Cancer Research Grants  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, H.
Right arrow Articles by Zhan, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, H.
Right arrow Articles by Zhan, Q.
[Cancer Research 60, 6276-6280, November 15, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Activation of the Transcription Factor Oct-1 in Response to DNA Damage

Hongcheng Zhao, Shunqian Jin, Feiyue Fan, Wenhong Fan, Tong Tong and Qimin Zhan1

Department of Radiation Oncology, Pittsburgh Cancer Institute, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Mammalian cells exhibit complex cellular responses to genotoxic stress, including cell cycle checkpoint, DNA repair, and apoptosis. Inactivation of these important biological events will result in genomic instability and cell transformation. It has been demonstrated that gene activation is a critical initial step during the cellular response to DNA damage. A number of investigations have shown that transcription factors are involved in the regulation of stress-inducible genes. These transcription factors include p53, c-Myc, and AP-1 (c-fos and c-jun). However, the role for the octamer-binding transcription factor Oct-1 in the DNA damage-activated response is unknown. In this report, we have presented the novel observation that the transcription factor Oct-1 is induced after cells are exposed to multiple DNA-damaging agents and therapeutic agents, including UV radiation, methylmethane sulfonate, ionizing radiation, etoposide, cisplatin, and camptothecin. The induction of the Oct-1 protein is mediated through a posttranscriptional mechanism and does not require the normal cellular function of the tumor suppressor p53, indicating that the Oct-1 protein, as a transcription factor, may play a role in p53-independent gene activation. In addition to increased protein level, the activity of Oct-1 DNA binding to its specific consensus sequence is also enhanced by DNA damage. Therefore, these results have implicated that the transcription factor Oct-1 might participate in cellular response to DNA damage, particularly in p53-independent gene activation.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
It has been well accepted that exposure to DNA damage contributes to the development of many human tumors. Therefore, much effort has been focused on understanding how cells respond to DNA damage and maintain both genomic integrity and chromatin structure. Several important biological events, such as cell cycle growth arrest (1 , 2) , apoptosis (3) , and DNA repair (4 , 5) , are thought to be critical when cells are exposed to DNA damaging agents such as IR,2 UV radiation, and alkylating agents. Inactivation of these biological events may result in genomic instability and malignant cell transformation.

Throughout their lives, cells suffer from both endogenous and exogenous sources of DNA-damaging agents. For example, free radicals and peroxides generated during the normal physiological processes or inflammation constitute a source of endogenous DNA-damaging agents. Exposure to numerous chemical and physical agents from the environment is the exogenous source. To a great extent, cellular responses after DNA damage will initially include the induction of the stress-inducible genes. However, gene induction, as a result of exposure to adverse conditions, is dependent on the nature of the stress. Oxidative stress, heat stress, and DNA damage induce different sets of genes that are particular for each type of stress, but some of these genes can also be induced by more than one agent (6 , 7) . In both bacteria and eukaryotes, induction of genes involved in cell growth delay or cell cycle checkpoint is a common response to DNA damage (2) .

Transcription factor genes are of particular interest in cellular response to DNA damage (8 , 9) . Activation of transcription factors by DNA damage will directly enhance the transcription of their downstream genes, which may exert biological functions in cellular response. Among these transcription factors, p53, c-Myc, and AP-1 (c-jun and c-fos) are well characterized as playing important roles in the control of cell cycle checkpoint, apoptosis, and signaling pathways (2 , 10, 11, 12, 13) . In the case of p53, it is induced by a variety of DNA-damaging agents through a posttranscriptional mechanism (1) . The activated p53 will in turn transactivate its targeted genes such as p21/WAF1 (14) , GADD45 (2 , 15) , and BAX (16 , 17) . Those p53-targeted genes are thought to mediate the biological roles of p53 as a tumor suppressor. Cells lacking normal cellular p53 function usually display deficient cellular responses to DNA damage, including abrogated cell cycle checkpoint, impaired DNA repair, and deregulated apoptosis.

