAGE but migrated faster than PA during
nondenaturing PAGE (data not shown), because the four positively
charged residues RKKR of the furin site were replaced by noncharged
amino acids.
To verify that the mutated proteins had the expected susceptibility to
proteases, they were subjected to cleavage with a soluble form of furin
and active forms of MMP-2 and MMP-9. As expected, PA was very sensitive
to furin but completely resistant to MMP-2 and MMP-9 (Fig. 1B)
. In contrast, PA-L1 and PA-L2 were completely resistant
to furin but were efficiently processed into the two expected
fragments, PA63 and PA20, by MMP-2 and MMP-9 (Fig. 1, C and D)
. Thus, the mutated PA proteins had the desired
susceptibilities to the gelatinases.
PA-L1 and PA-L2 Selectively Kill MMP-overexpressing Tumor Cells.
To test the hypothesis that PA-L1 and PA-L2 would preferentially kill
MMP-overexpressing cells, cytotoxicity assays were done with three
human tumor cell lines: fibrosarcoma HT1080, melanoma A2058, and breast
cancer MDA-MB-231. A nontumor monkey cell line, Vero, was used as
control. Gelatin zymography of cell lysates showed that HT1080
expressed both gelatinases, A2058 expressed MMP-2 but not MMP-9, and
MDA-MB-231 expressed MMP-9 but not MMP-2 (Fig. 2)
. Conditioned serum-free medium gave qualitatively similar results,
indicating that the gelatinases expressed by these three tumor cell
lines were associated with the cell surface and partially secreted into
the medium (Fig. 2)
. In contrast, Vero cells had very low expression of
gelatinases (Fig. 2)
.

View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Zymographic analysis of gelatinase production. Triton
X-100 cell extracts (left panel) and serum-free
conditioned medium (right panel) of Vero, HT1080, A2058,
and MDA-MB-231 cultures were analyzed. Cell extract protein (1 mg) or
volumes of conditioned media (34 ml) corresponding to 1 mg of cell
extract were analyzed by gelatin zymography as described in
"Materials and Methods." Parallel gels (not shown) containing
molecular weight markers identified the two bands as MMP-9 and MMP-2,
as indicated.
|
|
Cytotoxicity of PA and the mutated PA proteins to these cells was
measured in 96-well plates. PA, PA-L1, and PA-L2 combined with FP59
were incubated with cells for 6 or 48 h, and viability in both
cases was measured after 48 h. The EC50s
(concentrations needed to kill half of the cells) for PA and the
mutated PA proteins are summarized in Table 1
. The gelatinase-nonexpressing Vero cells were resistant to PA-L1 and
PA-L2 but sensitive to PA in a dose-dependent manner (Fig. 3A)
. However, PA-L1 and PA-L2 that were first nicked by MMP-2
in vitro efficiently killed Vero cells, even with the 6-h
toxin challenge (Fig. 3B)
. This demonstrates that the
resistance of Vero cells to PA-L1 and PA-L2 was attributable to the
inability of the cells to proteolytically activate the mutated PA
proteins. In contrast to Vero cells, the three gelatinase-expressing
tumor cells, HT1080, A2058, and MDA-MB-231, were quite susceptible to
PA as well as to PA-L1 and PA-L2 (Fig. 4)
. The selective cytotoxicity of PA-L1 and PA-L2 for the tumor cells was
retained when the experiments were repeated in medium containing FCS
(data not shown). This indicates that serum proteases do not activate
the PA proteins, nor do serum protease inhibitors block proteolytic
cleavage by the cell surface proteases. To simplify further analyses,
all subsequent experiments were performed in serum-free medium.
View this table:
[in this window]
[in a new window]
|
Table 1 Toxicities of wild-type and mutated PA proteins for cultured cells
Values in the table are EC50 in ng/ml, where EC50 is
the concentration of toxin required to kill half of the cells.
EC50s are interpolated from Figs. 3
, 4
, and 8
. Values are for
48-h toxin treatments, except that values in parentheses are for 6-h
toxin treatments. All incubations included 50 ng/ml FP59. Nicking of
PA-L1 and L-2 (last two lines) was by MMP-2.
|
|

View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Cytotoxicity of mutated PA proteins for Vero cells. Vero
cells grown in serum-free DMEM medium were treated with intact or
MMP-2-treated PA, PA-L1, and PA-L2, together with 50 ng/ml FP59. The
toxins were incubated with cells for 48 h or were removed after
6 h and replaced with fresh, serum-containing DMEM. MTT was added
to determine cell viability at 48 h. Nicked PA-L1 and PA-L2 were
prepared by cleavage of PA-L1 and PA-L2 by active MMP-2 at 37°C for
3 h. A, effect of PA proteins after 6 or 48 h
exposure. B, effect of intact and MMP-nicked toxins
after 6 h of exposure. The analyses were performed two additional
times with results similar to those presented. Bars,
SE.
|
|

View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Cytotoxicity of PA proteins for HT1080 cells
(A), A2058 cells (B), and MDA-MB-231
cells (C). Cells were cultured and treated with toxin
for 6 or 48 h as in Fig. 3
. The analyses were performed two
additional times with results similar to those presented.
