| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
The Second Department of Pathology, Miyazaki Medical College, Miyazaki 889-1692 [H. K., R. H., H. I., M. K.], and Department of Biological Sciences, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama 226-0026 [N. K.], Japan
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Recently, a novel factor XIIa-like serine proteinase having an efficient scHGF-activating activity was identified and designated as HGFA (23 , 24) . This enzyme is reported to be secreted by the liver as an inactive zymogen (pro-HGFA), circulating in the blood in this form (21 , 24 , 25) . It is activated by limited proteolysis brought about by thrombin in injured tissue, and it then activates scHGF very efficiently as a typical catalyst (25, 26, 27) . In fact, the activation of scHGF in an injured rat liver was abrogated by treatment with the anti-HGFA antibody, indicating that HGFA may be involved crucially in the activation of scHGF in vivo (25) . It is important to note that the activity of HGFA is not inhibited by major plasma proteinase inhibitors, and that HGFA is in fact active in serum (21) . HAI-1 was identified as a potent endogenous inhibitor of HGFA (28) . Mature HAI-1 has two well-defined Kunitz-type serine proteinase inhibitor domains. The first domain appears to be responsible for the inhibition of HGFA (28) . This inhibitor has a presumed transmembrane domain in the COOH-terminal region, suggesting that HAI-1 is an integral membrane serine proteinase inhibitor. In fact, we reported recently that the HAI-1 protein is present on the cellular basolateral surface and is expressed predominantly in columnar epithelial cells covering the mucosal surface and duct lumen (29) . Its expression is up-regulated in response to tissue injury and regeneration (29) . We also reported that HAI-1 mRNA was present in gastrointestinal mucosa and carcinoma; the level is lower in carcinoma tissue than in the corresponding normal mucosa (30) .
Colorectal cancer is one of the most common types of cancer diagnosed and the second leading cause of cancer death in the United States, and its incidence is increasing in Japan. The c-met proto-oncogene is overexpressed in colorectal carcinomas (31 , 32) , and HGF/SF stimulates the growth and motility of the colorectal carcinoma cells in vitro (33 , 34) . Moreover, serum HGF/SF level is correlated with disease progression in patients with colorectal carcinoma, and the amounts of HGF/SF increase in the tumor tissue (35) . However, essentially nothing is known concerning the mechanism and regulation of HGF/SF activation in colorectal carcinomas, as well as in other tumors; such a study would have potentially great importance. Given the fact that the activation of scHGF by uPA is controlled by a stoichiometric reaction, the coexistence of another mechanism may be suggested in colorectal carcinomas in which secreted and stored extracellular scHGF is processed efficiently enzymatically. In this context, it can be hypothesized that HGFA and HAI-1 may have roles in the regulation of HGF/SF activation in colorectal tumors. However, the extrahepatic expression of HGFA in colorectal tumors has not yet been determined, and little is known about HAI-1 expression during the course of colorectal tumor progression. Moreover, it has not yet been established whether activation of HGF/SF is in fact enhanced in the colorectal cancer tissue in vivo compared with normal mucosa. The principal purposes of the present study were to examine an existence of scHGF-processing activity in colorectal carcinoma cells and to test the potential role of HGFA in the scHGF activation of the cells. Furthermore, we evaluated the comparative expression pattern of HGFA and HAI-1 in the human colorectal adenoma-carcinoma sequence.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Human colorectal carcinoma cell lines used were SW837, DLD-1, RCM-1, LoVo, and Colo 205. SW837 and Colo 205 were obtained from Dainihon Seiyaku (Osaka, Japan), DLD-1 and LoVo were obtained from RIKEN cell bank (Tsukuba, Japan), and RCM-1 was established in our laboratory.
Immunohistochemistry.
The method used for immunohistochemistry was described previously
(29)
. Formalin-fixed, paraffin-embedded tissue specimens
were prepared according to the routine procedure. Sections were dewaxed
in xylene and rehydrated in decreasing ethanol solutions and water.
After antigen retrieval [5 min of autoclave in 10 mM
citrate buffer (pH 6.0)], the sections were treated with 3%
H2O2 in PBS for 10 min,
washed in PBS twice, and then blocked in 3% BSA in PBS for 1 h at
room temperature. Then the sections were incubated with the primary
antibody (10 µg/ml) in PBS containing 1% BSA for 16 h at 4°C.
Negative controls consisted of omission of the primary antibody. For
adsorption test, each antibody was pretreated with a 10-fold excess of
recombinant HGFA or HAI-1. The sections were then washed in PBS and
incubated with Envision labeled polymer reagents (Dako, Carpinteria,
CA) for 30 min at 37°C. The reaction was revealed with nickel and
cobalt-3,3'-diaminobenzidine (ImmunoPure Metal Enhanced DAB Substrate
kit; Pierce, Rockford, IL) and counterstained with Mayer’s
hematoxylin. All colon pathology was assessed independently by two
pathologists. Diagnoses and terminology were those of the World Health
Organization (36)
. Eight cases of hyperplastic
polyp, 57 cases of low-grade (mildly or moderately dysplastic) adenoma,
14 cases of high-grade (severely dysplastic) adenoma, 63 cases of
primary colorectal adenocarcinoma, and 15 cases of metastatic lesion in
the liver were used. Epithelial cell or tumor cell staining was graded
on a scale of 0 to 4 as follows: 0, negative; 1+, <20% of cells
staining; 2+, 20–50%; 3+, 50–80%; and 4+, 80–100%.
