| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Laboratory of Molecular Oncology and Cell Cycle Regulation [K. O. M., M. S. R., D. T. D., Z. J., W. S. E-D.], Howard Hughes Medical Institute [W. S. E-D.], Departments of Medicine [M. S. R., D. T. D., W. S. E-D.], Genetics [W. S. E-D.], and Pharmacology [W. S. E-D.], University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6148; National Children’s Medical Research Center, Tokyo, Japan 154 [T. M.]; and The Burnham Institute, La Jolla, California 92037 [J. C. R.]
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
Attempts have been made to characterize the cell death machinery involved in c-Myc-induced apoptosis, and it seems that the release of cytochrome c is necessary for c-Myc-induced cell death (7) . Cytochrome c activates the APAF-1/caspase-9 apoptotic pathway (8) . Likewise, caspase-9 and APAF-1 were shown to be necessary for c-Myc-induced apoptosis (9) . Cytochrome c release from the mitochondria is regulated by the binding of Bcl-2 family members to the mitochondria (10 , 11) . The overexpression of antiapoptotic Bcl-2 blocks the mitochondrial release of cytochrome c (12) . Bcl-2 is able to protect c-Myc-overexpressing cells from either serum or glucose deprivation-induced apoptosis (13, 14, 15) . Taken together, these results establish a pathway for c-Myc-induced cell killing from the release of cytochrome c to the activation of caspase activity. However, a mechanism by which c-Myc induces the release of cytochrome has not been established.
Bax is a proapoptotic bcl-2 family member whose apoptotic function is antagonized by bcl-2 expression (16) . Bax inserts into mitochondrial membranes and forms channels for the release of cytochrome c (8 , 17) . These results link bax to the same apoptotic pathway as c-Myc. Indeed, when the human bax gene promoter was first cloned, it was shown to be a p53 primary response gene, but it was also noted to be potentially c-Myc-responsive based on the presence of 4 E-box sequences downstream of the transcriptional start site in the 5'-untranslated region (18) . In the present studies, we investigated whether bax is involved in the c-Myc apoptotic pathway. We show here that bax is a direct transcriptional target of c-Myc and contributes to c-Myc-induced apoptosis.
|
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
Adenovirus Infections.
The human c-Myc-expressing adenovirus was generated as described
previously (21)
. Adenovirus titers and infections were
carried out as described previously (22)
.
Bax-Promoter Reporter Plasmids.
Serial E-box deletion fragments from pTM604-4 (18)
were subcloned into the HindIII site of the promoterless
CAT plasmid pUCSVOCAT (18)
by blunt-end ligation.
This procedure produced the following plasmids: pTM667-3
(bax, -318 bp to -687 bp); pMYH426-282 (bax,
-172 bp to -687 bp); pTM780-10 (bax, -113 bp to -687
bp); pMYH426-272 (bax, -80 bp to -687 bp); and pTM668-1
(bax, -61 bp to -687 bp). The luciferase reporter
construct pGL3-668-1 was generated by releasing the bax
promoter sequence from pTM668-1 using BamHI and
HindIII and inserting it into the
BglII/HindIII sites of the promoterless firefly
luciferase reporter plasmid pGL3-Basic (Promega, Madison, WI). Reporter
plasmids containing mutants of each E-box were generated by replacing
each E-box sequence (CACGTG) with GTGCAC. PCR amplification products of
bax-promoter sequences using one of the following primers
were used to generate the luciferase reporter mutants using the
QuikChange Site-Directed Mutagenesis Kit (Stratagene): E-box 1,
GCTCATTGGACAGTGTGCACACGGGACCAAACCTC; E-box 2,
GAGGCAGGTGCGGTGTGCACTCCCGGCGGCGCTGC; E-box 3,
TTTTGCGGGGCGGCGTGCACAAGGACGCACGTTCA; and E-box 4,
TTCAGCGGGGCTCTGTGCACACCCGGGCGCGCTGC.