Bars, SE.
|
|
Binding and processing of PA, PA-L1, and PA-L2 on the surface of cells
were also assessed. Vero and HT1080 cells were incubated with PA,
PA-L1, and PA-L2 for various times, and cell lysates were examined by
Western blotting to detect processing of the PA proteins to the active
PA63 species. PA, PA-L1, and PA-L2 could be detected in the Vero and
HT1080 cell lysates as soon as 10 min after incubation, showing rapid
binding to the cell surface (Fig. 5, A and B)
. PA was processed by both cell types.
In contrast, PA-L1 and PA-L2 were processed by the MMP-overexpressing
HT1080 cells but not by the Vero cells (Fig. 5, A and B)
. This result was consistent with the previous evidence
that PA-L1 and PA-L2 were processed only by MMPs (Fig. 1, B and C)
and selectively killed MMP-expressing tumor cells
(Figs. 3
and 4)
. Although HT1080 cells processed PA-L1 and PA-L2 along
with PA, the latter was cleaved somewhat more rapidly (Fig. 5B)
. To verify that the cleavage observed on the surface of
HT1080 cells was attributable to MMPs, we added the specific inhibitor,
TIMP-2 (Fig. 5C)
. The inhibitor had no effect on cleavage of
PA (by furin) but strongly decreased cleavage of both PA-L1 and PA-L2.
We also analyzed the processing of PA-L1 and PA-L2 in culture
supernatants of HT1080 cells, and could not detect the active PA63
species in overnight culture supernatants (data not shown).

View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Binding and processing of PA proteins on the surface of
Vero and HT1080 cells. Vero cells (A) and HT1080 cells
(B and C) were cultured in 24-well plates
to 80100% of confluence, washed, and incubated in serum-free medium.
In C, TIMP-2 was added at 5 µg/ml for 1 h prior
to toxin addition. The PA proteins were added to the cells at a final
concentration of 1000 ng/ml and incubated for the indicated times, and
lysates were prepared for Western blotting analysis with rabbit anti-PA
polyclonal antibody.
|
|
To further demonstrate that the cytotoxicity of the mutated PA proteins
for tumor cells was dependent on MMP activity, we characterized the
effects of several well-characterized MMP inhibitors, BB94
(Batimastat), BB2516 (Marimastat), and GM6001. All three MMP
inhibitors, and especially GM6001, conferred strong protection to
HT1080 cells against challenge with PA-L1 and PA-L2 plus FP59 but did
not protect the cells against PA plus FP59 (Fig. 6)
. In addition, the highly specific physiological MMP inhibitor, TIMP-2,
also protected cells. Thus, the killing the tumor cells by PA-L1 and
PA-L2 is highly dependent on the MMP activity expressed by the tumor
cells.

View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. MMP inhibitors protect HT1080 cells from MMP-targeted PA
proteins. HT1080 cells were cultured to 80% of confluence in a 96-well
plate and washed twice with serum-free DMEM. MMP inhibitors GM6001,
BB94, and BB2516 were added to the cells at a final concentration of 10
µM in serum-free DMEM. TIMP-2 was used at a final
concentration of 10 µg/ml. After 30 min preincubation with the MMP
inhibitors, 300 ng/ml of PA, PA-L1, or PA-L2 were added combined with
50 ng/ml FP59. After 6 h, the medium containing the toxins and MMP
inhibitors was removed, and fresh serum-containing medium was added,
and incubation continued to 48 h, at which time MTT was added to
determine cell viability. The analysis was performed one additional
time with results similar to those presented.
|
|
PA-L1 and PA-L2 Retain Selectivity for MMP-overexpressing Cells in
a Coculture Model.
We designed a coculture model to mimic in vivo conditions to
test whether PA-L1 and PA-L2 can selectively kill gelatinase-expressing
tumor cells but not bystander cells. Vero, HT1080, MDA-MB-231, and
A2058 cells were cultured in separate compartments of eight-chamber
slides. When the cells reached confluence, the chamber partitions were
removed, and the slides were put into culture dishes with serum-free
medium so that all cells on the slide were bathed in the same medium.