Tissue Collection, RNA Extraction, RT-PCR, and RNA Blot Analysis.
Total cellular RNA was extracted by Trizol reagent (Life Technologies,
Inc., Gaithersburg, MD). For RNA extraction, all tissues were received
fresh from the operating room. In each case, tissue samples were taken
from the primary tumor and corresponding normal mucosa. Sections taken
adjacent to the tissue used for RNA extraction were assessed for degree
of histopathological assessment. Methods for RT-PCR analyses of HGFA,
c-met, and G3PDH mRNAs have been described previously
(37)
. Primer sequences are as follows: c-met
forward, ATTCATCAGGCTGTGAAGCG; c-met reverse,
CAGAGAGGCATTGACTGCAG. HGFA forward, AGGACACAAGTGCCAGATTG; HGFA reverse,
GTTGATCCAGTCCACATAGT. The expected product sizes are 381, 334, and 300
bp for c-met, HGFA, and G3PDH, respectively. RT-PCR for HGFA
and c-met was carried out by running for 22 and 32 cycles at
2-cycle intervals. The products emerged between 24 and 26 cycles
(c-met) and between 26 and 28 cycles (HGFA), increased
exponentially with cycles up to 30–34, and then reached a plateau.
Thus, PCR amplification was set at 28 cycles, because c-met
PCR products and HGFA PCR products almost linearly increased in
proportion to the number of cycles between 24 and 30 cycles
(c-met) and between 26 and 32 cycles (HGFA). For G3PDH, 23
cycles of amplification were used as in a similar experiment, at 95°C
for 30 s, 58°C for 60 s, and 72°C for 90 s using
HotStarTaq polymerase (Qiagen, Tokyo, Japan), and followed by
incubation at 72°C for 7 min. The conditions of G3PDH amplifications
were same as above, except for 20–26 cycles at 2-cycle intervals. The
products were electrophoresed on 2% agarose gels and stained with
ethidium bromide, and the band intensity was measured with NIH Image
software. For semiquantification of the RT-PCR, the reaction cycle/PCR
products of each reaction mixture were plotted on semilogarithmic
graphs, and PCR cycles in which the products linearly increased in
proportion to the number of cycles were determined. The intensity of
the product was normalized through that of the corresponding G3PDH
product. For RNA blot analysis, 30 µg of total RNA were applied to
each well and electrophoresed through formaldehyde-containing 1%
agarose gel. The products of electrophoresis were transferred onto
Hybond-N+ nylon membrane (Amersham,
Buckinghamshire, United Kingdom), and RNA was UV-cross-linked onto the
membrane. Hybridization was performed in mixed solution of 50%
formamide, 5x Denhardt’s solution, 25 mM
phosphate buffer (pH 6.5), 0.1% SDS, 100 µg/ml sonicated and
heat-denatured salmon sperm DNA, and 5x SSC at 42°C for
16 h. The blots were washed as follows: three times in 1x
SSC-0.1% SDS for 15 min at room temperature, and twice in the same
solution for 20 min at 65°C. The membranes were autoradiographed with
Kodak XR-5 film at -80°C for 6 or 18 h. The
NaeI-XhoI fragment (1221 bp) from human HAI-1
cDNA was used as a probe. For internal control of loading, the blots
were hybridized subsequently to the G3PDH probe (Clontech, Palo Alto,
CA). The probes were radiolabeled by random priming with
[32P]CTP. For quantification of the RNA blot
analysis, the radioactivity of mRNA signals for HAI-1 was measured
directly by a bioimaging analyzer (FUJIX BAS2000 system; Fuji Photo
Film, Tokyo, Japan), and normalized by division through those of the
corresponding G3PDH mRNA signals. To assess the level of indicated mRNA
in tumor, a ratio of the T to that of the corresponding N was
calculated, and expressed as the T:N ratio.
Immunoblot Analysis.
