| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Oral Infection and Immunity Branch [S. L., S. H. L.] and Matrix Metalloproteinase Unit [S. N-A., H. B-H.], National Institute of Dental and Craniofacial Research, NIH, Bethesda, Maryland 20892
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Several strategies have been used to improve the therapeutic indices of immunotoxins. However, attempts have rarely been made to exploit characteristics unique to the particular toxins. Many protein toxins require proteolytic cleavage to separate the catalytic domain from the receptor-binding and translocation domains (4) . Anthrax toxin is unique in that proteolytic cleavage must occur on the cell surface to achieve binding and internalization of a catalytic polypeptide. Anthrax toxin is a three-part toxin secreted by Bacillus anthracis consisting of PA2 (Mr 83,000), LF (Mr 90,000), and EF (Mr 89,000; Refs. 5, 6, 7 ). These three proteins are individually nontoxic. PA binds to an unidentified receptor (8) and is cleaved at the sequence RKKR167 by cell-surface furin or furin-like proteases (9 , 10) . The COOH-terminal Mr 63,000 fragment (PA63) remains bound to receptor, associates to form a heptamer, and binds LF and EF (6 , 11, 12, 13) . The resulting oligomeric complex is internalized by endocytosis (14) , produces a channel in the endosomal membrane, and translocates LF and EF to the cytosol. LF and EF induce cytotoxic events in the cytosol through their respective enzymatic actions. The combination of PA + LF, named anthrax lethal toxin, lyses mouse macrophages (15 , 16) , and kills animals (17 , 18) . These effects result from the proteolytic action of LF on mitogen-activated protein kinase kinases and possibly other cytosolic proteins (19 , 20) . The combination of PA+ EF, named edema toxin, damages cells because of the intracellular adenylate cyclase activity of EF (21) .
LF and EF have substantial sequence homology at aa 1–250 (7) . This region constitutes the PA-binding domain (22) . LF aa 1–254 (LFn) are sufficient to achieve translocation of "passenger" polypeptides to the cytosol of cells in a PA-dependent process (23 , 24) . Thus, an LFn fusion to the ADP-ribosylation domain of Pseudomonas exotoxin A, named FP59, kills any cell type possessing PA receptors (24 , 25) . FP59 may be used as a potent cytotoxic agent when delivered to the target cells with a target-specific PA.
The unique requirement that PA be activated on the target cell surface provides an opportunity to re-engineer this protein to make its activation dependent on eukaryotic cell surface proteases. In particular, it should be possible to exploit the fact that many tumor cells overexpress certain cell surface-associated proteases. MMPs constitute a family of zinc-dependent, multidomain, neutral endopeptidases that play a leading role in both the normal tissue remodeling and pathological destruction of the extracellular matrix (26) . Family members include secreted and membrane bound collagenases, stromelysins, gelatinases, and membrane-type metalloproteinases (26) . MMPs are overexpressed in a variety of tumor tissues and tumor cell lines and are highly correlated to tumor invasion and metastasis (27) . Of the MMPs, MMP-2 (gelatinase A), MMP-9 (gelatinase B), and membrane-type 1 MMP (MT1-MMP) are reported to be most related to invasion and metastasis in various human cancers (27 , 28) . Current models view MMPs as acting during tumor invasion and metastasis by breaking down tissue extracellular matrix and dissolving epithelial and endothelial basement membranes, thereby enabling tumor cells to invade through stroma and blood vessels. Certain MMPs may also participate in tumor neoangiogenesis because they are selectively up-regulated in proliferating endothelial cells in tumor tissues (29) . Furthermore, a group of incompletely characterized MMPs can contribute to the sustained growth of established tumor foci by the ectodomain cleavage of membrane-bound pro-forms of growth factors, releasing peptides that are mitogens for tumor cells and/or tumor vascular endothelial cells (30 , 31) .
The catalytic activities of MMPs are highly regulated. The MMPs are
expressed as zymogens, which are activated by proteolysis of an
NH2-terminal propeptide that blocks the active
site cleft (32
, 33)
. Additionally, a family of proteins,
the TIMPs, function as highly effective MMP inhibitors
(Ki 
10-10
M; Ref. 34
). Through these control
mechanisms, the activities of MMPs appear to be restricted to the
surface of tumor cells, where they may play a key role in the
degradative events associated with invasion and metastasis.