The transcription factor Oct-1 is a member of the POU homeodomain family and ubiquitously expressed. This protein binds to the specific-octamer sequence (ATGCAAAT) and plays an important role in activating the transcription of various genes that contain an Oct-1 binding motif (18, 19, 20, 21) . These genes include the histone H2B (22 , 23) , immunoglobulin genes in B cells (24 , 25) , small nuclear RNA gene (26) , TIF2 gene (27) , and GnRH gene (28) . Oct-1 can also negatively regulate certain genes, such as the von Willebrand factor (29) and vascular cell adhesion molecule (30) . In addition to its direct binding to the specific motif, in some cases, Oct-1 gene regulation requires cofactors that interact with the DNA binding (POU) domain. For example, MAT1, a subunit of cyclin-dependent kinase activating kinase, directly binds to the POU domain of Oct-1 and, consequently, enhances its phosphorylation by cyclin-dependent kinase activating kinase (31) . It has been shown that Oct-1 DNA-binding specificity is regulated by protein kinase A, protein kinase C, and casein kinase 2 (32) . The phosphorylation of the Oct-1 protein appears to be cell cycle regulated (33) . However, little is known about the roles of the transcription factor Oct-1 in the cellular response to genotoxic stress. In the present study, we have reported that Oct-1 protein is induced in a p53-independent manner after cells are treated with multiple DNA-damaging agents and therapeutic agents. Importantly, the Oct-1 DNA binding activity, as demonstrated by the EMSA, is significantly induced by DNA-damaging agents. These results indicate that Oct-1 may be an important player in the cellular responses to genotoxic stress.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cell Culture and Treatment.
The human lung carcinoma cell line H1299, colorectal carcinoma line HCT116, breast carcinoma line MCF-7, and cervical carcinoma line HeLa were grown in F-12 medium supplemented with 10% fetal bovine serum. For MMS treatment, cells were exposed in medium to MMS (Aldrich) at 100 µg/ml for 4 h, and then the medium was replaced with fresh medium. Cells were then collected at the indicated time points. For UV radiation, cells in 100-mm dishes were rinsed with PBS and irradiated to a dose of 10 Jm-2. For IR, cells were {gamma}-irradiated with a 137Cs source at 5 Gy/min. In the case of therapeutic agents, cells were treated with 0.4 µM etoposide, 4 µM cisplatin, 4 mM hydroxyurea, and 1 µM camptothecin for 8 h, and the medium was replaced with fresh medium lacking those agents.

Cellular Protein Preparation and Western Blotting Assay.
After treatment with DNA-damaging agents, cells were rinsed with PBS and lysed in PBS containing100 µg/ml phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 2 µg/ml leupeptin, and 1% NP40 (lysis buffer). Lysates were collected by scraping and cleared by centrifugation at 4°C. For Western blotting analysis, 100 µg of cellular lysates were loaded onto 8% SDS-PAGE gels and transferred to Immobilon membranes. Membranes were blocked for 1 h at room temperature in 5% milk, washed with PBST (PBS with 0.1% Tween), and incubated with anti-Oct-1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 2 h. Membranes were washed four times in PBST, and horseradish peroxidase-conjugated antirabbit antibody was added at 1:4000 in 5% milk. After 1 h, membranes were washed and detected by ECL (Amersham, Arlington Heights, IL) and exposed to X-ray film (34) . The estimated bands were scanned using an ImageQuant analyzer (Molecular Dynamics, Sunnyvale, CA) for the measurement of density.

RT-PCR.
Total RNA was isolated using RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol. RT-PCR was done using the RNA PCR Core kit (Perkin Elmer Corp.). Total RNA (0.5 µg) in 1 µl of RNase-free water was used in 20 µl of RT mix containing 4 µl of 25 mM MgCl2, 2 µl of 10x PCR buffer, 2 µl of diethyl pyrocarbonate water, 8 µl of dNTP mix (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 µl of RNase inhibitor (20 units/µl), 1 µl of Random Hexamers (50 µM), and 1 µl of murine leukemia virus reverse transcriptase (50 units/µl). The mixture was subjected to cDNA synthesis using the GeneAmp PCR System 9600 (Perkin Elmer Corp.). Ten µl of cDNA product were added to 40 µl of PCR mix containing 2 µl of 25 mM MgCl2, 4 µl of 10x PCR buffer, 3 µl of dNTP mix (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 28.5 µl of sterile distilled water, 0.5 µl of Taq DNA polymerase (5 units/µl), and 2 µl of 1:1 primer mix (30 µM each of upstream and downstream primers). The mixture was subjected to DNA amplification using the GeneAmp PCR System 9600 (Perkin Elmer Corp.). Finally, 30 µl of PCR products were loaded on 1% agarose gel for analysis. The primers used to amplify Oct-1, Gadd45, and ß-actin were designed as follows: Oct-1, 5' primer GCAACACAGGCACACAAACC and 3' primer TTGGCTTTGCTGAGGTAGTT; Gadd45, 5' primer GGAATTCCATATGGGGCGACCTGCAGTTTGC and 3' primer TAGCGCACATATGCAATTTGGTTCAGTTATT; and ß-actin, 5' primer GCGGGAAATCGTGCGTGACATT.

EMSA.
Nuclear extracts were prepared, and an EMSA was carried out as described previously (35) . DNA binding reactions were performed for 15 min at room temperature in a binding buffer containing 20 mM HEPES (pH 7.8), 150 mM NaCl, 1 mM DTT, 1 µg of poly(deoxyinosinic-deoxycytidylic acid), 10% glycerol, 20 µg of nuclear protein, and 4 x 104 dpm of labeled probe. The probe was a 30-mer double-stranded synthetic oligo containing the intact or mutated Oct-1 consensus sequence. Each strand was labeled separately, and the strands were annealed and then purified using a G-25 column. The samples were analyzed on a 4% nondenaturing acrylamide gel (35) .