Transfections.
Transfections were performed as described previously (21)
,
with the following modifications. The Lipofectamine Plus reagent (Life
Technologies, Inc., Bethesda Research Laboratory, Bethesda, MD) was
used to transfect the bax promoter-CAT reporter constructs
as recommended by the manufacturer. CAT assays were performed as
described previously (23)
. Quantification of CAT activity
was performed using Imagequant densitometer software (Molecular
Dynamics). Lipofectin (Life Technologies, Inc.) was used for
transfections of SW480 cells plated at a density of 5 x 105 cells/well using 1.8 µg of bax
promoter-luciferase reporter plasmid and 0.2 µg of a constitutively
expressing ß-galactosidase plasmid in six-well plates. Extracts were
prepared 36 h after transfection, and luciferase activity was
assayed using the Luciferase Assay System (Promega).
RNA Isolation and Northern Blot Analysis.
Total RNA was prepared as described (24)
by CsCl gradient
ultracentrifugation of guanidine isothiocyanate-lysed cells. RNA was
separated on 10% formaldehyde agarose gels, transferred to Zeta-Probe
GT membranes (Bio-Rad), and detected after hybridization to
32P-labeled probes specific for bax using methods
described previously (25)
. The full-length human bax cDNA
probe (1.3 kb) was generated by digestion of the pMV10-bax
plasmid DNA (21)
with HindIII and XmnI.
Western Analysis.
Protein lysate preparation and immunoblot analysis was performed as
described previously (21)
. Antihuman PARP polyclonal
antibody (VIC5) was obtained from Boehringer-Mannheim Biochemicals
(Indianapolis, IN). The polyclonal antibody specific for cleaved
caspase-9 (D315) was obtained from Cell Signaling Technology/New
England Biolabs (Beverly, MA). Anti-actin (C-2) and anti-bax (P-19)
antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz,
CA).
Immunoprecipitation of the Bax Promoter.
Immunoprecipitation of the bax promoter and human c-Myc or
Max proteins was carried out as described (26)
. A
PCR-amplified fragment of the bax-promoter containing the
three E-box sequences shown in Fig. 3
.a.3 (-211 to -78)
was used to test c-Myc binding. Nuclear extracts from HEK-293 cells
infected for 48 h with Ad-cMyc or Ad-LacZ adenovirus were
immunoprecipitated with either anti-c-Myc (9E10; Santa Cruz
Biotechnology) or anti-Max (06525; Upstate Biotechnology, Lake Placid,
NY).
|
-32P] ATP, the
kinase was inactivated and the DNA ethanol-precipitated. The
end-labeled DNA was digested further with SacI to obtain the
portion of the bax promoter containing all four E-boxes
(-318 to -58) radio-labeled on the 3'-end. Five µl of each in
vitro translated c-Myc and Max reticulocyte lysate were incubated
with 100,000 cpm of radio-labeled DNA, and the DNA-protein complex was
immunoprecipitated with anti-c-Myc antibody. Immunoprecipitated DNA was
purified as described (26)
, digested with DNaseI, and the
fragmented DNA was separated on a 6% denaturing polyacrylamide gel.
Electrophoretic Mobility Gel Shift.
Electrophoretic mobility shift of each E-box and corresponding mutants
by c-Myc and Max was carried out using methodology described previously
(27)
. One µl of reticulocyte lysate containing in
vitro translated c-Myc or Max was added to the binding reaction (2
µg of salmon sperm DNA; 7.1 mM HEPES (pH 7.5);
3.6 mM MgCl2; 100
mM KCl; 5.7% glycerol; and 0.03% NP40),
incubated at room temperature for 10 min, and then the indicated
bax promoter sequence was added (19 µl, final volume) with
incubation for an additional 20 min. E-box-containing sequences
added to the binding reactions were the oligonucleotides described for
the generation of the bax luciferase reporter plasmids, annealed to
their complimentary sequences. The annealed 35 bp oligomers were
end-labeled using T4 polynucleotide kinase and
[-32P] ATP and approximately 100,000 cpm
were added to each binding reaction. Proteins were separated on
nondenaturing polyacrylamide gels, dried, and autoradiographed.