PA, PA-L1, or PA-L2 (each at 300 ng/ml) plus FP59 (50 ng/ml) or FP59
alone were added to the culture dishes and incubated for 48 h
before measuring viability. PA killed all cells, whereas PA-L1 and
PA-L2 killed only the HT1080, MDA-MB-231, and A2058 cells while not
affecting the gelatinase nonexpressing Vero cells (Fig. 7)
. This result shows that PA-L1 and PA-L2 are not activated in the
tissue culture medium by secreted proteases, nor do PA proteins
proteolytically activated on the surface of one cell dissociate and
rebind on other cells. Activated MMPs in the culture supernatant would
have led to killing of the Vero cells, because Fig. 3
shows that PA-L1
and PA-L2 cleaved in solution become cytotoxic.

View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 7. PA-L1 and PA-L2 selectively kill MMP-overexpressing tumor
cells in a coculture model. Vero, HT1080, A2058, and MDA-MB-231 cells
were cultured in the separate chambers of eight-chamber slides to
80100% confluence. Then the partitions were removed, and the slides
were placed in 100-mm culture dishes with serum-free medium, so that
the different cells were in the same culture environment. PA, PA-L1, or
PA-L2 (300 ng/ml) each combined with FP59 (50 ng/ml) were separately
added to the cells and incubated 48 h. MTT was added to determine
cell viability. The slides were photographed (inset),
the partitions were replaced, and the insoluble blue dye in each
chamber was dissolved and measured in a microplate reader (bar graph).
The analysis was performed one additional time, with results similar to
those presented.
|
|
MT1-MMP Plays a Role in Activation of PA-L1 and PA-L2.
Northern blot analyses have shown that the three tumor cells used in
these studies express MT1-MMP in addition to gelatinases (data not
shown), suggesting that MT1-MMP may contribute to cleavage of the
mutated PA proteins. To examine the potential role of MT1-MMP, we used
COS-7 cells, after showing by zymography that they express negligible
amounts of gelatinases (Fig. 8
A, inset). Consistent with the lack of gelatinases, COS-7
cells were resistant to PA-L1 and PA-L2 plus FP59 but susceptible to PA
plus FP59 (Fig. 8A)
. A plasmid expressing human MT1-MMP-EGFP
was transfected into COS-7 cells, yielding a stable transfectant,
COSgMT1, in which expression of MT1-MMP-EGFP was verified by Western
blotting (Fig. 8
B, inset). In contrast to COS-7 cells,
COSgMT1 were very sensitive to PA-L1 and PA-L2 (Fig. 8B)
,
indicating that MT1-MMP can cause activation of these mutated PA
proteins, either by directly cleaving the cell-bound PA proteins or in
an indirect way by activation of pro-MMP-2 or other MMP zymogens, which
in turn cleaved the PA proteins. In support of the former explanation,
preliminary experiments have shown that purified MT1-MMP can cleave the
mutated PA proteins (data not shown).

View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 8. Expression of MT1-MMP makes COS-7 cells sensitive to
MMP-targeted PA proteins. A, cytotoxicity of PA-L1 and
PA-L2 to COS-7 cells. COS-7 cells were cultured to 80100% of
confluence, washed, and incubated in serum-free DMEM medium. PA
proteins combined with 50 ng/ml FP59 were added to the cells and
incubated for 6 or 48 h. MTT was added to determine cell viability
at 48 h. Inset, zymographic analysis of cell
extracts and culture supernatants of COS-7 cells, compared with a
lysate of HT1080 as control. B, cytotoxicity of PA-L1
and PA-L2 to COSgMT1. COSgMT1 cells were treated as in
A. Inset, expression of MT1-MMP-EGFP from
COSgMT1 cells as measured by Western blotting using a rabbit
anti-MT1-MMP antibody (AB815; Chemicon International, Inc.). The
analyses were performed two additional times with results similar to
those presented.