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Induction of Oct-1 Protein after DNA Damage.
A number of observations have implicated that many transcription factors play important roles in the important biological events after cells are exposed to DNA-damaging agents. To investigate whether the transcription factor Oct-1 participates in the cellular response to genotoxic response, a panel of human cell lines including H1299 (lung carcinoma), HeLa (cervical carcinoma), HCT116 (colorectal carcinoma), and MCF-7 (breast carcinoma) were treated with the DNA base-damaging agent MMS. Cells were collected at 4 and 8 h after treatment and analyzed for the expression of Oct-1 protein. As shown in Fig. 1ACitation , after exposure to 100 µg of MMS, the levels of Oct-1 protein were substantially elevated in all cell lines tested. In contrast to the untreated cells, induction of Oct-1 protein was seen between 5–8-fold among the cell lines. As a control, detection of the actin protein was included, and it showed no evident change. Obviously, the MMS induction of Oct-1 protein does not require normal cellular function of the tumor suppressor p53, because the induction was seen in the cell lines with disrupted p53, such as H1299, where p53 gene is deleted, and HeLa that contains HPVE6 protein, an inhibitor of p53.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Induction of Oct-1 protein in human cells after DNA-damaging agents and therapeutic agents. A, human cell lines were exposed to 100 µg/ml MMS. Cells were harvested at 4 and 8 h after treatment, and cellular proteins were prepared as described in "Materials and Methods." One hundred µg of total cell protein were loaded onto 8% SDS polyacrylamide gels. After electrophoresis, the proteins were transferred to Immobilon membranes. Membranes were then blocked for 1 h in 5% milk at room temperature. Measurement of Oct-1 protein was performed with anti-Oct-1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Immunoreaction was revealed using chemiluminescence detection procedure. As a loading control (C), detection of actin protein was included. Only visualized bands are shown; their estimated sizes were Mr 97,000 for Oct-1 and Mr 43,000 for actin. B, human H1299 cells were treated with different DNA-damaging agents or medium starvation (G0), including MMS (100 µg/ml), UV radiation (10 J/m-2), IR (20 Gy), camptothecin (1 µM), hydroxyurea (4 mM), cisplatin (4 µM), and etoposide (0.4 µM). Eight h later, cells were harvested for Oct-1 detection as in A. C, quantitative results of Oct-1 protein expression are from B. All experiments were performed at least three times. The results of the representative experiment are shown; bars, SE.

 
Next, we examined the induction of Oct-1 protein in cells treated with different genotoxic stresses, including IR (20 Gy), UV radiation (10 Jm-2), medium starvation (G0) ,and therapeutic agents (1 µM camptothecin, 4 µM cisplatin, and 0.4 µM etoposide). As shown in Fig. 1, B and CCitation , most of the genotoxic agents were shown to induce the expression of Oct-1 protein except for camptothecin. Among the DNA-damaging agents tested, DNA base-damaging agents, UV radiation, and MMS generated a more appreciable induction of Oct-1 protein. In contrast, ionizing radiation that produces DNA stand breaks induced Oct-1 weakly. Interestingly, medium starvation (G0), which does not produce typical DNA damage, also exhibited evident induction for this protein. Taken together, these results indicate that the transcription factor Oct-1 is induced in a p53-independent manner after cell exposure to genotoxic stress.

The duration of Oct-1 induction was next measured in both H1299 and HCT116 cell lines after treatment with 100 µg/ml of MMS (Fig. 2, A and B)Citation . Induction was rapid and transient. The induced level of Oct-1 protein was seen 30 min after treatment. The induction peaked at 8 h (HCT116) or 12 h (H1299) after cell exposure to MMS and returned to normal level by 24 h. In addition, an analysis was carried out to examine the Oct-1 induction by different MMS doses. An appreciable increase in Oct-1 protein level was seen with the dose as low as 20 µg/ml, which produces little lethality. The magnitude of Oct-1 induction was approximately proportional to the dose and reached maximal induction with 100 µg/ml of MMS (results not shown). These results demonstrate that Oct-1 induction after DNA damage is a rapid, sensitive, and transient response, suggesting that Oct-1 may be well involved in some cellular response to genotoxic stress.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Time course of Oct-1 protein expression in human H1299 and HCT116 cells after MMS treatment. Cells were treated with 100 µg/ml MMS for 4 h and then collected at the indicated time points. Whole-cell protein was prepared and analyzed for Oct-1 expression as described in Fig. 1Citation . C, control. The results of a representative experiment are shown in A, and quantitative analysis for the results of three separate experiments is shown in B. The results in B are normalized to that of the control sample.

 
Induction of Oct-1 Protein Is through a Posttranscriptional Mechanism.
Additional experiments were performed to determine the mechanism by which DNA-damaging agents activate Oct-1 protein expression. To do this, the levels of OCT-1 transcripts after DNA damage were measured using an RT-PCR approach. Surprisingly, OCT-1 mRNA was not seen to be elevated after DNA damage. As shown in Fig. 3ACitation , H1299 cells were exposed to MMS and collected at the indicated time for RT-PCR analysis. Expression of OCT-1 mRNA at all time points remained similar after MMS treatment. As a positive control, we included the analysis of GADD45 expression in the same experiments. Consistent with our previous reports (11 , 36) , GADD45 mRNA was observed to increase >3-fold. To ensure that equal amounts of mRNA were used and equal amounts of PCR products were loaded, ß-actin was included in the experiments. These results indicated that induction of Oct-1 protein might be through a posttranscriptional mechanism. We next analyzed Oct-1 protein expression in the presence of actinomycin D, an inhibitor of RNA synthesis. In this experiment, actinomycin D was added at a concentration of 1 µg/ml into tissue culture, whereas cells were exposed to MMS. In Fig. 3BCitation , addition of actinomycin D did not reduce the expression of Oct-1 protein, suggesting that induction of Oct-1 protein not require new RNA synthesis. In contrast, actinomycin D was shown to significantly abrogate induction of Gadd45 protein. Taken together with the results in Fig. 3ACitation , it can be concluded that induction of Oct-1 is mediated via the posttranscriptional mechanism.