Flow Cytometric Analysis.
Preparation of cells for fluorescence activated cell sorting was
performed as described (28
, 29)
, with the following
modifications: cell sorting was performed on a Coulter Epics Elite
counter, and Annexin V assays (Clontech, Palo Alto, CA) were performed
according to the manufacturer’s instructions.
X-gal Staining.
X-gal staining was performed as described previously (21)
.
Briefly, cells were fixed in a solution containing 2% paraformaldehyde
and 0.05 M sodium phosphate (pH 7.3) for 5 min. Cells were
then washed twice with PBS and incubated at 37°C in the presence of
0.1 M sodium phosphate (pH 7.3), 3 mM
K3Fe(CN)6, 3 mM
K4Fe(CN)6, 1.3
mM MgCl2, and 1 mg/ml X-gal for
12 h.
|
Results |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
. The results revealed that levels of the 1.5 kb
bax transcript are up-regulated after overexpression of
c-Myc in human breast (SkBr3), lung (H460), ovarian (SkOV3), and colon
(SW480) cancer cell lines.
|
, we found that
bax mRNA steady-state levels were increased as early as 6 h after
Ad-cMyc infection. Furthermore, this induction was sustained for at
least 30 h postinfection in H460 cells and for at least 45 h
postinfection in SW480 cells. Because H460 cells express wild-type p53,
whereas SW480, SkBr3, and SkOV3 cells express mutant p53, it seems
that, in human cells, the c-Myc-dependent bax induction may occur in
the absence of wild-type p53 (30)
. Thus, the early
induction of bax expression in response to c-Myc is consistent with a
role for bax as an effector rather than a consequence of c-Myc-induced
apoptosis.
Up-Regulation of Bax Protein Expression and Induction of Apoptosis
by c-Myc Overexpression.
Because we observed a sustained increase in bax mRNA levels after c-Myc
overexpression in H460 and SW480 cancer cell lines, we examined bax
protein expression levels after Ad-cMyc infection of the same cells
under serum-deprived conditions (Fig. 2a)
. It is well established that c-Myc overexpression in
serum- or growth factor-deprived cells results in the apoptotic
response (2
, 7
, 31)
. Immunoblot analysis showed a
significant induction of bax protein expression after Ad-cMyc infection
as compared with Ad-LacZ infection in H460 and SW480 cells.
|
. PARP cleavage
seemed to be significantly enhanced in both H460 and SW480 cells by
c-Myc in the absence of serum, consistent with the possibility that
c-Myc is mediating the induction of apoptosis. Similar correlations
were made between c-Myc overexpression and the activity of the bax
effector, caspase-9. As expected, in serum-deprived cells, c-Myc
expression resulted in an increase in caspase-9 cleavage (Fig. 2c)
. Thus, not only is the increased expression of bax
associated with the induction of apoptosis in human cells
overexpressing c-Myc protein, but it is also associated with the
cleavage of caspase-9, which has been shown to be activated after the
release of cytochrome c from the mitochondrial membrane
(7)
.
As another test to rule out the possibility that up-regulation of bax
could be a consequence of c-Myc-induced apoptosis, we used TRAIL, a
potent inducer of cell death (32)
to show that another
inducer of apoptosis does not up-regulate bax expression.
Exposure of human SW480 cells to a lethal dose of TRAIL led, within
4 h, to massive apoptosis, as evidenced by PARP cleavage, without
concomitant bax protein expression (Fig. 2d)
. Thus, the
increase observed in bax expression after c-Myc overexpression seems to
be attributable to the regulation of bax by c-Myc and not
simply a consequence of cell death induction.
c-Myc-dependent Transcriptional Control of the Human
bax Promoter.