Recognition of the role of MMPs in tumor development and metastasis has encouraged the development of synthetic inhibitors of MMPs as potential therapeutic agents (35 , 36) . Some of these agents are already used in cancer treatment (36) . The efficacy of these MMP-directed agents argues that other strategies targeting MMPs may provide selective antitumor agents. In the work described here, we constructed two mutated anthrax PA proteins, PA-L1 and PA-L2, in which the furin recognition site is replaced by sequences susceptible to cleavage by MMP-2 and MMP-9. When combined with FP59, these PA proteins showed selective killing of MMP-overexpressing human tumor cell lines including fibrosarcoma HT1080 cells, breast cancer MDA-MB-231 cells, and melanoma A2058 cells.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Construction of PA MMP Substrate Proteins.
A modified overlap PCR method was used to construct the mutated PA
proteins PA-L1 and PA-L2 in which the furin site is replaced by the
gelatinase substrate sequences GPLGMLSQ and GPLGLWAQ, respectively. The
PA expression plasmid pYS5 (39)
was used as template. We
used 5' primer F, AAAGGAGAACGTATATGA
(Shine-Dalgarno and start codons are underlined), and the
phosphorylated primer R1, pTGAGTTCGAAGATTTTTGTTTTAATTCTGG, annealing to
the sequence corresponding to
P154-S163, to amplify a
fragment designated "N." We used the mutagenic phosphorylated
primer H1,
pGGACCATTAGGAATGTGGAGTCAAAGTACAAGTGCTGGACCTACGGTTCCAG,
encoding the gelatinase substrate GPLGMLSQ and
S168-P176, and reverse
primer R2, ACGTTTATCTCTTATTAAAAT, annealing to the sequence encoding
I589-R595, to amplify a
mutagenic fragment "M1." We used a phosphorylated mutagenic primer
H2, pGGACCATTAGGATTATGGGCACAAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding
gelatinase substrate GPLGLWAQ and
S168-P176, and reverse
primer R2, to amplify a mutagenic fragment "M2." Primers F and R2
were used to amplify the ligated products of N + M1, and
N + M2, respectively, resulting in the mutagenized fragments
L1 and L2, in which the coding sequence for the furin site
(RKKR167) is replaced by gelatinase substrate
sequences GPLGMLSQ and GPLGLWAQ, respectively. The
HindIII/PstI digests of L1 and L2 were cloned
between the HindIII and PstI sites of pYS5. The
resulting expression plasmids were named pYS-PA-L1 and pYS-PA-L2, and
their expression products, the PA mutated proteins, were accordingly
named PA-L1 and PA-L2.
Expression and Purification of PA, PA-L1, and PA-L2.
To express PA, PA-L1, and PA-L2, the expression plasmids pYS5,
pYS-PA-L1, and pYS-PA-L2 were transformed into nonvirulent strain
B. anthracis UM23C1–1 and grown in FA medium
(39)
with 20 µg/ml of kanamycin for 16 h at 37°C.
PA proteins were purified by ammonium sulfate precipitation, followed
by chromatography on a MonoQ column (Amersham Pharmacia Biotech,
Piscataway, NJ), as described previously (40)
.
In Vitro Cleavage of PA, PA-L1, and PA-L2 by
MMP-2, MMP-9, and Furin.
Reaction mixtures of 50 µl containing 5 µg of the PA proteins were
incubated at 37°C with 5 µl of soluble furin or 0.2 µg of active
MMP. Furin cleavage was done in 25 mM HEPES (pH 7.4), 150
mM NaCl, 0.2 mM EDTA, 0.2 mM EGTA,
100 µg/ml ovalbumin, 1.0 mM CaCl2,
and 1.0 mM MgCl2. Cleavage with MMPs
was done in 50 mM HEPES (pH 7.5), 10 mM
CaCl2, 200 mM NaCl, 0.05% (v/v)
Brij-35, and 50 µM ZnSO4. Aliquots
(5 µl) withdrawn at intervals were separated by PAGE using 10–20%
gradient Tris-glycine gel (Novex, San Diego, CA) and electroblotted to
a nitrocellulose membrane (Novex). Cleavage was assessed by Western
blotting with a rabbit anti-PA antibody. Membranes were blocked with
5% (w/v) nonfat milk, incubated sequentially with rabbit anti-PA
polyclonal antibody (#5308) and horseradish peroxidase-conjugated goat
antirabbit antibody (sc-2004; Santa Cruz Biotechnology, Inc., Santa
Cruz, CA), and developed with TMB Stabilized Substrate (Promega Corp.,
Madison, WI).