View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Induction of Oct-1 protein is mediated through a posttranscription mechanism. A, 0.5 µg of total RNA from cells treated with MMS was used in 20 µl of reverse transcriptase mixture containing 4 µl of 25 mM MgCl2, 2 µl of 10x PCR buffer, 2 µl of diethyl pyrocarbonate water, 8 µl of dNTP, 1 µl of RNase inhibitor (20 units/µl), 1 µl of Random Hexamers (50 µM), and 1 µl of murine leukemia virus reverse transcriptase (50 units/µl). After reverse transcription, 10 µl of cDNA products were added to 40 µl of PCR mixture containing 2 µl of 25 mM MgCl2, 4 µl of 10x PCR Buffer, 3 µl of dNTP mix, 0.5 µl of Taq DNA polymerase, and 2 µl of 1:1 primer mix (30 µM each of upstream and downstream primer). The mixture was subjected to DNA amplification using GeneAmp PCR System 9600. Finally, 30 µl of PCR products were loaded on 1% agarose gel for analysis. C, control. B, human colorectal carcinoma HCT116 cells were treated with MMS (100 µg/ml). Meanwhile, actinomycin D (ActD) was added to the cell culture medium at a final concentration of 1 µg/ml. Cells were collected at the indicated time for analysis of Oct-1 protein expression. Each experiment was repeated more than three times, and only the representative one was shown in this figure. The variability of results from each independent experiment was seen <25%. C, control.

 
DNA Damage Activates Oct-1 DNA Binding Affinity.
Oct-1 is a DNA-binding transcription factor with a specific DNA binding motif (18 , 19) . To examine whether DNA damage enhances the Oct-1 DNA-binding ability, the EMSA was used. A 30-bp, double-stranded oligo DNA that harbors a typical Oct-1 consensus sequence (ATGCAAAT) was synthesized and labeled with [{gamma}-32P]ATP. The labeled oligos were incubated with the nuclear extracts from H1299 cells treated with MMS. In Fig. 4, A and BCitation , we detected several DNA-protein complexes by EMSA. A prominent slowly migrating band was seen, but it disappeared when the Oct-1 motif was mutated, indicating that this DNA-protein complex is associated with the Oct-1 consensus sequence. In agreement with the evidence that MMS strongly induces the Oct-1 protein expression, the Oct-1 binding affinity was dramatically enhanced by MMS treatment. The enhanced DNA binding of Oct-1 was observed with the nuclear extracts from MMS-treated H1299 cells isolated at 1, 4, 8, 12, 16, and 24 h after treatment. At 32 h after treatment, the increased binding affinity was reduced to the basal level. To further demonstrate that this protein-DNA complex was specific for Oct-1, a competition experiment with an unlabeled oligo containing an Oct-1 binding site was conducted. In Fig. 4CCitation , this prominent band was effectively competed by unlabeled self sequence (WT), whereas the oligo with mutated Oct-1 site did not compete this complex. To examine whether the Oct-1 is directly involved in this DNA-protein complex, we performed supershift experiments. In the presence of the antibody against Oct-1, a higher supershifted band was observed (Fig. 4DCitation , top arrow). In contrast, nonspecific antibodies (IgG, p53 antibody, and cyclin D1 antibody) did not generate the supershift band. These results demonstrate that the DNA damage-inducible complex that specifically binds to the Oct-1 motif contains Oct-1 protein, and that the Oct-1 DNA-binding activity is enhanced after DNA damage.



View larger version (78K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. EMSAs with DNA containing the Oct-1 binding site. A, the 30-bp oligo probe containing the Oct-1 binding site was incubated with the nuclear extracts isolated from the human H1299 cells. The nuclear extracts were prepared from untreated cells (Control) or cells treated with MMS. Cells were collected at the indicated time points. B, nuclear extracts from H1299 cells treated with MMS were incubated with oligo containing the intact Oct-1 binding site (WT) or with one containing mutated Oct-1 site (Mutant). C, EMSAs were performed in the presence of the indicated amounts of unlabeled oligo containing the intact Oct-1 consensus sequence (WT) or oligo containing the mutated Oct-1 site (Mutant). D, EMSAs were performed in the same manner in the presence of the antibodies against Oct-1, p53, cyclin D1, and IgG. These experiments were performed at least three times, and the representative results are shown. Ab, antibody.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
In summary, we have presented novel observations that the transcription factor Oct-1 may participate in cellular response to genotoxic stress. After DNA damage treatment, levels of Oct-1 protein are elevated in multiple human cell lines. Evident induction of Oct-1 protein can be detected as early as 0.5 h after treatment. The maximal level of Oct-1 was observed at 8 or 12 h and returned to normal at 24 h. The induction of Oct-1 protein does not require the tumor suppressor p53, because cells with disrupted p53 still exhibited a strong induction of Oct-1. Interestingly, induction of Oct-1 protein is mediated through a posttranscriptional mechanism because there was no induction of OCT-1 mRNA in response to DNA damage, and addition of actinomycin D, an inhibitor of RNA synthesis, had no effect on the induction of Oct-1 protein. More importantly, the affinity of Oct-1 binding to its consensus sequence (ATGCAAAT) was highly enhanced after DNA damage. These results have implicated that the activation of Oct-1, as manifested by both induction of protein level and enhanced DNA binding affinity, may play roles in cellular responses to genotoxic stress.