The bax promoter has been cloned previously and found to be
p53-responsive (18)
. It was recognized that the
bax promoter contains 4 E-boxes which represent canonical
c-Myc binding sites. To determine the significance of the E-boxes in
the regulation of bax transcription by c-Myc, we tested
bax promoter-reporter constructs in transient transfection
assays. For these assays we used CAT reporter constructs containing
serial deletions of the endogenous E-box elements of bax
(Fig. 3a)
. Following transient transfection of SW480 cells with the
deletion series of CAT reporters, we found a striking increase in CAT
activity with the three- and four-E-box-containing constructs (Fig. 3b)
. Thus, endogenous c-Myc, which is known to be
overexpressed in the SW480 colon cancer cells (33)
,
presumably transactivates the bax promoter, and the
expression of bax is up-regulated significantly when at
least three of the four endogenous E-boxes are present in the reporter
construct.
To determine whether c-Myc is directly responsible for the
E-box-dependent regulation of the bax promoter, we
transfected c-Myc null Rat-1A fibroblasts (19
, 34)
with the CAT reporters used in Fig. 3b
and
compared the CAT activity in these cells with levels observed in c-Myc
wild-type Rat-1A fibroblasts (Fig. 3c
, upper
panel). The results show a 3- to 4-fold increase in CAT activity
with the- and four-E-box-containing bax-promoter constructs
occurring in the Rat1A c-Myc-wild-type but not in the c-Myc-null cells
(Fig. 3c
, lower panel). These results suggest
that the bax promoter is regulated by the c-Myc protein.
Physical Interaction of the E-box-containing bax
Promoter Region with the c-Myc Protein.
We next investigated a possible physical interaction between c-Myc
protein and the E-box-containing region of the bax promoter
using an immunoprecipitation assay (26)
in which the human
bax promoter region was recovered in association with human
c-Myc or Max proteins. The results show that the E-box-containing
bax promoter region was specifically immunoprecipitated with
anti-c-Myc antibodies or anti-Max antibodies (Fig. 4a)
. To delineate whether c-Myc binds one or more of the four
E-boxes, we performed a DNaseI protection assay using the
bax promoter region containing all four E-boxes. c-Myc/Max
dimers offered some protection to E-boxes 1, 2, and 3 but appeared to
bind E-box 3 most strongly (Fig. 4b)
. To verify whether
c-Myc preferentially binds E-box 3, we used an EMSA of the individual
E-boxes. Max/Max dimers strongly bound all four wild-type but not
mutant E-box sequences, whereas c-Myc/Max alone bound E-box 3 with an
affinity comparable with Max/Max binding (Fig. 4c)
. This
binding pattern is in agreement with the observation that E-box 3
confers c-Myc responsiveness to the CAT reporter constructs used in
Fig. 3
. This pattern is also consistent with DNA site-selection data
which indicates that the nucleotides flanking either side of the E-box
confer binding specificity by c-Myc/Max dimers, whereas Max/Max dimers
are less discriminatory (35
, 36)
. E-boxes 1, 2, and 4,
which each have an A or T at both the 5' or 3' flanking positions,
would be predicted not to bind c-Myc/Max. E-box 3 is flanked by a 5' C,
which is permissive for c-Myc/Max binding. Therefore, E-boxes 1, 2, and
4 would be predicted to be transcriptionally silent with respect to
c-Myc (35)
. To test this, we generated luciferase reporter
constructs containing bax promoter mutants shown not to bind
either c-Myc/Max or Max/Max dimers by DNA gel shift (Fig. 4c)
. We observed that the level of bax promoter
activity was significantly reduced only when E-box 3 is mutated (Fig. 4d)
. Unexpectedly, bax promoter activity was
enhanced when any of the other E-boxes were mutated, suggesting that
these sites may act as repressor sites. Other proteins known to bind
E-boxes and act as transcriptional repressors, such as Mnt, may also be
involved in bax regulation (37)
. We propose a
complex yet realistic scenario wherein the contribution of the E-boxes
to bax activation may result from a combination of c-Myc
binding E-box 3 plus c-Myc sequestration of Max, thereby reducing its
availability as a repressor. We are currently investigating whether
other factors that associate with E-boxes are involved in
bax regulation.