To prepare a tissue extract specimen, fresh human colon carcinoma
tissue and corresponding normal mucosa tissue (160 mg of each), which
were obtained from surgically resected colon of a colon cancer patient,
and normal liver tissue obtained at autopsy were frozen immediately in
liquid nitrogen, crushed, and homogenized in an extraction buffer
containing 50 mM Tris-HCl (pH 7.5), 150 mM
NaCl, proteinase inhibitor mixture (Complete; Boehringer Mannheim,
Germany), and 0.01% CHAPS, without (for HGF/SF) or with (for HGFA and
HAI-1) 0.2% Triton X-100, followed by centrifugation (25,000 x g for 15 min). For the detection of HGF/SF, the
resultant supernatants were mixed with heparin-Sepharose beads
(Pharmacia, Uppsala, Sweden) in the presence of 100
µM nafamostat mesilate (Banyu Seiyaku, Tokyo,
Japan). After the Sepharose beads had been washed three times with PBS,
bound HGF/SF was eluted with SDS-PAGE sample buffer and boiled for 3
min. Protein extraction from the cultured cells was done according to
the method described previously (29)
. Each sample was
separated by SDS-PAGE (4–12% gradient gel; Novex, San Diego, CA)
under reducing conditions and processed for immunoblot analysis as
described previously (29)
. Primary antibodies used were
anti-HGF/SF (1H56) monoclonal antibody (0.5 µg/ml), anti-HGFA (A1)
monoclonal antibody (1 µg/ml), anti-HAI-1 (1N7) monoclonal antibody
(1 µg/ml), and anti-Met (C-28) rabbit polyclonal antibody (0.5
µg/ml; Santa Cruz Biotechnology, Santa Cruz, CA). After incubation
with peroxidase-conjugated secondary antibodies, the labeled proteins
were visualized with a chemiluminescence reagent (New England
Nuclear-Life Science, Boston, MA). For positive controls of HGFA and
HAI-1, SFCM of CHO cells transfected with HGFA expression vector and
cell extract of CHO transfected with HAI-1 expression vector,
respectively, were used. The vectors were constructed by using pCIneo
plasmid (Promega Corp., Madison, WI) and the whole coding region of
HGFA and HAI-1 cDNA (24
, 28)
. To detect phosphorylated
Met, peroxidase-conjugated antiphosphotyrosine monoclonal antibody
(PY-20) was used according to the instruction of the
manufacturer (Amersham Pharmacia Biotech, Buckinghamshire, United
Kingdom).
Assay for HGF/SF Activation Activity.
Five µl of recombinant scHGF (1.6 µg/µl) were mixed with 20 µl
of concentrated SFCM of cultured colon carcinoma cells in PBS
containing 0.05% CHAPS and incubated at 37°C for 12 h. To avoid
the contamination of fetal bovine serum-derived HGFA, colon carcinoma
cells were maintained in a mixture of RPMI 1640:Ham’s F-12 medium
(1:1) supplemented with HGFA-depleted fetal bovine serum (5%) before
starting the serum-free culture. The HGFA-depleted serum was prepared
by using anti-HGFA immunoaffinity column. Subconfluent cells were then
washed three times with SFCM and cultured in SFCM for 24 h. SFCM
was collected and concentrated by ultrafiltration (5- or 10-fold). In
the concentrated sample, 0.05% CHAPS was added and used for the assay.
In an indicated assay, SFCM was pretreated with 1 unit of thrombin
(Sigma Chemical Co., St. Louis, MO) for 1 h at 37°C. For
positive control of pro-HGF/SF activation, 5 µl of recombinant
Mr 34,000 HGFA (0.3 ng/µl)
were mixed with scHGF and incubated. For neutralizing study, the sample
was preincubated at 37°C for 1 h with 1 µg of antibody, 10 ng
of nafamostat mesilate, or 400 ng of recombinant HAI-1
(Mr 40,000 secreted form). Total
reaction volume was 45 µl for each assay. After the incubation of
scHGF with each sample, HGF/SF was bound to heparin-Sepharose beads.
After the Sepharose beads had been washed three times with PBS, HGF/SF
was eluted with SDS-PAGE sample buffer, boiled for 3 min, and then
separated by SDS-PAGE (4–12% gradient gel) under reducing conditions.
Proteins in the gel were stained with 2.5% Coomassie Brilliant Blue in
water:methanol:acetic acid solution (6:3:1, v/v). Recombinant scHGF and
Mr 34,000 two-chain form of HGFA were
prepared as described (23
, 24)
. uPA was kindly provided by
Dr. Etsuo Yoshida (Second Department of Physiology, Miyazaki Medical
College, Miyazaki, Japan). To study cellular activation of scHGF and
subsequent cellular response, SW837 and DLD-1 cells were cultured in
serum-free condition as described above and treated with 50 ng/ml scHGF
with or without thrombin (4 units/ml), anti-HGFA antibody (20 µg/ml),
control mouse IgG (P1-4, 20 µg/ml), or nafamostat mesilate (250
ng/ml). Assay for scHGF-processing activity in tissue extracts was done
according to the method described previously (25)
.
Measurement of VEGF.
Amounts of VEGF protein in the cultured conditioned media were measured
by sandwich ELISA with a human VEDF EIA kit (Immunobiological
Laboratories Co., Gunma, Japan).
Data Analysis.