Mammalian cells demonstrate complex cellular responses to DNA damage, including activation of genes involved in cell cycle arrest (2) , DNA repair (37 , 38) , and apoptosis (3) . It is important to determine how the transcription factors are modified in DNA-damaged cells and whether these modifications are necessary intermediates in the DNA damage-induced activation of genes. The results presented in this report demonstrate evidence that the octamer transcription factor Oct-1 is activated and might be one of the important players in gene activation by DNA damage. As discussed earlier, Oct-1 protein is ubiquitously expressed and involved in the regulation of various genes, which function in the development of multiple organs and tissues (27 , 33) , the control of cell cycle progression (33) , and the regulation of signaling pathways as well (39 , 40) . However, despite its demonstrated biological functions, the role of Oct-1 protein in the regulation of stress-inducible genes after DNA damage remains unclear. It can be expected that after genotoxic stress, activated Oct-1 protein would be able to bind to the octamer-containing promoters of DNA damage-responsive genes and in turn exert its regulatory function. Graunke et al. (41) has reported that a DNA-protein interaction at the octamer binding motif is identified in the promoter of the GADD45 gene, using in vivo DNase I hypersensitivity analysis. The GADD45 gene is transcriptionally up-regulated after DNA-damaging agents (IR, UV radiation, and alkylating agents) and has been suggested to coordinate cell cycle regulation and DNA repair (34 , 42 , 43) . Interestingly, we have found recently that the octamer-binding motif is involved in the regulation of GADD45 induction in response to certain DNA-damaging agents. Disruption of the Oct-1 binding site located at the GADD45 promoter attenuated the induction of GADD45 by DNA damage.3 Therefore, the finding that the transcription factor Oct-1 is activated by DNA damage has extended the physiological roles of Oct-1 protein to the cellular response after genotoxic stress.

The tumor suppressor p53 plays an important role in cellular response to DNA damage through the regulation of its downstream genes like p21 and GADD45 (2 , 14) . In the case of the GADD45 gene, p53 is required for its IR induction (15) , but the induction of GADD45 by UV or MMS does not require normal cellular p53 function, although p53 can contribute to these responses (36) . Most likely, Oct-1 may play a role in the p53-independent cellular response to DNA damage. Therefore, it can be assumed that after DNA damage, Oct-1 protein may delicately coordinate with some other gene regulators to ensure the establishment of cellular defense network under the circumstance of genotoxic stress. However, future studies are required to investigate how Oct-1 regulates its targeted genes that are activated when cells are exposed to DNA damage. In fact, in addition to its induction of both protein level and binding activity, Oct-1 may also need to interact with cofactors or posttranslational modification such as phosphorylation or acetylation. In conclusion, we have found that the transcription factor Oct-1 is strongly induced after multiple DNA-damaging agents and therapeutic agents in a p53-independent manner. In agreement with the protein induction, Oct-1 DNA binding activity is also enhanced by DNA damage. These findings provide insight into the biological roles of Oct-1 in cellular response to genotoxic stress, particularly in the p53-independent gene activation.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Pittsburgh Cancer Institute, University of Pittsburgh School of Medicine, BST W-945, 200 Lothrop Street, Pittsburgh, PA 15213. Phone: (412) 648-8630; Fax: (412) 624-0295; E-mail: qzhan{at}pitt.edu Back

2 The abbreviations used are: IR, ionizing radiation; EMSA, electrophoretic mobility shift assay; MMS, methylmethane sulfonate; RT-PCR, reverse transcription-PCR; dNTP, deoxynucleotide triphosphate; oligo, oligonucleotide. Back