Cells and Culture Medium.
Vero cells, COS-7 cells, human fibrosarcoma HT1080 cells, human
melanoma A2058 cells, and human breast cancer MDA-MB-231 cells were
obtained from American Type Culture Collection (Manassas, Virginia).
All cells were grown in DMEM with 0.45% glucose, 10% FCS, 2
mM glutamine, and 50 µg/ml gentamicin. Cells were
maintained at 37°C in a 5% CO2 environment.
Preparation of Cell Extracts and Conditioned Media for Gelatin
Zymography.
Cells were grown to 80–100% confluence in
75-cm2
flasks, washed twice with serum-free DMEM,
and lysed for 10 min on ice with 1 ml/flask of 0.5% (v/v) Triton X-100
in 0.1 M Tris-HCl (pH 8.0). Lysates collected by scraping
with a rubber policeman were centrifuged at 10,000 rpm for 10 min at
4°C, and the protein concentrations of the supernatants were
determined by the BCA procedure (Pierce, Rockford, IL) and adjusted to
1 mg/ml with lysis buffer. For collection of conditioned media, the
cells were incubated for 24 h with 4 ml/flask of serum-free DMEM.
The culture supernatants were harvested, and cellular debris was
removed by centrifugation at 10,000 rpm for 10 min at 4°C.
Gelatin Zymography.
To enrich and assay gelatinases, cell extracts (1 ml) and amounts of
conditioned media derived from the same number of cells were incubated
at 4°C for 1 h in an end-over-end mixer with 50 µl of
gelatin-Sepharose 4B (Amersham Pharmacia Biotech, Piscataway, NJ)
equilibrated with 50 mM Tris-HCl (pH 7.5), 150
mM NaCl, 5 mM CaCl2,
0.02% (v/v) Tween 20, and 10 mM EDTA. After four washes
with 1 ml of equilibration buffer containing 200 mM NaCl,
the beads were eluted with 30 µl of 4x nonreducing SDS sample
buffer. The supernatants were loaded onto 10% gelatin zymogram gels
(Novex). After electrophoresis, gels were developed using the buffers
and procedures specified by Novex.
Cytotoxicity Assay with MTT.
Cells were seeded into 96-well plates at 25% confluence. The next
day, cells were washed twice with serum-free DMEM to remove residual
serum. Serial dilutions of PA, PA-L1, or PA-L2 (0–1000 ng/ml) combined
with FP59 (50 ng/ml) in serum-free DMEM were added to the cells to give
a total volume of 200 µl/well. In some experiments, MMP inhibitors
were added 30 or 60 min prior to toxin addition. In some experiments,
cells was incubated with the toxins for 6 h, after which the
medium was replaced with fresh DMEM supplemented with 10% FCS. Other
cells were incubated in the serum-free DMEM for the full extent of the
toxin treatment, usually 48 h. Cell viability was then assayed by
adding 50 µl of 2.5 mg/ml MTT. The cells were incubated with MTT for
45 min at 37°C, the medium was removed, and the blue pigment produced
by viable cells was solubilized with 100 µl/well of 0.5% (w/v) SDS,
25 mM HCl, in 90% (v/v) isopropanol. The plates were
vortexed, and the oxidized MTT was measured as
A570 using a microplate reader.
Cytotoxicity Assay in a Coculture System.
A coculture model was designed to mimic the in vivo
condition to verify whether PA-L1 and PA-L2 kill MMP-overexpressing
tumor cells while not affecting MMP nonexpressing cells. Vero, HT1080,
A2058, and MDA-MB-231 cells were cultured in separate chambers of
eight-chamber slides (Nalge Nunc International, Naperville, IL) to
80–100% confluence. The cells were washed twice with serum-free DMEM,
the chamber partition was removed, and the slide was put into a culture
dish with serum-free medium, so that all of the cells were bathed in
the same medium. PA, PA-L1, or PA-L2 (300 ng/ml) and FP59 (50 ng/ml)
were added individually or in combination and cells were exposed for
48 h. Then MTT (0.5 mg/ml) was added for 45 min at 37°C, the
partitions were remounted, and the oxidized MTT in each chamber was
dissolved to determine the viability of each cell type.
Binding and Processing of PA, PA-L1, and PA-L2 by Cultured Cells.