Statistical parameters were ascertained with the Statview 4.0 program
(Brainpower, Inc., Calabasas, CA). Kruskal-Wallis nonparametric one-way
ANOVA tests or Fisher’s protected the least significant
difference tests were used to compare between groups; the
difference between means was tested with the Mann-Whitney U
test or nonparametric paired Wilcoxon test. Significance was set at
P < 0.05.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, HGF/SF present in normal mucosa tissue distant from the tumor was
primarily scHGF. In contrast, a significant proportion of scHGF had
been converted to the two-chain active form in the corresponding
carcinoma tissue. In accordance with the previous reports (12
, 35)
, total amounts of HGF/SF protein were increased apparently
in the carcinoma tissues. These findings indicate that the activation
process of HGF/SF and synthesis of HGF/SF are up-regulated
significantly in colorectal carcinomas.
|
. Interestingly, this processing activity was enhanced
significantly when SFCM was pretreated with thrombin (Fig. 2, A and B)
. However, the same concentration of
thrombin itself did not activate scHGF (Fig. 2, A and B)
. Because pro-HGFA is activated specifically by thrombin
(26)
, these observations suggested that the processing
activity in SFCM may represent HGFA produced by the carcinoma cells.
Indeed, the activity was inhibited significantly by recombinant HAI-1,
a specific endogenous inhibitor for HGFA (Fig. 2B)
. A
subsequent neutralizing assay using specific antibody for HGFA
confirmed that HGFA is, in fact, responsible for the scHGF-processing
activity present in SFCM (Fig. 2C)
. On the other hand, the
activity was not inhibited by anti-uPA neutralizing antibody. As
reported previously (22, 23, 24)
, in contrast to uPA, the
reaction of recombinant HGFA-induced scHGF/SF activation was typical
catalytic reaction in which virtually all of the substrate was
processed (Fig. 2, A and C)
. Then the presence of
HGFA mRNA and proteins was confirmed by RT-PCR study and immunoblot
analysis, respectively, in SW837 cells (Fig. 2D)
. SFCM of
SW837 cells, indeed, contained Mr
96,000 pro-HGFA and a very low level of
Mr 32,000 active form under the
reducing condition. This active form migrated on the gel as a
Mr 34,000 protein under nonreducing
conditions (not shown). Faint bands of
Mr 66,000,
Mr 50,000–60,000, and
Mr 41,000 species immunoreactive to
the antibody were also detected. The expression of HGFA was not SW837
cell line-specific phenomenon, because four other colorectal carcinoma
cell lines examined (DLD-1, RCM-1, LoVo, and Colo205) also expressed
HGFA mRNA with sensitive RT-PCR study (Fig. 2D)
. Of the cell
lines, DLD-1 showed the highest mRNA level of HGFA, and SFCM of DLD-1
also contained scHGF-processing activity. This activity was enhanced
markedly by thrombin treatment and was inhibited significantly by
anti-HGFA neutralizing antibody or by nafamostat mesilate, a synthetic
serine proteinase inhibitor having potent inhibitory activity to HGFA
but not to uPA (21
, 38
; Fig. 3A
). The presence of pro-HGFA in SFCM of DLD-1 and its
activation upon thrombin treatment were confirmed by immunoblot
analysis (Fig. 3B)
.
|
|
. The two-chain active form of HGF/SF induced enhanced
scattering of DLD-1 cells. SW837 cells did not show apparent scattering
response and migrated as coherent cell sheets. The scattering response
could be reproduced by scHGF treatment in DLD-1 accompanying tyrosine
phosphorylation of Met, particularly in the presence of thrombin, and
the induction of scattering by scHGF was suppressed by anti-HGFA
antibody (Fig. 3D)
or by nafamostat mesilate (not shown). On
the other hand, the two-chain active form of HGF/SF induced enhanced
VEGF secretion in both DLD-1 and SW837 cell lines (Fig. 3E)
.
This VEGF-inducing effect of HGF/SF was also observed in other
colorectal carcinoma cell lines showing 1.6–2.5-fold increase in VEGF
secretion after HGF/SF (20 ng/ml) treatment. As shown in the Fig. 3E
, scHGF also showed the VEGF-inducing effects, although
the extent of stimulation was lower than that of two-chain active form.
However, the addition of thrombin into the culture significantly
enhanced the scHGF-induced VEGF up-regulation. The effects of scHGF was
inhibited significantly, although not completely, by the presence of
anti-HGFA antibody (up to 72 and 67% inhibition in DLD-1 and SW837,
respectively) or nafamostat mesilate (80% inhibition). The failure of
complete inhibition of scHGF-induced VEGF up-regulation in this study
may be because of the minor contamination, which represents 
5% of
total protein, of the two-chain active form in the scHGF sample as
observed in SDS-PAGE analysis. In addition, thrombin itself also showed
weak stimulatory effect. These results indicated that HGFA is a major
activator of scHGF of these colon carcinoma cells in vitro,
and they support the hypothesis that cellular HGFA is involved in the
processing of scHGF in the extracellular milieu of colorectal
carcinomas.
Comparative Analysis of Expression of mRNAs for HGFA, HAI-1, and
c-met in Colorectal Carcinoma and Corresponding Normal
Colon Mucosa Tissues.