3 Submitted for publication. Back

Received 3/24/00. Accepted 10/ 3/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Kastan M. B., Onyekwere O., Sidransky D., Vogelstein B., Craig R. W. Participation of p53 protein in the cellular response to DNA damage. Cancer Res., 51: 6304-6311, 1991.[Abstract/Free Full Text]
  2. Kastan M. B., Zhan Q., el-Deiry W. S., Carrier F., Jacks T., Walsh W. V., Plunkett B. S., Vogelstein B., Fornace A. J., Jr. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell, 71: 587-597, 1992.[Medline]
  3. White E. Life, death, and the pursuit of apoptosis. Genes Dev., 10: 1-15, 1996.[Free Full Text]
  4. Schmutte C., Fishel R. Genomic instability: first step to carcinogenesis. Anticancer Res., 19: 4665-4696, 1999.[Medline]
  5. Rajanbabu R., Patarca R. DNA replication and cancer. Crit. Rev. Oncog., 10: 275-291, 1999.[Medline]
  6. Holbrook N. J., Liu Y., Fornace A. J., Jr. Signaling events controlling the molecular response to genotoxic stress. Exper. Suppl. (Basel), 77: 273-288, 1996.
  7. Fornace A. J., Jr., Jackman J., Hollander M. C., Hoffman-Liebermann B., Liebermann D. A. Genotoxic-stress-response genes and growth-arrest genes gadd, MyD, and other genes induced by treatments eliciting growth arrest. Ann. NY Acad. Sci., 663: 139-153, 1992.[Medline]
  8. Kramer M., Stein B., Mai S., Kunz E., Konig H., Loferer H., Grunicke H. H., Ponta H., Herrlich P., Rahmsdorf H. J. Radiation-induced activation of transcription factors in mammalian cells. Radiat. Environ. Biophys., 29: 303-313, 1990.[Medline]
  9. Papathanasiou M. A., Fornace A. J., Jr. DNA-damage inducible genes. Cancer Treat. Res., 57: 13-36, 1991.[Medline]
  10. Amundson S. A., Zhan Q., Penn L. Z., Fornace A. J., Jr. Myc suppresses induction of the growth arrest genes gadd34, gadd45, and gadd153 by DNA-damaging agents. Oncogene, 17: 2149-2154, 1998.[Medline]
  11. Hollander M. C., Fornace A. J., Jr. Induction of fos RNA by DNA-damaging agents. Cancer Res., 49: 1687-1692, 1989.[Abstract/Free Full Text]
  12. Ghosh R., Amstad P., Cerutti P. UVB-induced DNA breaks interfere with transcriptional induction of c-fos. Mol. Cell. Biol., 13: 6992-6999, 1993.[Abstract/Free Full Text]
  13. Manome Y., Datta R., Taneja N., Shafman T., Bump E., Hass R., Weichselbaum R., Kufe D. Coinduction of c-jun gene expression and internucleosomal DNA fragmentation by ionizing radiation. Biochemistry, 32: 10607-10613, 1993.[Medline]
  14. el-Deiry W. S., Tokino T., Velculescu V. E., Levy D. B., Parsons R., Trent J. M., Lin D., Mercer W. E., Kinzler K. W., Vogelstein B. WAF1, a potential mediator of p53 tumor suppression. Cell, 75: 817-825, 1993.[Medline]
  15. Zhan Q., Bae I., Kastan M. B., Fornace A. J., Jr. The p53-dependent {gamma}-ray response of GADD45. Cancer Res., 54: 2755-2760, 1994.[Abstract/Free Full Text]
  16. Zhan, Q., Fan, S., Bae, I., Guillouf, C., Liebermann, D. A., O’Connor, P. M., and Fornace, A. J., Jr. Induction of bax by genotoxic stress in human cells correlates with normal p53 status and apoptosis [published erratum appears in Oncogene, 10: 1259, 1995]. Oncogene, 9: 3743–3751, 1994.
  17. Miyashita T., Reed J. C. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell, 80: 293-299, 1995.[Medline]
  18. Sturm R. A., Herr W. The POU domain is a bipartite DNA-binding structure. Nature (Lond.), 336: 601-604, 1988.[Medline]
  19. Sturm R. A., Das G., Herr W. The ubiquitous octamer-binding protein Oct-1 contains a POU domain with a homeobox subdomain. Genes Dev., 2: 1582-1599, 1988.[Abstract/Free Full Text]
  20. Tanaka, M., Grossniklaus, U., Herr, W., and Hernandez, N. Activation of the U2 snRNA promoter by the octamer motif defines a new class of RNA polymerase II enhancer elements [published erratum appears in Genes Dev., 3: 584, 1989]. Genes Dev., 2: 1764–1778, 1988.
  21. Tanaka M., Lai J. S., Herr W. Promoter-selective activation domains in Oct-1 and Oct-2 direct differential activation of an snRNA and mRNA promoter. Cell, 68: 755-767, 1992.[Medline]
  22. LaBella F., Sive H. L., Roeder R. G., Heintz N. Cell-cycle regulation of a human histone H2b gene is mediated by the H2b subtype-specific consensus element. Genes Dev., 2: 32-39, 1988.[Abstract/Free Full Text]
  23. Fletcher C., Heintz N., Roeder R. G. Purification and characterization of OTF-1, a transcription factor regulating cell cycle expression of a human histone H2b gene. Cell, 51: 773-781, 1987.[Medline]
  24. Bergman Y., Rice D., Grosschedl R., Baltimore D. Two regulatory elements for immunoglobulin {kappa} light chain gene expression. Proc. Natl. Acad. Sci. USA, 81: 7041-7045, 1984.[Abstract/Free Full Text]