|
. Quantification of sub-G1 PI-stained cells
showed that c-Myc induces apoptosis in both bax+/+ and
bax-/- cells as compared with overexpression of LacZ, but
significantly less apoptosis was induced in bax-/-
versus bax+/+ cells observed on either day 2 or
day 5 after Ad-cMyc infection (Fig. 5b)
. The infectivity of
bax-null and wild-type MEFs by adenovirus were very
similar (data not shown). Three observations are noted in the results
shown in Fig. 5, a and b
: (a) Ad-cMyc
infection resulted in a greater level of apoptosis in bax+/+
as compared with bax-/- MEFs on days 2 and 5. These
results reveal that the presence of bax contributes to
c-Myc-induced apoptosis or may be required for a full apoptotic
response after c-Myc overexpression; (b) there was evidence
of toxicity attributable to adenovirus infection, and this was more
evident on the day-5 as compared with the day-2 Ad-LacZ-infected
cells; and (c) Ad-cMyc infection led to a greater extent of
apoptosis over time in bax-/- cells consistent with the
existence of bax-independent c-Myc effectors of apoptosis.
These results suggest that bax is only partially required
for c-Myc-induced apoptosis, especially at later time points.
|
revealed two points: (a) as in the previous
experiments in Fig. 5
, Ad-cMyc induced apoptosis to a much greater
extent in bax+/+ as compared with bax-/- cells.
These results confirm that the expression of bax is required
for an efficient apoptotic response after c-Myc overexpression; and
(b) in the bax-/- MEFs at the 36 h time
point, there was no evidence for greater death in Ad-cMyc
versus Ad-LacZ-infected cells. These results suggest that
early on during c-Myc-induced apoptosis, the bax-dependent mechanism
may predominate (Fig. 6a)
, whereas later the bax-independent
effects contribute significantly to c-Myc-induced death (Fig. 5 a and b)
.
|
. As expected,
the induction of apoptosis was inhibited in the presence of serum.
These results are consistent with the interpretation that although bax
is partially required for c-Myc-induced apoptosis, its up-regulation is
not sufficient. Taken together, we conclude that c-Myc expression in
cells deprived of survival factors will engage the cell-death
machinery, and this effect is significantly enhanced by the activation
of bax. We conclude that the direct transcriptional
up-regulation of bax plays a significant role in the
c-Myc-dependent apoptotic response, though bax-independent mechanisms
are also involved. |
Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
and 2)
. The absence of
wild-type p53 did not inhibit c-Myc-dependent up-regulation of
bax gene expression. Second, the bax gene
contains four Myc/Max binding sites within the promoter region
(18)
. c-Myc is able to drive reporter activity from
bax promoter-reporter constructs containing at least three
of the four E-boxes (Fig. 3)
. Moreover, c-Myc binds directly the
E-box-containing region of the bax promoter (Fig. 4)
.
Finally, the induction of bax mRNA was associated with c-Myc-mediated
apoptosis (Fig. 2)
.