To examine the in vivo relevance of the above observations
in vitro, expression of HGFA and HAI-1 was analyzed in
vivo in colorectal mucosa. Total RNAs extracted from colon
carcinoma and corresponding normal colon mucosa tissue were used to
determine the expression of specific mRNAs for HGFA and HAI-1, as well
as for c-met. Fig. 4
shows a representative result of analyses. There were low but distinct
levels of mRNA for HGFA in the colorectal mucosa. The expression was
conserved or was enhanced modestly in the neoplastic colorectal mucosa,
although the difference was not statistically significant (mean
T:N ± SE, 1.6 ± 0.5). In accordance to
a number of previous studies (12
, 31
, 32)
, there existed a
tendency for the expression of c-met mRNAs to be more
enhanced in carcinoma tissues than in the corresponding normal
counterparts (mean T:N ± SE, 2.3 ± 0.5;
P < 0.05). Next, expression of HAI-1, a
potent inhibitor of HGFA, was analyzed by RNA blot analysis. The level
of HAI-1 mRNA was lower in carcinoma tissue than in its corresponding
normal counterpart (mean T:N ± SE, 0.58 ± 0.1; P < 0.01).
|
. Specificity of the antibody was
further verified by immunoblot analysis of the liver tissue extracts
(Fig. 5B)
. Then normal human colon mucosa tissue was stained
with the antibody. In normal colon mucosa, HGFA immunoreactivity was
observed in the enterocytes (Fig. 5C)
, although it was much
weaker than that in hepatocytes. In addition, macrophages in the stroma
tissue and serous fluid in the blood vessels were also stained (data
not shown). The latter immunoreactivity may represent zymogen of HGFA
produced by the liver and present in the plasma.
|
, the subcellular localization of HGFA immunoreactivity was altered
significantly in the carcinoma cells. In normal cells, the positive
immunoreactivity for HGFA was localized beneath the apical membrane or
in supranuclear region. This pattern was preserved relatively well in
adenoma cells (Fig. 5, C and D)
, whereas in
carcinoma cells the immunoreactivity frequently localized to the basal
membrane or cell-stroma interface (Fig. 5, E
–H).
This basal pattern of HGFA immunoreactivity was observed predominantly
in 52% (29 of 56) of total carcinoma cases stained for HGFA (Table 2)
. On the other hand, none of hyperplastic polyps or low-grade adenomas
showed the predominant basal staining pattern of HGFA, and this basal
pattern was correlated with the progression of adenoma-carcinoma
sequence (P < 0.01, Kruskal-Wallis test).
There was a tendency for carcinoma cases with liver metastases and
metastatic liver tumor to exhibit the basal immunostain pattern of HGFA
more frequently (Table 2)
.
|
|
A, a). This immunoreactivity was much more evident in
surface absorptive cells than in goblet cells (Fig. 6A, b)
. Detaching or shedding nests of
somewhat degenerative epithelial cells were stained more strongly (Fig. 6A, b)
. The immunoreactivity appeared to increase
in hyperplastic polyp (not shown), in which not only the surface
epithelium but also deep glandular epithelial cells were stained. In
the low-grade adenoma epithelium, HAI-1 immunoreactivity apparently was
enhanced compared with the corresponding normal mucosa (Fig. 6A, c)
. Intracellular immunolocalization of HAI-1
in adenoma cells was similar to that in normal epithelial cells,
showing a predominant basolateral cellular surface stain (Fig. 6A, c)
. In contrast, the immunoreactivity was
reduced more significantly in carcinoma cells than in the adjacent
normal epithelium (Fig. 6A, d
–f).
Interestingly, normal epithelial cells adjacent to the cancer cells or
left behind in cancer tissue expressed a significantly higher level of
cell surface HAI-1 (Fig. 6B)
.
|
. The reduced expression of HAI-1 in
carcinomas was further confirmed by immunoblot analysis (Fig. 6D)
. The band corresponding to the
Mr 66,000 membrane-bound form of HAI-1
(29)
clearly was reduced in carcinoma tissue compared with
corresponding normal and adenoma tissues. Semiquantitative analysis of
HAI-1 immunoreactivity indicated that the immunoreactivity was
correlated inversely with the progression of the adenoma-carcinoma
sequence (P < 0.001 Kruskal-Wallis test;
Table 3
). However, an apparent relationship was not observed between HAI-1
immunoreactivity and Dukes’ stage of the cancer.
|
. To confirm that HGFA and its active form were, in fact, present in
carcinoma tissue, immunoblot analysis was performed (Fig. 8A)
. The amounts of pro-HGFA as well as the
Mr 32,000 active form of HGFA were
increased in carcinoma tissue and its metastatic lesion compared with
the corresponding normal mucosa distant from the carcinoma lesion. The
presence of HGFA-dependent scHGF-processing activity was further
confirmed in the carcinoma tissue extracts (Fig. 8B)
.
Therefore, the net balance between HGFA and HAI-1 appears to be shifted
in favor of HGFA activity in carcinoma tissues.