  25. Jenuwein T., Grosschedl R. Complex pattern of immunoglobulin µ gene expression in normal and transgenic mice: nonoverlapping regulatory sequences govern distinct tissue specificities. Genes Dev., 5: 932-943, 1991.[Abstract/Free Full Text]
  26. Murphy S., Pierani A., Scheidereit C., Melli M., Roeder R. G. Purified octamer binding transcription factors stimulate RNA polymerase III-mediated transcription of the 7SK RNA gene. Cell, 59: 1071-1080, 1989.[Medline]
  27. Fadel B. M., Boutet S. C., Quertermous T. Octamer-dependent in vivo expression of the endothelial cell-specific TIE2 gene. J. Biol. Chem., 274: 20376-20383, 1999.[Abstract/Free Full Text]
  28. Eraly S. A., Nelson S. B., Huang K. M., Mellon P. L. Oct-1 binds promoter elements required for transcription of the GnRH gene. Mol. Endocrinol., 12: 469-481, 1998.[Abstract/Free Full Text]
  29. Schwachtgen J. L., Remacle J. E., Janel N., Brys R., Huylebroeck D., Meyer D., Kerbiriou-Nabias D. Oct-1 is involved in the transcriptional repression of the von Willebrand factor gene promoter. Blood, 92: 1247-1258, 1998.[Abstract/Free Full Text]
  30. Iademarco M. F., McQuillan J. J., Rosen G. D., Dean D. C. Characterization of the promoter for vascular cell adhesion molecule-1 (VCAM-1). J. Biol. Chem., 267: 16323-16329, 1992.[Abstract/Free Full Text]
  31. Inamoto S., Segil N., Pan Z. Q., Kimura M., Roeder R. G. The cyclin-dependent kinase-activating kinase (CAK) assembly factor, MAT1, targets and enhances CAK activity on the POU domains of octamer transcription factors. J. Biol. Chem., 272: 29852-29858, 1997.[Abstract/Free Full Text]
  32. Grenfell, S. J., Latchman, D. S., and Thomas, N. S. Oct-1 [corrected] and Oct-2 DNA-binding site specificity is regulated in vitro by different kinases [published erratum appears in Biochem. J., 317: 959, 1996]. Biochem. J., 315: 889–893, 1996.
  33. Roberts S. B., Segil N., Heintz N. Differential phosphorylation of the transcription factor Oct1 during the cell cycle. Science (Washington DC), 253: 1022-1026, 1991.[Abstract/Free Full Text]
  34. Zhan Q., Antinore M. J., Wang X. W., Carrier F., Smith M. L., Harris C. C., Fornace A. J., Jr. Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene, 18: 2892-2900, 1999.[Medline]
  35. Zhan, Q., Chen, I. T., Antinore, M. J., and Fornace, A. J., Jr. Tumor suppressor p53 can participate in transcriptional induction of the GADD45 promoter in the absence of direct DNA binding [published erratum appears in Mol. Cell. Biol., 18: 5620, 1998]. Mol. Cell. Biol., 18: 2768–2778, 1998.
  36. Zhan Q., Fan S., Smith M. L., Bae I., Yu K., Alamo I., Jr., O’Connor P. M., Fornace A. J., Jr. Abrogation of p53 function affects gadd gene responses to DNA base-damaging agents and starvation. DNA Cell Biol., 15: 805-815, 1996.[Medline]
  37. Dasika G. K., Lin S. C., Zhao S., Sung P., Tomkinson A., Lee E. Y. DNA damage-induced cell cycle checkpoints and DNA strand break repair in development and tumorigenesis. Oncogene, 18: 7883-7899, 1999.[Medline]
  38. Venkitaraman A. R. Breast cancer genes and DNA repair. Science (Washington DC), 286: 1100-1102, 1999.[Free Full Text]
  39. Kakizawa T., Miyamoto T., Ichikawa K., Kaneko A., Suzuki S., Hara M., Nagasawa T., Takeda T., Mori J., Kumagai M., Hashizume K. Functional interaction between Oct-1 and retinoid X receptor. J. Biol. Chem., 274: 19103-19108, 1999.[Abstract/Free Full Text]
  40. Prefontaine G. G., Lemieux M. E., Giffin W., Schild-Poulter C., Pope L., LaCasse E., Walker P., Hache R. J. Recruitment of octamer transcription factors to DNA by glucocorticoid receptor. Mol. Cell. Biol., 18: 3416-3430, 1998.[Abstract/Free Full Text]
  41. Graunke D. M., Fornace A. J., Jr., Pieper R. O. Presetting of chromatin structure and transcription factor binding poise the human GADD45 gene for rapid transcriptional up-regulation. Nucleic Acids Res., 27: 3881-3890, 1999.[Abstract/Free Full Text]
  42. Smith M. L., Chen I. T., Zhan Q., Bae I., Chen C. Y., Gilmer T. M., Kastan M. B., O’Connor P. M., Fornace A. J., Jr. Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science (Washington DC), 266: 1376-1380, 1994.[Abstract/Free Full Text]
  43. Wang X. W., Zhan Q., Coursen J. D., Khan M. A., Kontny H. U., Yu L., Hollander M. C., O’Connor P. M., Fornace A. J., Jr., Harris C. C. GADD45 induction of a G2/M cell cycle checkpoint. Proc. Natl. Acad. Sci. USA, 96: 3706-3711, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Genes Dev.Home page
J. Kang, M. Gemberling, M. Nakamura, F. G. Whitby, H. Handa, W. G. Fairbrother, and D. Tantin
A general mechanism for transcription regulation by Oct1 and Oct4 in response to genotoxic and oxidative stress
Genes & Dev., January 15, 2009; 23(2): 208 - 222.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