Until now, the regulation of bax expression has been considered to be
completely under the control of the p53 tumor suppressor. Miyashita and
Reed (18)
cloned and performed functional analysis of the
bax gene promoter, which indicated that it was a direct
target of p53. It was hypothesized that c-Myc might be an additional
transactivator of bax, based on the presence of four CACGTG
motifs located within the 5' UTR of the bax gene. Deletion
analysis of the bax promoter indicated that E-box 3 is
critical for c-Myc transcriptional activation (Fig. 3)
. Inspection of
the sequences flanking the four E-boxes revealed that E-box 3 differed
from the other three E-boxes in that it alone possessed a 5'C, whereas
the other E-boxes possessed either a 5'A or T. Because previous reports
have shown that the presence of a 5'C flanking the E-box confers
specificity of c-Myc binding (35
, 36)
, we tested whether
c-Myc preferentially binds E-box 3. Our results using DNase1 protection
analysis and EMSA confirmed this hypothesis and showed that c-Myc binds
most strongly to E-box 3 (Fig. 4, b and c)
. When
we mutated E-box 3, as expected, we observed reduced transcriptional
activation by c-Myc (Fig. 4d)
. However, c-Myc increased
transactivation of the bax promoter when E-boxes 1, 2, or 4
were mutated, which suggests that these E-boxes may be regulated by
other proteins that can act as transcriptional repressors. Other
proteins that heterodimerize with Max and bind to E-box sequences, such
as those of the Mad/Mxi1 family and Mnt/Rox1, can act as powerful
antagonists of Myc-induced transactivation, attributable in part to
their ability to recruit the Sin3 protein and its associated
transcriptional corepressors (37
, 43)
. In support of this
hypothesis, a recent report showed that c-Myc-induced apoptosis was
inhibited in fibroblasts that had been micro-injected with a
Mad1-expressing plasmid (44)
. We are currently
investigating whether other Max-binding partners may be involved in
bax regulation.
In the present studies, we used an adenovirus vector overexpressing
c-Myc protein to investigate the mechanism of c-Myc-induced apoptosis.
This strategy has some unique features, strengths as well as
limitations. Strengths of this approach include the ability to
overexpress the c-Myc protein in multiple human cell lines where its
effects can be studied using overexpression of the LacZ gene
also delivered by an adenovirus as a control. Unlike other systems such
as the myc-ER system (45)
, where the c-Myc protein is
preformed, one unique feature of the system is that immediate early
gene expression is delayed probably for at least two hours
because of the need to first express the c-Myc protein from the
adenovirus vector. Our results showing that bax mRNA expression
is detectably up-regulated as early as 6 h after Ad-cMyc infection
argues strongly that it is a very early event which precedes apoptotic
death in the cells examined. Taken together with the physical
association between c-Myc and bax promoter elements, our
interpretation is that there is a direct link between c-Myc protein and
the regulation of bax gene expression. The adenovirus
approach has been used previously to investigate the effects of c-Myc
on cell cycle regulation (21)
. Repression of expression of
the cell cycle inhibitor p21 and transcriptional up-regulation of the
cyclin-dependent kinase CDK4 by c-Myc have been discovered using
adenovirus-based systems (21
, 46)
. Of note, CDK4
up-regulation was not observed with the more traditional myc-ER system,
suggesting most likely variable levels of c-Myc protein or perhaps cell
type-specific differences in the extent to which particular targets may
be controlled (46)
. Because adenovirus vectors are widely
used to investigate protein function including transcription factors,
we believe the system provides a valid approach to investigating c-Myc
targets and should be of use in future studies in conjunction with
other approaches. In the present studies, we provide other supportive
evidence for the regulation of bax expression by c-Myc not relying on
overexpression using the adenovirus vector. We observed a striking
difference in bax-promoter CAT-reporter gene expression
between c-Myc+/+ and c-Myc-/- Rat-1A
fibroblasts (Fig. 3)
. Thus, the presence or absence of endogenous c-Myc
expression appears to correlate with transcriptional control of the
bax gene through at least one E-box element, which c-Myc can
bind directly.
We observed that Ad-cMyc overexpression in serum-deprived cells results
in apoptosis, and the presence of bax significantly enhances
the apoptotic response (Figs. 5
and 6)
. The data presented using PI
staining show that c-Myc overexpression causes more cell death than
LacZ in both bax-null and bax-wild-type cells,
and that c-Myc causes greater cell death in the presence of
bax. The apparent toxicity of adenoviral infection after
long infection times led us to assess c-Myc-induced apoptosis at an
earlier time point after infection. Using Annexin V staining, it is
clear that bax contributes to c-Myc-induced apoptosis (Fig. 6a)
, but that at longer infection times using PI staining,
bax-independent mechanisms contribute to c-Myc induced
apoptosis (Fig. 5, a and b)
. Therefore, it is
very likely that other c-Myc target genes or other unknown mechanisms
contribute to the apoptotic response.