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
It is worth noting that HGFA is secreted as an inactive zymogen
(pro-HGFA) in the liver (24)
. This is also the case in the
colon carcinoma cells as shown in this study. Thrombin generated in an
injured tissue has been considered to be an important activator of
pro-HGFA (26)
. Indeed, HGFA activities of colon carcinoma
cells, as well as in SFCM, were enhanced significantly by thrombin
treatment. Because thrombin did not alter the expression level of HGFA
mRNA (data not shown), the effects of thrombin would be mediated by its
pro-HGFA-activating activity. Therefore, the present study indicates a
crucial role of blood coagulation system in HGF/SF activation in
tumors. In cancer tissue, increased procoagulant activity has been
reported accompanying pericellular fibrin generation, indicating
thrombin generation in tumor tissues (41)
. We have
reported that colorectal carcinoma cells express tissue factor, a major
initiator of the coagulation cascade in vivo
(42)
. Moreover, a highly metastatic subline of a rectal
carcinoma cell line exhibited higher tissue factor activity than its
parent line (42)
. Thus, it is reasonable to speculate that
thrombin is generated frequently in the pericellular microenvironment
of colon carcinoma cells via the aberrant activation of a coagulation
cascade, and the generated thrombin would activate cellular pro-HGFA,
eventually resulting in the generation of active HGF/SF in
vivo. In fact, the active Mr
32,000 form (Mr 34,000 in nonreducing
conditions) of HGFA was detectable in carcinoma tissues. Moreover, the
current observation that HGF/SF enhances VEGF production in colon
carcinoma cells may provide an amplifying circuit for the activation of
scHGF by HGFA, because VEGF also enhances the permeability of blood
vessels in tumor tissue (hence its other name, "vascular permeability
factor"), resulting in elevated concentrations of prothrombin and
pro-HGFA derived from plasma in the interstitial fluid of the tumor
(41)
. The plasma-derived HGFA would also contribute to the
activation of scHGF upon activation by thrombin. Indeed, immunoblot
analysis showed an increase in the level of pro- and active forms of
HGFA at the protein level in cancer tissue (Fig. 8A)
,
whereas this increase was not apparent by RT-PCR (Fig. 4)
, suggesting
the contribution of plasma-derived HGFA in cancer tissue as a result of
enhanced vascular permeability.
HGFA immunoreactivity was observed consistently in normal and neoplastic colorectal epithelia, and the level of expression tended to increase in the neoplastic cells compared with the normal counterparts. The expression of HGFA mRNA in colorectal tissues was further confirmed by RT-PCR analysis. Although the major source of plasma HGFA protein has been considered to be the liver (24) , this study revealed that the human colorectal epithelium also expresses HGFA. In accordance with the present observation, Matsubara et al. (43) have reported recently that HGFA mRNA is expressed in epithelia expressing c-met mRNA in the fetal rat gastrointestinal tract. Using RNA blot analysis, we have also observed that HGFA mRNA is expressed in the gastrointestinal tract of mouse, particularly in the colon, suggesting the possible important role of HGFA in the gastrointestinal tract (44) . Interestingly, the subcellular localization of HGFA often is altered significantly in carcinoma cells showing a predominant basal staining pattern. It may be a result of altered cancer-specific sorting of HGFA or may reflect the binding of activated HGFA on the cellular surface proteoglycan because active HGFA has strong affinity for heparin (25) . This abnormal subcellular distribution of HGFA in carcinoma with respect to normal and low-grade adenoma cells may increase the availability of mesenchyme-derived scHGF for the activation by HGFA in carcinoma. In fact, primary carcinomas with distant metastasis (Dukes’ D) and metastatic liver lesions tended to show this basal HGFA staining pattern more frequently than nonmetastatic carcinomas. However, the precise relevance of HGFA activity to the disease process in vivo could not be analyzed in this study. For this purpose, an immunoassay system to quantitate the antigen level of the active form of HGFA and an adequate method for the titration of HGFA activity are necessary, both of which are currently under development.
In contrast to HGFA, the immunoreactivity for the HAI-1 protein was highly dependent on cellular situations and correlated inversely with the progression of the adenoma-carcinoma sequence. Therefore, given the observation that the level of HGFA mRNA expression is relatively consistent, local HGFA activity seems to be regulated by the level of HAI-1 expression and/or by the change in subcellular localization of HGFA. In a normal colon, HAI-1 was stained on the basolateral cellular surface of enterocytes of the mucosal surface (zone of maturation), and both the cells in the zone of proliferation and the stem cells in the crypt were hardly stainable. However, the immunoreactivity was up-regulated in hyperplastic and low-grade adenoma epithelia and in the injured normal epithelium adjacent to carcinoma cells. On the other hand, HAI-1 immunoreactivity was reduced significantly in carcinoma cells compared with the adjacent normal or adenoma epithelium. Therefore, the staining patterns of HAI-1 and HGFA were frequently reciprocal at the normal (or adenoma)-carcinoma boundaries, suggesting that the net balance between HGFA and HAI-1 shifts in favor of HGFA activity in the carcinoma tissues. This shift of proteinase/inhibitor balance would contribute to an efficient activation of HGF/SF in colorectal carcinomas, which may result in enhanced cellular growth, migration, and angiogenesis, because HGF/SF is a potent growth factor for gastrointestinal epithelial cells (33 , 45) as well as for vascular endothelial cells (8 , 46) and stimulates cellular migration and VEGF production of colon carcinoma cells. Stimulatory effects of HGF/SF on VEGF production were also reported in other cell types (47 , 48) . Moreover, HGF/SF also stimulates the expression of VEGF receptor in vascular endothelial cells (48) .