|
|
 |
DISCUSSION
|
|---|
The close association between MMP overexpression and tumor
metastasis has been known for several decades. Recognition that MMPs
contribute to tumor development and metastasis has led to the
development of novel therapies using synthetic inhibitors of MMPs
(35
, 36) . However, it is expected that these inhibitors
will only slow the growth of tumors, without having a direct cytotoxic
action that could eradicate the malignant cells. The present study is
the first attempt to exploit the localization of MMPs to achieve
cell-type selective targeting of cytotoxic bacterial toxin fusion
proteins. In this study, we constructed two mutated anthrax toxin PA
proteins, PA-L1 and PA-L2, in which the furin recognition site is
replaced by sequences susceptible to cleavage by MMPs. When combined
with FP59, derived from Pseudomonas exotoxin A, these two
mutated PA proteins selectively killed MMP-overexpressing human tumor
cells. The potency of the mutated PA proteins for the tumor cells
closely approached that of native PA, consistent with the demonstration
that cleavage of PA-L1 and PA-L2 on cell surfaces was almost as rapid
as cleavage of native PA. This result is somewhat surprising, because
it might have been expected that steric constraints or localization to
differing membrane domains would limit contact between receptor-bound
PA and cell-surface MMPs molecules.
Cytotoxicity assays in a coculture model, where cells were equally
accessible to the toxins in the supernatant, showed that PA-L1 and
PA-L2 killed only the three MMP-overexpressing tumor cells and not
bystander Vero cells. This result demonstrated that activation of PA-L1
and PA-L2 occurs principally on cell surfaces. Thus, the cytotoxicity
of PA-L1 and PA-L2 is directed selectively to the MMP-overexpressing
tumor cells, suggesting that these cytotoxins may retain cell-type
specificity if used in vivo. These results encourage the
further testing of these materials in animal models.
Several factors may explain the cell-type selectivity obtained with the
mutated PA proteins in the coculture system described above. PA
proteins bind to cells rapidly and with high affinity (Kd,
1 nM). Therefore, even at low PA
concentrations, PA receptors will be highly occupied. As a result, any
PA that becomes activated in the supernatant or dissociates from a cell
after cleavage would be unable to locate a free receptor by which to
bind to cells and internalize FP59. The bystander normal cells would
have their receptors occupied by the uncleavable mutated PA proteins.
These nonproductively occupied receptors may be cleared from the cell
surface of the normal cells, further reducing the possibility that the
cell could be targeted by a PA protein that becomes activated in either
the surrounding milieu or on the surface of an MMP-expressing cell.
Another factor that may explain the selectivity observed in the
coculture model is that the enzymatic activities of MMPs appear to be
enhanced through their localization on cell membranes. This focuses
their activities on extracellular matrix substrates and renders them
more resistant to the proteinase inhibitors present in the
extracellular milieu. Recently, it has been shown that physiological
concentrations of plasmin can activate both MMP-2 and MMP-9 on the
surface of HT1080 cells by a mechanism independent of MMP or acid
proteinase activities (45)
. In contrast, in the soluble
phase, plasmin degrades both MMP-2 and MMP-9 (45)
. Thus,
plasmin may provide a mechanism for restricting gelatinase activities
to the cell surface.
The recently identified, membrane-anchored MMP family member, MT1-MMP,
also serves to localize MMP activity to the cell surface. It functions
both as an MMP activator and as a receptor for MMP-2 but has no effect
on MMP-9 (46)
. A MMP-2/TIMP-2 complex binds to MT1-MMP on
the cell surface and then is proteolytically activated by an adjacent
MT1-MMP. Recent work has shown that adhesion receptors, such as
vß3 integrin (47)
and the cell surface hyaluronan
receptor CD44 (48)
, may act to retain soluble active MMP-2
or MMP-9 on invasive tumor cell surfaces, where their proteolytic
activities are more likely to promote cell invasion. Because MMP
activities involved in tumor invasion and metastasis are localized
and/or modulated on cell surfaces, MMPs constitute specific markers for
tumor tissues and provide a means for targeting these cells.
It was originally thought that the only role of MMPs in cancer was to
break down tissue barriers to promote tumor invasion and metastasis. It
is now understood that MMPs also participate in tumor neoangiogenesis
and are selectively up-regulated in proliferating endothelial cells
(29)
. Therefore, the modified bacterial toxins described
here may have the additional therapeutic effect of targeting the
dividing vascular endothelial cells that are essential to
neoangiogenesis in tumor tissues. Therefore, the MMP-targeted toxins
may also kill tumor cells by starving the cells of necessary nutrients
and oxygen.