Cells were grown in 24-well plates to 80–100% of confluence and
washed twice with serum-free DMEM to remove residual serum. Then the
cells were incubated with 1000 ng/ml of PA, PA-L1, or PA-L2 at 37°C
in serum-free DMEM for different lengths of time. When TIMP-2 was
tested, it was incubated with cells for 1 h before the PA proteins
were added. The cells were washed three times to remove unbound PA
proteins. Cells were lysed in 100 µl/well modified RIPA lysis buffer
[50 mM Tris-HCl (pH 7.4), 1% NP40, 0.25% sodium
deoxycholate, 150 mM NaCl, 1 mM EDTA, 1
mM phenylmethylsulfonyl fluoride, and 1 µg/ml each of
aprotinin, leupeptin, and pepstatin] on ice for 10 min. Equal amounts
of protein from cell lysates were separated by PAGE using 10–20%
gradient Tris-glycine gels (Novex). Western blotting to detect PA and
its cleavage products was performed as described above.
Construction and Transfection of MT1-MMP cDNA into COS-7 Cells.
A cDNA encoding human MT1-MMP was a generous gift of Dr.
Motoharu Seiki (University of Tokyo, Tokyo, Japan). The MT1-MMP coding
sequence was isolated by digestion with TthIII, the ends
were filled in with Pfu, and the fragment was inserted into
the SmaI site of the mammalian expression vector pEGFPN1
(Clontech Laboratories, Palo Alto, CA). The protein expressed from this
plasmid contains MT1-MMP at the NH2 terminus of
EGFP (red shifted variant of green fluorescent protein). COS-7 cells
(2 x 105 per dish) were
transfected with the expression vector (2 µg) using 10 µg of
SuperFect (Qiagen, Valencia, CA). Cells were incubated for 3 h
with the DNA-SuperFect complex in the presence of serum and
antibiotic-containing medium, washed, and grown in fresh
serum-containing medium for 48 h. Thereafter, cells were grown in
medium containing 500 µg/ml G418 (Life Technologies, Rockville, MD).
Cells expressing the MT1-MMP-EGFP fusion protein, named COSgMT1, were
sorted from nonexpressing cells by flow cytometry with a FACStar Plus
(Becton Dickinson), using excitation at 488 nm. Expression of
MT1-MMP-EGFP was assessed by Western blotting using a specific
antiserum (AB815, Chemicon International, Temecula, CA).
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. These two sequences were shown to be favored gelatinase
substrates by examining the rates of hydrolysis of >50 synthetic
oligopeptides (42
, 43)
. The octapeptide sequences selected
are excellent substrates for MMP-2 and MMP-9 but are also susceptible
to other MMP species (42
, 43)
, including MT1-MMP
(44)
. These two sequences were modeled after the MMP
cleavage site in the 
1 chain of type I collagen and contain
substitutions that enhanced cleavage by MMP-2 and MMP-9 (L1) or by
multiple members of the MMP family (L2).
|
To verify that the mutated proteins had the expected susceptibility to
proteases, they were subjected to cleavage with a soluble form of furin
and active forms of MMP-2 and MMP-9. As expected, PA was very sensitive
to furin but completely resistant to MMP-2 and MMP-9 (Fig. 1B)
. In contrast, PA-L1 and PA-L2 were completely resistant
to furin but were efficiently processed into the two expected
fragments, PA63 and PA20, by MMP-2 and MMP-9 (Fig. 1, C and D)
. Thus, the mutated PA proteins had the desired
susceptibilities to the gelatinases.
PA-L1 and PA-L2 Selectively Kill MMP-overexpressing Tumor Cells.
To test the hypothesis that PA-L1 and PA-L2 would preferentially kill
MMP-overexpressing cells, cytotoxicity assays were done with three
human tumor cell lines: fibrosarcoma HT1080, melanoma A2058, and breast
cancer MDA-MB-231. A nontumor monkey cell line, Vero, was used as
control. Gelatin zymography of cell lysates showed that HT1080
expressed both gelatinases, A2058 expressed MMP-2 but not MMP-9, and
MDA-MB-231 expressed MMP-9 but not MMP-2 (Fig. 2)
. Conditioned serum-free medium gave qualitatively similar results,
indicating that the gelatinases expressed by these three tumor cell
lines were associated with the cell surface and partially secreted into
the medium (Fig. 2)
. In contrast, Vero cells had very low expression of
gelatinases (Fig. 2)
.