R. C. Fry, J. P. Svensson, C. Valiathan, E. Wang, B. J. Hogan, S. Bhattacharya, J. M. Bugni, C. A. Whittaker, and L. D. Samson
Genomic predictors of interindividual differences in response to DNA damaging agents
Genes & Dev., October 1, 2008; 22(19): 2621 - 2626.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
C. Zhou, Y. Tong, K. Wawrowsky, S. Bannykh, I. Donangelo, and S. Melmed
Oct-1 induces pituitary tumor transforming gene expression in endocrine tumors
Endocr. Relat. Cancer, September 1, 2008; 15(3): 817 - 831.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Thum and J. Borlak
LOX-1 Receptor Blockade Abrogates oxLDL-induced Oxidative DNA Damage and Prevents Activation of the Transcriptional Repressor Oct-1 in Human Coronary Arterial Endothelium
J. Biol. Chem., July 11, 2008; 283(28): 19456 - 19464.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Yaar, C. Wu, H.-Y. Park, I. Panova, G. Schutz, and B. A. Gilchrest
Bone Morphogenetic Protein-4, a Novel Modulator of Melanogenesis
J. Biol. Chem., September 1, 2006; 281(35): 25307 - 25314.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Tantin, C. Schild-Poulter, V. Wang, R. J.G. Hache, and P. A. Sharp
The Octamer Binding Transcription Factor Oct-1 Is a Stress Sensor
Cancer Res., December 1, 2005; 65(23): 10750 - 10758.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Mesplede, M.-L. Island, N. Christeff, F. Petek, J. Doly, and S. Navarro
The POU Transcription Factor Oct-1 Represses Virus-Induced Interferon A Gene Expression
Mol. Cell. Biol., October 1, 2005; 25(19): 8717 - 8731.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. E. Lilley, C. T. Carson, A. R. Muotri, F. H. Gage, and M. D. Weitzman
DNA repair proteins affect the lifecycle of herpes simplex virus 1
PNAS, April 19, 2005; 102(16): 5844 - 5849.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. L. Nogueira, V. E. H. Wang, D. Tantin, P. A. Sharp, and T. M. Kristie
Herpes simplex virus infections are arrested in Oct-1-deficient cells
PNAS, February 10, 2004; 101(6): 1473 - 1478.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Schild-Poulter, A. Shih, N. C. Yarymowich, and R. J. G. Hache
Down-Regulation of Histone H2B by DNA-Dependent Protein Kinase in Response to DNA Damage through Modulation of Octamer Transcription Factor 1
Cancer Res., November 1, 2003; 63(21): 7197 - 7205.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. Bruemmer, F. Yin, J. Liu, J. P. Berger, T. Sakai, F. Blaschke, E. Fleck, A. J. Van Herle, B. M. Forman, and R. E. Law
Regulation of the Growth Arrest and DNA Damage-Inducible Gene 45 (GADD45) by Peroxisome Proliferator-Activated Receptor {gamma} in Vascular Smooth Muscle Cells
Circ. Res., August 22, 2003; 93 (4): e38 - e47.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
H.-F. Yam, A. K.-H. Kwok, K.-P. Chan, T. Y.-Y. Lai, K.-Y. Chu, D. S.-C. Lam, and C. P. Pang
Effect of Indocyanine Green and Illumination on Gene Expression in Human Retinal Pigment Epithelial Cells
Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 370 - 377.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. H. Wu and B. Y. M. Yung
UV Stimulation of Nucleophosmin/B23 Expression Is an Immediate-early Gene Response Induced by Damaged DNA
J. Biol. Chem., December 6, 2002; 277(50): 48234 - 48240.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Adimoolam and J. M. Ford
p53 and DNA damage-inducible expression of the xeroderma pigmentosum group C gene
PNAS, October 1, 2002; 99(20): 12985 - 12990.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Torigoe, H. Izumi, H. Ishiguchi, H. Uramoto, T. Murakami, T. Ise, Y. Yoshida, M. Tanabe, M. Nomoto, H. Itoh, et al.
Enhanced Expression of the Human Vacuolar H+-ATPase c subunit Gene (ATP6L) in Response to Anticancer Agents
J. Biol. Chem., September 20, 2002; 277(39): 36534 - 36543.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Fan, S. Jin, T. Tong, H. Zhao, F. Fan, M. J. Antinore, B. Rajasekaran, M. Wu, and Q. Zhan
BRCA1 Regulates GADD45 through Its Interactions with the OCT-1 and CAAT Motifs
J. Biol. Chem., March 1, 2002; 277(10): 8061 - 8067.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Schild-Poulter, L. Pope, W. Giffin, J. C. Kochan, J. K. Ngsee, M. Traykova-Andonova, and R. J. G. Hache
The Binding of Ku Antigen to Homeodomain Proteins Promotes Their Phosphorylation by DNA-dependent Protein Kinase
J. Biol. Chem., May 11, 2001; 276(20): 16848 - 16856.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, H.
Right arrow Articles by Zhan, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, H.
Right arrow Articles by Zhan, Q.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online