Previous efforts to develop anthrax toxin fusion proteins as
therapeutic agents have focused on modification of domain 4, the
receptor-binding domain of PA. Work is ongoing to create cell
type-specific cytotoxic agents by modifying or replacing domain 4 to
direct PA to alternate receptors (40
, 49)
. This work
follows the example of the development of immunotoxins from other
protein toxins, as cited earlier (1)
. We suggest that
combining two conceptually distinct targeting strategies in a single PA
protein will yield agents having higher therapeutic indices. A protein
that is both retargeted to a tumor cell surface protein and dependent
on MMPs for activation may achieve therapeutic effects while being free
of the side effects observed with many of the existing immunotoxins.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Guangqing Tang for helpful discussions and Dana Hsu for
assistance in protein purification.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 To whom requests for reprints should be
addressed, at Oral Infection and Immunity Branch, National Institute of
Dental and Craniofacial Research, NIH, 30 Convent Drive MSC 4350,
Building 30, Room 316, Bethesda, MD 20892-4350. Phone: (301) 594-2865;
Fax: (301) 402-0396; E-mail: Leppla{at}nih.gov 
2 The abbreviations used are: PA, protective
antigen; EF, edema factor; LF, lethal factor; aa, amino acid(s); FP59,
fusion protein of LF aa 1254 and Pseudomonas exotoxin
A domain III; MMP, matrix metalloproteinase; MTT,
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; PA20,
NH2-terminal Mr 20,000 fragment
of PA; PA63, COOH-terminal Mr 63,000
fragment of PA; TIMP, tissue inhibitor of matrix metalloproteinase. 
Received 2/18/00.
Accepted 8/23/00.
 |
REFERENCES
|
|---|
-
Kreitman R. J. Immunotoxins in cancer therapy. Curr. Opin. Immunol., 11: 570-578, 1999.[Medline]
-
Frankel A. E., Tagge E. P., Willingham M. C. Clinical trials of targeted toxins. Semin. Cancer Biol., 6: 307-317, 1995.[Medline]
-
Yamaizumi M., Mekada E., Uchida T., Okada Y. One molecule of diphtheria toxin fragment A introduced into a cell can kill the cell. Cell, 15: 245-250, 1978.[Medline]
-
Gordon V. M., Klimpel K. R., Arora N., Henderson M. A., Leppla S. H. Proteolytic activation of bacterial toxins by eukaryotic cells is performed by furin and by additional cellular proteases. Infect. Immun., 63: 82-87, 1995.[Abstract]
-
Smith H., Stanley J. L. Purification of the third factor of anthrax toxin. J. Gen. Microbiol., 29: 517-521, 1962.
-
Leppla S. H. The bifactorial Bacillus anthracis lethal and oedema toxins Alouf J. E. Freer J. H. eds. . Comprehensive Sourcebook of Bacterial Protein Toxins, : 243-263, Academic Press London 1999.
-
Leppla, S. H. Anthrax Toxins. In: J. Moss, B. Iglewski, M. Vaughan, and A. Tu (eds.), Bacterial Toxins and Virulence Factors in Disease. Handbook of Natural Toxins, Vol. 8, Ed. 1, pp. 543572. New York: Marcel Dekker, Inc., 1995.
-
Escuyer V., Collier R. J. Anthrax protective antigen interacts with a specific receptor on the surface of CHO-K1 cells. Infect. Immun., 59: 3381-3386, 1991.[Abstract/Free Full Text]
-
Klimpel K. R., Molloy S. S., Thomas G., Leppla S. H. Anthrax toxin protective antigen is activated by a cell-surface protease with the sequence specificity and catalytic properties of furin. Proc. Natl. Acad. Sci. USA, 89: 10277-10281, 1992.[Abstract/Free Full Text]
-
Molloy S. S., Bresnahan P. A., Leppla S. H., Klimpel K. R., Thomas G. Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-X-X-Arg and efficiently cleaves anthrax toxin protective antigen. J. Biol. Chem., 267: 16396-16402, 1992.[Abstract/Free Full Text]
-
Leppla S. H., Friedlander A. M., Cora E. Proteolytic activation of anthrax toxin bound to cellular receptors Ed. 1 Fehrenbach F. Alouf J. E. Falmagne P. Goebel W. Jeljaszewicz J. Jurgen D. Rappuoli R. eds. . Bacterial Protein Toxins, : 111-112, Gustav Fischer New York 1988.