|
. The gelatinase-nonexpressing Vero cells were resistant to PA-L1 and
PA-L2 but sensitive to PA in a dose-dependent manner (Fig. 3A)
. However, PA-L1 and PA-L2 that were first nicked by MMP-2
in vitro efficiently killed Vero cells, even with the 6-h
toxin challenge (Fig. 3B)
. This demonstrates that the
resistance of Vero cells to PA-L1 and PA-L2 was attributable to the
inability of the cells to proteolytically activate the mutated PA
proteins. In contrast to Vero cells, the three gelatinase-expressing
tumor cells, HT1080, A2058, and MDA-MB-231, were quite susceptible to
PA as well as to PA-L1 and PA-L2 (Fig. 4)
. The selective cytotoxicity of PA-L1 and PA-L2 for the tumor cells was
retained when the experiments were repeated in medium containing FCS
(data not shown). This indicates that serum proteases do not activate
the PA proteins, nor do serum protease inhibitors block proteolytic
cleavage by the cell surface proteases. To simplify further analyses,
all subsequent experiments were performed in serum-free medium.
|
|
|
. PA was processed by both cell types.
In contrast, PA-L1 and PA-L2 were processed by the MMP-overexpressing
HT1080 cells but not by the Vero cells (Fig. 5, A and B)
. This result was consistent with the previous evidence
that PA-L1 and PA-L2 were processed only by MMPs (Fig. 1, B and C)
and selectively killed MMP-expressing tumor cells
(Figs. 3
and 4)
. Although HT1080 cells processed PA-L1 and PA-L2 along
with PA, the latter was cleaved somewhat more rapidly (Fig. 5B)
. To verify that the cleavage observed on the surface of
HT1080 cells was attributable to MMPs, we added the specific inhibitor,
TIMP-2 (Fig. 5C)
. The inhibitor had no effect on cleavage of
PA (by furin) but strongly decreased cleavage of both PA-L1 and PA-L2.
We also analyzed the processing of PA-L1 and PA-L2 in culture
supernatants of HT1080 cells, and could not detect the active PA63
species in overnight culture supernatants (data not shown).
|
. In addition, the highly specific physiological MMP inhibitor, TIMP-2,
also protected cells. Thus, the killing the tumor cells by PA-L1 and
PA-L2 is highly dependent on the MMP activity expressed by the tumor
cells.
|
. This result shows that PA-L1 and PA-L2 are not activated in the
tissue culture medium by secreted proteases, nor do PA proteins
proteolytically activated on the surface of one cell dissociate and
rebind on other cells. Activated MMPs in the culture supernatant would
have led to killing of the Vero cells, because Fig. 3
shows that PA-L1
and PA-L2 cleaved in solution become cytotoxic.
|
A, inset). Consistent with the lack of gelatinases, COS-7
cells were resistant to PA-L1 and PA-L2 plus FP59 but susceptible to PA
plus FP59 (Fig. 8A)
. A plasmid expressing human MT1-MMP-EGFP
was transfected into COS-7 cells, yielding a stable transfectant,
COSgMT1, in which expression of MT1-MMP-EGFP was verified by Western
blotting (Fig. 8
B, inset). In contrast to COS-7 cells,
COSgMT1 were very sensitive to PA-L1 and PA-L2 (Fig. 8B)
,
indicating that MT1-MMP can cause activation of these mutated PA
proteins, either by directly cleaving the cell-bound PA proteins or in
an indirect way by activation of pro-MMP-2 or other MMP zymogens, which
in turn cleaved the PA proteins. In support of the former explanation,
preliminary experiments have shown that purified MT1-MMP can cleave the
mutated PA proteins (data not shown).
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Cytotoxicity assays in a coculture model, where cells were equally accessible to the toxins in the supernatant, showed that PA-L1 and PA-L2 killed only the three MMP-overexpressing tumor cells and not bystander Vero cells. This result demonstrated that activation of PA-L1 and PA-L2 occurs principally on cell surfaces. Thus, the cytotoxicity of PA-L1 and PA-L2 is directed selectively to the MMP-overexpressing tumor cells, suggesting that these cytotoxins may retain cell-type specificity if used in vivo. These results encourage the further testing of these materials in animal models.