It should be noted that normal epithelium left behind in cancer tissue
and exfoliating surface epithelial cells showed significant
up-regulation of HAI-1. Moreover, although the immunoreactivity of
HAI-1 was reduced significantly in cancer cells relative to the
adjacent normal epithelium, we have observed paradoxical up-regulation
of HAI-1 in certain carcinoma cells showing cell injury, degeneration,
or intense cell-stroma interactions (data not shown). These findings
suggest that the HAI-1 molecule has multiple roles that may be highly
situational, depending on the presence of other constituents in the
intra- or extracellular milieu; some of these roles are possibly
independent of the HGFA-inhibitory activity of the molecule. HAI-1 has
two Kunitz domains. The first domain appears to be responsible for the
inhibition of HGFA (28)
, indicating the possible presence
of other target proteinases(s) in which the second Kunitz domain might
be involved predominantly. Because all situations where HAI-1
immunoreactivity was up-regulated in vivo appear to be
adverse situations for the cells, one possibility is that HAI-1 may act
as a cell survival factor in adverse and unstable circumstances through
its inhibitory activities against excess pericellular proteinase(s).
Alternatively, it may be somehow involved in a regenerating process in
response to tissue and cellular injury. Indeed, recent observations
supporting this hypothesis indicate that HAI-1 is also up-regulated in
severely injured human kidneys and liver (29)
and at the
ulcer edge of mouse experimental colitis (49)
. In this
regard, we have observed that the 5'-regulatory region of the human
HAI-1 gene contained consensus binding sites of early
responsive transcription factors in case of tissue injury, such as heat
shock transcription factors, nuclear factor 
B, and Egrs
(50)
. Further study for the proteinase specificity of
HAI-1 in the colorectum and analysis of the regulatory elements of the
HAI-1 gene is required to clarify these phenomena. Recently,
a novel serine proteinase designated as matriptase was identified as a
target of HAI-1 in the mammary tissue in vivo
(51)
.
In conclusion, this study provides evidence of the crucial involvement
of HGFA in the regulation of HGF/SF activation in colon carcinoma cells
and reports the comparative expression patterns of HGFA and HAI-1 in
colon mucosa, adenomas, and carcinomas for the first time. In Fig. 9
, we propose a hypothetical model for intermolecular interactions in the
activation of HGF/SF in colorectal cancer tissue. Considering the
important roles of HGF/SF in gastrointestinal mucosa and tumors as well
as the fact that the extracellular activation of scHGF is a critical
limiting step in inducing the pleiotropic biological effects of HGF/SF
through its receptor Met, more studies of HGFA and HAI-1 in the
pathophysiology of gastrointestinal tract will be necessary. The
activation step of HGF/SF may serve as a promising new target of
therapeutic intervention of tumors including colon cancers.
|
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by Grants-in-Aid for
Scientific Research (C) 11670221 (to H. I.) and 12670209 (to H. K.)
from the Ministry of Education, Science, Sports and Culture, Japan, and
by grants from the Sagawa Cancer Research Foundation (to H. I.). 
2 To whom requests for reprints should be
addressed, at Second Department of Pathology, Miyazaki Medical College,
5200 Kihara, Kiyotake, Miyazaki 889-1692, Japan. Phone: 81-985-85-2809;
Fax: 81-985-85-6003; E-mail: mejina{at}post.miyazaki-med.ac.jp
3 The abbreviations used are: HGF, hepatocyte
growth factor; SF, scatter factor; scHGF, single-chain HGF
(latent form); HGFA, HGF activator; HAI-1, HGFA inhibitor type 1; uPA,
urokinase-type plasminogen activator; T:N, tumor:normal ratio; CHAPS,
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; VEGF,
vascular endothelial growth factor; CHO, Chinese hamster ovary; SFCM,
serum-free culture conditioned medium; RT-PCR, reverse
transcription-PCR; G3PDH, glyceraldehyde-3-phosphate dehydrogenase.