-
Milne J. C., Furlong D., Hanna P. C., Wall J. S., Collier R. J. Anthrax protective antigen forms oligomers during intoxication of mammalian cells. J. Biol. Chem., 269: 20607-20612, 1994.[Abstract/Free Full Text]
-
Benson E. L., Huynh P. D., Finkelstein A., Collier R. J. Identification of residues lining the anthrax protective antigen channel. Biochemistry, 37: 3941-3948, 1998.[Medline]
-
Gordon V. M., Leppla S. H., Hewlett E. L. Inhibitors of receptor-mediated endocytosis block the entry of Bacillus anthracis adenylate cyclase toxin but not that of Bordetella pertussis adenylate cyclase toxin. Infect. Immun., 56: 1066-1069, 1988.[Abstract/Free Full Text]
-
Friedlander A. M. Macrophages are sensitive to anthrax lethal toxin through an acid-dependent process. J. Biol. Chem., 261: 7123-7126, 1986.[Abstract/Free Full Text]
-
Hanna P. C., Kochi S., Collier R. J. Biochemical and physiological changes induced by anthrax lethal toxin in J774 macrophage-like cells. Mol. Biol. Cell, 3: 1269-1277, 1992.[Abstract]
-
Beall F. A., Taylor M. J., Thorne C. B. Rapid lethal effect in rats of a third component found upon fractionating the toxin of Bacillus anthracis. J. Bacteriol., 83: 1274-1280, 1962.[Abstract/Free Full Text]
-
Ezzell J. W., Ivins B. E., Leppla S. H. Immunoelectrophoretic analysis, toxicity, and kinetics of in vitro production of the protective antigen and lethal factor components of Bacillus anthracis toxin. Infect. Immun., 45: 761-767, 1984.[Abstract/Free Full Text]
-
Duesbery N. S., Webb C. P., Leppla S. H., Gordon V. M., Klimpel K. R., Copeland T. D., Ahn N. G., Oskarsson M. K., Fukasawa K., Paull K. D., Van de Woude G. F. Proteolytic inactivation of MAP-kinase-kinase by anthrax lethal factor [see comments]. Science (Washington DC), 280: 734-737, 1998.[Abstract/Free Full Text]
-
Vitale G., Pellizzari R., Recchi C., Napolitani G., Mock M., Montecucco C. Anthrax lethal factor cleaves the N-terminus of MAPKKs and induces tyrosine/threonine phosphorylation of MAPKs in cultured macrophages. Biochem. Biophys. Res. Commun., 248: 706-711, 1998.[Medline]
-
Leppla S. H. Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations of eukaryotic cells. Proc. Natl. Acad. Sci. USA, 79: 3162-3166, 1982.[Abstract/Free Full Text]
-
Quinn C. P., Singh Y., Klimpel K. R., Leppla S. H. Functional mapping of anthrax toxin lethal factor by in-frame insertion mutagenesis. J. Biol. Chem., 266: 20124-20130, 1991.[Abstract/Free Full Text]
-
Arora N., Klimpel K. R., Singh Y., Leppla S. H. Fusions of anthrax toxin lethal factor to the ADP-ribosylation domain of Pseudomonas exotoxin A are potent cytotoxins which are translocated to the cytosol of mammalian cells. J. Biol. Chem., 267: 15542-15548, 1992.[Abstract/Free Full Text]
-
Arora N., Leppla S. H. Residues 1254 of anthrax toxin lethal factor are sufficient to cause cellular uptake of fused polypeptides. J. Biol. Chem., 268: 3334-3341, 1993.[Abstract/Free Full Text]
-
Milne J. C., Blanke S. R., Hanna P. C., Collier R. J. Protective antigen-binding domain of anthrax lethal factor mediates translocation of a heterologous protein fused to its amino- or carboxy-terminus. Mol. Microbiol., 15: 661-666, 1995.[Medline]
-
Birkedal-Hansen H. Proteolytic remodeling of extracellular matrix. Curr. Opin. Cell Biol., 7: 728-735, 1995.[Medline]
-
Stetler-Stevenson W. G., Aznavoorian S., Liotta L. A. Tumor cell interactions with the extracellular matrix during invasion and metastasis. Annu. Rev. Cell Biol., 9: 541-573, 1993.