Several factors may explain the cell-type selectivity obtained with the
mutated PA proteins in the coculture system described above. PA
proteins bind to cells rapidly and with high affinity (Kd,
1 nM). Therefore, even at low PA
concentrations, PA receptors will be highly occupied. As a result, any
PA that becomes activated in the supernatant or dissociates from a cell
after cleavage would be unable to locate a free receptor by which to
bind to cells and internalize FP59. The bystander normal cells would
have their receptors occupied by the uncleavable mutated PA proteins.
These nonproductively occupied receptors may be cleared from the cell
surface of the normal cells, further reducing the possibility that the
cell could be targeted by a PA protein that becomes activated in either
the surrounding milieu or on the surface of an MMP-expressing cell.
Another factor that may explain the selectivity observed in the coculture model is that the enzymatic activities of MMPs appear to be enhanced through their localization on cell membranes. This focuses their activities on extracellular matrix substrates and renders them more resistant to the proteinase inhibitors present in the extracellular milieu. Recently, it has been shown that physiological concentrations of plasmin can activate both MMP-2 and MMP-9 on the surface of HT1080 cells by a mechanism independent of MMP or acid proteinase activities (45) . In contrast, in the soluble phase, plasmin degrades both MMP-2 and MMP-9 (45) . Thus, plasmin may provide a mechanism for restricting gelatinase activities to the cell surface.
The recently identified, membrane-anchored MMP family member, MT1-MMP,
also serves to localize MMP activity to the cell surface. It functions
both as an MMP activator and as a receptor for MMP-2 but has no effect
on MMP-9 (46)
. A MMP-2/TIMP-2 complex binds to MT1-MMP on
the cell surface and then is proteolytically activated by an adjacent
MT1-MMP. Recent work has shown that adhesion receptors, such as
vß3 integrin (47)
and the cell surface hyaluronan
receptor CD44 (48)
, may act to retain soluble active MMP-2
or MMP-9 on invasive tumor cell surfaces, where their proteolytic
activities are more likely to promote cell invasion. Because MMP
activities involved in tumor invasion and metastasis are localized
and/or modulated on cell surfaces, MMPs constitute specific markers for
tumor tissues and provide a means for targeting these cells.
It was originally thought that the only role of MMPs in cancer was to break down tissue barriers to promote tumor invasion and metastasis. It is now understood that MMPs also participate in tumor neoangiogenesis and are selectively up-regulated in proliferating endothelial cells (29) . Therefore, the modified bacterial toxins described here may have the additional therapeutic effect of targeting the dividing vascular endothelial cells that are essential to neoangiogenesis in tumor tissues. Therefore, the MMP-targeted toxins may also kill tumor cells by starving the cells of necessary nutrients and oxygen.
Previous efforts to develop anthrax toxin fusion proteins as therapeutic agents have focused on modification of domain 4, the receptor-binding domain of PA. Work is ongoing to create cell type-specific cytotoxic agents by modifying or replacing domain 4 to direct PA to alternate receptors (40 , 49) . This work follows the example of the development of immunotoxins from other protein toxins, as cited earlier (1) . We suggest that combining two conceptually distinct targeting strategies in a single PA protein will yield agents having higher therapeutic indices. A protein that is both retargeted to a tumor cell surface protein and dependent on MMPs for activation may achieve therapeutic effects while being free of the side effects observed with many of the existing immunotoxins.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 To whom requests for reprints should be
addressed, at Oral Infection and Immunity Branch, National Institute of
Dental and Craniofacial Research, NIH, 30 Convent Drive MSC 4350,
Building 30, Room 316, Bethesda, MD 20892-4350. Phone: (301) 594-2865;
Fax: (301) 402-0396; E-mail: Leppla{at}nih.gov 
2 The abbreviations used are: PA, protective
antigen; EF, edema factor; LF, lethal factor; aa, amino acid(s); FP59,
fusion protein of LF aa 1–254 and Pseudomonas exotoxin
A domain III; MMP, matrix metalloproteinase; MTT,
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; PA20,
NH2-terminal Mr 20,000 fragment
of PA; PA63, COOH-terminal Mr 63,000
fragment of PA; TIMP, tissue inhibitor of matrix metalloproteinase.