Received 2/14/00. Accepted 8/29/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. Nakamura, F. Abarzua, A. Hongo, J. Kodama, Y. Nasu, H. Kumon, and Y. Hiramatsu Hepatocyte growth factor activator inhibitor-2 (HAI-2) is a favorable prognosis marker and inhibits cell growth through the apoptotic pathway in cervical cancer Ann. Onc., January 1, 2009; 20(1): 63 - 70. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Marchand-Adam, A. Fabre, A. A. Mailleux, J. Marchal, C. Quesnel, H. Kataoka, M. Aubier, M. Dehoux, P. Soler, and B. Crestani Defect of Pro-Hepatocyte Growth Factor Activation by Fibroblasts in Idiopathic Pulmonary Fibrosis Am. J. Respir. Crit. Care Med., July 1, 2006; 174(1): 58 - 66. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Saleem, V. M. Adhami, W. Zhong, B. J. Longley, C.-Y. Lin, R. B. Dickson, S. Reagan-Shaw, D. F. Jarrard, and H. Mukhtar A novel biomarker for staging human prostate adenocarcinoma: overexpression of matriptase with concomitant loss of its inhibitor, hepatocyte growth factor activator inhibitor-1. Cancer Epidemiol. Biomarkers Prev., February 1, 2006; 15(2): 217 - 227. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P. M. Tjin, R. W. J. Groen, I. Vogelzang, P. W. B. Derksen, M. D. Klok, H. P. Meijer, S. van Eeden, S. T. Pals, and M. Spaargaren Functional analysis of HGF/MET signaling and aberrant HGF-activator expression in diffuse large B-cell lymphoma Blood, January 15, 2006; 107(2): 760 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Fan, T. D. Wu, W. Li, and D. Kirchhofer Identification of Hepatocyte Growth Factor Activator Inhibitor-1B as a Potential Physiological Inhibitor of Prostasin J. Biol. Chem., October 14, 2005; 280(41): 34513 - 34520. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P. M. Tjin, R. J. Bende, P. W. B. Derksen, A.-P. van Huijstee, H. Kataoka, M. Spaargaren, and S. T. Pals Follicular Dendritic Cells Catalyze Hepatocyte Growth Factor (HGF) Activation in the Germinal Center Microenvironment by Secreting the Serine Protease HGF Activator J. Immunol., September 1, 2005; 175(5): 2807 - 2813. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Tanaka, K. Nagaike, N. Takeda, H. Itoh, K. Kohama, T. Fukushima, S. Miyata, S. Uchiyama, S. Uchinokura, T. Shimomura, et al. Hepatocyte Growth Factor Activator Inhibitor Type 1 (HAI-1) Is Required for Branching Morphogenesis in the Chorioallantoic Placenta Mol. Cell. Biol., July 1, 2005; 25(13): 5687 - 5698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. S. Knudsen, J. M. Lucas, L. Fazli, S. Hawley, S. Falcon, I. M. Coleman, D. B. Martin, C. Xu, L. D. True, M. E. Gleave, et al. Regulation of Hepatocyte Activator Inhibitor-1 Expression by Androgen and Oncogenic Transformation in the Prostate Am. J. Pathol., July 1, 2005; 167(1): 255 - 266. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. P.M. Tjin, P. W.B. Derksen, H. Kataoka, M. Spaargaren, and S. T. Pals Multiple myeloma cells catalyze hepatocyte growth factor (HGF) activation by secreting the serine protease HGF-activator Blood, October 1, 2004; 104(7): 2172 - 2175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Tahara, A. Ido, S. Yamamoto, Y. Miyata, H. Uto, T. Hori, K. Hayashi, and H. Tsubouchi Hepatocyte Growth Factor Facilitates Colonic Mucosal Repair in Experimental Ulcerative Colitis in Rats J. Pharmacol. Exp. Ther., October 1, 2003; 307(1): 146 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Kirchhofer, M. Peek, W. Li, J. Stamos, C. Eigenbrot, S. Kadkhodayan, J. M. Elliott, R. T. Corpuz, R. A. Lazarus, and P. Moran Tissue Expression, Protease Specificity, and Kunitz Domain Functions of Hepatocyte Growth Factor Activator Inhibitor-1B (HAI-1B), a New Splice Variant of HAI-1 J. Biol. Chem., September 19, 2003; 278(38): 36341 - 36349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Y. Kang, M. Dolled-Filhart, I. T. Ocal, B. Singh, C.-Y. Lin, R. B. Dickson, D. L. Rimm, and R. L. Camp Tissue Microarray Analysis of Hepatocyte Growth Factor/Met Pathway Components Reveals a Role for Met, Matriptase, and Hepatocyte Growth Factor Activator Inhibitor 1 in the Progression of Node-negative Breast Cancer Cancer Res., March 1, 2003; 63(5): 1101 - 1105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Peek, P. Moran, N. Mendoza, D. Wickramasinghe, and D. Kirchhofer Unusual Proteolytic Activation of Pro-hepatocyte Growth Factor by Plasma Kallikrein and Coagulation Factor XIa J. Biol. Chem., November 27, 2002; 277(49): 47804 - 47809. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Oberst, M. D. Johnson, R. B. Dickson, C.-Y. Lin, B. Singh, M. Stewart, A. Williams, A. al-Nafussi, J. F. Smyth, H. Gabra, et al. Expression of the Serine Protease Matriptase and Its Inhibitor HAI-1 in Epithelial Ovarian Cancer: Correlation with Clinical Outcome and Tumor Clinicopathological Parameters Clin. Cancer Res., April 1, 2002; 8(4): 1101 - 1107. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