-
Jones L., Ghaneh P., Humphreys M., Neoptolemos J. P. The matrix metalloproteinases and their inhibitors in the treatment of pancreatic cancer. Ann. NY Acad. Sci., 880: 288-307, 1999.[Medline]
-
Chambers A. F., Matrisian L. M. Changing views of the role of matrix metalloproteinases in metastasis. J. Natl. Cancer Inst., 89: 1260-1270, 1997.[Abstract/Free Full Text]
-
Arribas J., Coodly L., Vollmer P., Kishimoto T. K., Rose-John S., Massagué J. Diverse cell surface protein ectodomains are shed by a system sensitive to metalloprotease inhibitors. J. Biol. Chem., 271: 11376-11382, 1996.[Abstract/Free Full Text]
-
Merlos-Suarez A., Fernandez-Larrea J., Reddy P., Baselga J., Arribas J. Pro-tumor necrosis factor-
processing activity is tightly controlled by a component that does not affect notch processing. J. Biol. Chem., 273: 24955-24962, 1998.[Abstract/Free Full Text]
-
Springman E. B., Angleton E. L., Birkedal-Hansen H., Van Wart H. E. Multiple modes of activation of latent human fibroblast collagenase: evidence for the role of a Cys73 active-site zinc complex in latency and a "cysteine switch" mechanism for activation. Proc. Natl. Acad. Sci. USA, 87: 364-368, 1990.[Abstract/Free Full Text]
-
Murphy G., Stanton H., Cowell S., Butler G., Knauper V., Atkinson S., Gavrilovic J. Mechanisms for pro matrix metalloproteinase activation. Acta Pathol. Microbiol. Immunol. Scand., 107: 38-44, 1999.
-
Birkedal-Hansen H., Moore W. G., Bodden M. K., Windsor L. J., Birkedal-Hansen B., DeCarlo A., Engler J. A. Matrix metalloproteinases: a review. Crit Rev. Oral Biol. Med., 4: 197-250, 1993.[Abstract/Free Full Text]
-
Brown P. D. Matrix metalloproteinase inhibitors: a novel class of anticancer agents. Adv. Enzyme Regul., 35: 293-301, 1995.[Medline]
-
Drummond A. H., Beckett P., Brown P. D., Bone E. A., Davidson A. H., Galloway W. A., Gearing A. J., Huxley P., Laber D., McCourt M., Whittaker M., Wood L. M., Wright A. Preclinical and clinical studies of MMP inhibitors in cancer. Ann. NY Acad. Sci., 878: 228-235, 1999.[Medline]
-
Gordon V. M., Benz R., Fujii K., Leppla S. H., Tweten R. K. Clostridium septicum
-toxin is proteolytically activated by furin. Infect. Immun., 65: 4130-4134, 1997.[Abstract]
-
Grobelny D., Poncz L., Galardy R. E. Inhibition of human skin fibroblast collagenase, thermolysin, and Pseudomonas aeruginosa elastase by peptide hydroxamic acids. Biochemistry, 31: 7152-7154, 1992.[Medline]
-
Singh Y., Chaudhary V. K., Leppla S. H. A deleted variant of Bacillus anthracis protective antigen is non-toxic and blocks anthrax toxin action in vivo. J. Biol. Chem., 264: 19103-19107, 1989.[Abstract/Free Full Text]
-
Varughese M., Chi A., Teixeira A. V., Nicholls P. J., Keith J. M., Leppla S. H. Internalization of a Bacillus anthracis protective antigen-c-Myc fusion protein mediated by cell surface anti-c-Myc antibodies. Mol. Med., 4: 87-95, 1998.[Medline]
-
Petosa C., Collier R. J., Klimpel K. R., Leppla S. H., Liddington R. C. Crystal structure of the anthrax toxin protective antigen. Nature (Lond.), 385: 833-838, 1997.[Medline]
-
Netzel-Arnett S., Fields G. B., Birkedal-Hansen H., Van Wart H. E., Fields G. Sequence specificities of human fibroblast and neutrophil collagenases. J. Biol. Chem., 266: 6747-6755, 1991.[Abstract/Free Full Text]
-
Netzel-Arnett S., Sang Q. X., Moore W. G., Navre M., Birkedal-Hansen H., Van Wart H. E. Comparative sequence specificities of human 72- and 92-kDa gelatinases (type IV collagenases) and PUMP (matrilysin). Biochemistry, 32: 6427-6432, 1993.[Medline]
-
Will H., Atkinson S. J., Butler G. S., Smith B., Murphy G. The soluble catalytic domain of membrane type 1 matrix metalloproteinase cleaves the propeptide of progelatinase A and initiates autoproteolytic activation. Regulation by TIMP-2 and TIMP-3. J. Biol. Chem., 271: 17119-17123, 1996.[Abstract/Free Full Text]
-
Mazzieri R., Masiero L., Zanetta L., Monea S., Onisto M., Garbisa S., Mignatti P. Control of type IV collagenase activity by components of the urokinase- plasmin system: a regulatory mechanism with cell-bound reactants. EMBO J., 16: 2319-2332, 1997.[Medline]
-
Polette M., Birembaut P. Membrane-type metalloproteinases in tumor invasion. Int. J. Biochem. Cell Biol., 30: 1195-1202, 1998.[Medline]