Received 2/18/00. Accepted 8/23/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
processing activity is tightly controlled by a component that does not affect notch processing. J. Biol. Chem., 273: 24955-24962, 1998.-toxin is proteolytically activated by furin. Infect. Immun., 65: 4130-4134, 1997.vß3. Cell, 85: 683-693, 1996.[Medline]
This article has been cited by other articles:
|
|
 |
|
  R. W. Alfano, S. H. Leppla, S. Liu, T. H. Bugge, J. M. Ortiz, T. C. Lairmore, N. S. Duesbery, I. C. Mitchell, F. Nwariaku, and A. E. Frankel Inhibition of Tumor Angiogenesis by the Matrix Metalloproteinase-Activated Anthrax Lethal Toxin in an Orthotopic Model of Anaplastic Thyroid Carcinoma Mol. Cancer Ther., January 1, 2010; 9(1): 190 - 201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Alfano, S. H. Leppla, S. Liu, T. H. Bugge, C. J. Meininger, T. C. Lairmore, A. F. Mulne, S. H. Davis, N. S. Duesbery, and A. E. Frankel Matrix Metalloproteinase-Activated Anthrax Lethal Toxin Inhibits Endothelial Invasion and Neovasculature Formation during In vitro Morphogenesis Mol. Cancer Res., April 1, 2009; 7(4): 452 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. W. Alfano, S. H. Leppla, S. Liu, T. H. Bugge, M. Herlyn, K. S. Smalley, J. L. Bromberg-White, N. S. Duesbery, and A. E. Frankel Cytotoxicity of the matrix metalloproteinase-activated anthrax lethal toxin is dependent on gelatinase expression and B-RAF status in human melanoma cells Mol. Cancer Ther., May 1, 2008; 7(5): 1218 - 1226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Liu, H. Wang, B. M. Currie, A. Molinolo, H. J. Leung, M. Moayeri, J. R. Basile, R. W. Alfano, J. S. Gutkind, A. E. Frankel, et al. Matrix Metalloproteinase-activated Anthrax Lethal Toxin Demonstrates High Potency in Targeting Tumor Vasculature J. Biol. Chem., January 4, 2008; 283(1): 529 - 540. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Moayeri, J. F. Wiggins, and S. H. Leppla Anthrax Protective Antigen Cleavage and Clearance from the Blood of Mice and Rats Infect. Immun., November 1, 2007; 75(11): 5175 - 5184. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-H. Chen, S. Liu, L. A. Bankston, R. C. Liddington, and S. H. Leppla Selection of Anthrax Toxin Protective Antigen Variants That Discriminate between the Cellular Receptors TEM8 and CMG2 and Achieve Targeting of Tumor Cells J. Biol. Chem., March 30, 2007; 282(13): 9834 - 9845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Springfeld, V. von Messling, M. Frenzke, G. Ungerechts, C. J. Buchholz, and R. Cattaneo Oncolytic efficacy and enhanced safety of measles virus activated by tumor-secreted matrix metalloproteinases. Cancer Res., August 1, 2006; 66(15): 7694 - 7700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. V. Artym, Y. Zhang, F. Seillier-Moiseiwitsch, K. M. Yamada, and S. C. Mueller Dynamic interactions of cortactin and membrane type 1 matrix metalloproteinase at invadopodia: defining the stages of invadopodia formation and function. Cancer Res., March 15, 2006; 66(6): 3034 - 3043. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Vessillier, G. Adams, and Y. Chernajovsky Latent cytokines: development of novel cleavage sites and kinetic analysis of their differential sensitivity to MMP-1 and MMP-3 Protein Eng. Des. Sel., December 1, 2004; 17(12): 829 - 835. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Liu and S. H. Leppla Cell Surface Tumor Endothelium Marker 8 Cytoplasmic Tail-independent Anthrax Toxin Binding, Proteolytic Processing, Oligomer Formation, and Internalization J. Biol. Chem., February 7, 2003; 278(7): 5227 - 5234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Liu, H. Aaronson, D. J. Mitola, S. H. Leppla, and T. H. Bugge Potent antitumor activity of a urokinase-activated engineered anthrax toxin PNAS, January 21, 2003; 100(2): 657 - 662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Frankel Increased Sophistication of Immunotoxins Clin. Cancer Res., April 1, 2002; 8(4): 942 - 944. [Full Text] [PDF]
|
|
|
|
|
|
S. Liu, T. H. Bugge, and S. H. Leppla Targeting of Tumor Cells by Cell Surface Urokinase Plasminogen Activator-dependent Anthrax Toxin J. Biol. Chem., May 18, 2001; 276(21): 17976 - 17984. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