-
Brooks P. C., Stromblad S., Sanders L. C., von Schalscha T. L., Aimes R. T., Stetler-Stevenson W. G., Quigley J. P., Cheresh D. A. Localization of matrix metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin
vß3. Cell, 85: 683-693, 1996.[Medline]
-
Yu Q., Stamenkovic I. Localization of matrix metalloproteinase 9 to the cell surface provides a mechanism for CD44-mediated tumor invasion. Genes Dev., 13: 35-48, 1999.[Abstract/Free Full Text]
-
Varughese M., Teixeira A. V., Liu S., Leppla S. H. Identification of a receptor-binding region within domain 4 of the protective antigen component of anthrax toxin. Infect. Immun., 67: 1860-1865, 1999.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
R. W. Alfano, S. H. Leppla, S. Liu, T. H. Bugge, C. J. Meininger, T. C. Lairmore, A. F. Mulne, S. H. Davis, N. S. Duesbery, and A. E. Frankel
Matrix Metalloproteinase-Activated Anthrax Lethal Toxin Inhibits Endothelial Invasion and Neovasculature Formation during In vitro Morphogenesis
Mol. Cancer Res.,
April 1, 2009;
7(4):
452 - 461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. W. Alfano, S. H. Leppla, S. Liu, T. H. Bugge, M. Herlyn, K. S. Smalley, J. L. Bromberg-White, N. S. Duesbery, and A. E. Frankel
Cytotoxicity of the matrix metalloproteinase-activated anthrax lethal toxin is dependent on gelatinase expression and B-RAF status in human melanoma cells
Mol. Cancer Ther.,
May 1, 2008;
7(5):
1218 - 1226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Liu, H. Wang, B. M. Currie, A. Molinolo, H. J. Leung, M. Moayeri, J. R. Basile, R. W. Alfano, J. S. Gutkind, A. E. Frankel, et al.
Matrix Metalloproteinase-activated Anthrax Lethal Toxin Demonstrates High Potency in Targeting Tumor Vasculature
J. Biol. Chem.,
January 4, 2008;
283(1):
529 - 540.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Moayeri, J. F. Wiggins, and S. H. Leppla
Anthrax Protective Antigen Cleavage and Clearance from the Blood of Mice and Rats
Infect. Immun.,
November 1, 2007;
75(11):
5175 - 5184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-H. Chen, S. Liu, L. A. Bankston, R. C. Liddington, and S. H. Leppla
Selection of Anthrax Toxin Protective Antigen Variants That Discriminate between the Cellular Receptors TEM8 and CMG2 and Achieve Targeting of Tumor Cells
J. Biol. Chem.,
March 30, 2007;
282(13):
9834 - 9845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Springfeld, V. von Messling, M. Frenzke, G. Ungerechts, C. J. Buchholz, and R. Cattaneo
Oncolytic efficacy and enhanced safety of measles virus activated by tumor-secreted matrix metalloproteinases.
Cancer Res.,
August 1, 2006;
66(15):
7694 - 7700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. V. Artym, Y. Zhang, F. Seillier-Moiseiwitsch, K. M. Yamada, and S. C. Mueller
Dynamic interactions of cortactin and membrane type 1 matrix metalloproteinase at invadopodia: defining the stages of invadopodia formation and function.
Cancer Res.,
March 15, 2006;
66(6):
3034 - 3043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Vessillier, G. Adams, and Y. Chernajovsky
Latent cytokines: development of novel cleavage sites and kinetic analysis of their differential sensitivity to MMP-1 and MMP-3
Protein Eng. Des. Sel.,
December 1, 2004;
17(12):
829 - 835.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Liu and S. H. Leppla
Cell Surface Tumor Endothelium Marker 8 Cytoplasmic Tail-independent Anthrax Toxin Binding, Proteolytic Processing, Oligomer Formation, and Internalization
J. Biol. Chem.,
February 7, 2003;
278(7):
5227 - 5234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Liu, H. Aaronson, D. J. Mitola, S. H. Leppla, and T. H. Bugge
Potent antitumor activity of a urokinase-activated engineered anthrax toxin
PNAS,
January 21, 2003;
100(2):
657 - 662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Frankel
Increased Sophistication of Immunotoxins
Clin. Cancer Res.,
April 1, 2002;
8(4):
942 - 944.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Liu, T. H. Bugge, and S. H. Leppla
Targeting of Tumor Cells by Cell Surface Urokinase Plasminogen Activator-dependent Anthrax Toxin
J. Biol. Chem.,
May 18, 2001;
276(21):
17976 - 17984.
[Abstract]
[Full Text]
[PDF]
|
 |
|