It is well established that c-Myc-induced apoptosis can be rescued by growth factors or Bcl-2 overexpression. The present studies reveal a direct link between c-Myc and bax gene expression, which correlates with greater apoptosis in serum-free conditions. The rescue of c-Myc-induced apoptosis by serum is consistent with a model wherein elevated bax protein levels may contribute to death under the appropriate intracellular conditions, i.e., bax protein may be partially required, but is not sufficient, for c-Myc-induced apoptosis. Although the present study did not investigate the mechanism underlying protection from apoptosis by survival factors, some previous studies have provided potentially important clues. It has been shown for example that the survival factor IL-3 can activate the Akt kinase, which in turn phosphorylates the Bad protein, thereby sequestering it in cytoplasmic complexes containing 14-3-3 where it cannot bind to Bcl-XL (47, 48, 49) . Such a scenario involves a growth factor-dependent shift in the balance within the Bcl-2 family leading to cell survival. Another clue has recently been provided by studies showing that the survival factor IL-7 can modulate the subcellular localization of the bax protein (50) . In the absence of IL-7 through alterations in intracellular pH and a proposed change in the conformation of the bax protein, there is increased mitochondrial targeting of bax as a proapoptotic mediator. Future studies will explore these models, which are not mutually exclusive.
In conclusion, our experiments reveal a direct link between c-Myc and bax leading to apoptosis. Specifically, we observed that overexpression of c-Myc increased bax mRNA and protein expression. We show that c-Myc strongly binds one of the E-boxes present in the bax promoter region, contributing to bax expression. We also show that bax is required for a complete death response after c-Myc overexpression, and that survival factors present in serum may attenuate this response. Our results are in agreement with recent reports which suggest that downstream effectors of bax, APAF-1 and caspase-9, are required for c-Myc-induced apoptosis (9) and show the involvement of mitochondrial cytochrome c release in c-Myc-induced apoptosis (7) . Furthermore, it is well known that the bax-interacting prosurvival protein Bcl-2 can inhibit c-Myc-induced apoptosis (12) . Taken together, these results provide a pathway for c-Myc-induced apoptosis, which occurs through the direct control of bax gene expression.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by a grant from the NIH (GM60554).
K. O. M. was supported by a National Research Service Award
(5F31GM17199) from the USPHS. The results of this work were
presented at the 91st Annual American Association for
Cancer Research meeting in San Francisco, California. 
2 W. S. E-D. is an Assistant Investigator of the
Howard Hughes Medical Institute.
3 To whom requests for reprints should be
addressed, at Howard Hughes Medical Institute, Clinical Research
Building, Room 437A, 415 Curie Boulevard, Philadelphia, PA 19104-6148.
Fax: (215) 573-9139; E-mail: weldeir{at}hhmi.upenn.edu
4 The abbreviations used are: ODC, ornithine
decarboxylase; EMSA, electrophoretic mobility shift assay; CAT,
chloramphenicol acetyl transferase; APAF-1, apoptotic protease
activating factor-1; PARP, poly(ADP-ribose) polymerase; Ad-cMyc,
adenovirus vector expressing c-Myc; Ad-LacZ, adenovirus vector
expressing ß-galactosidase; TRAIL, tumor necrosis factor-related
apoptosis-inducing ligand; PI, propidium iodide; MOI, multiplicity of
infection; MEF, mouse embryonic fibroblast.
Received 7/20/00. Accepted 9/27/00.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
-prothymosin gene. EMBO J., 10: 133-141, 1991.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. Niapour, Y. Yu, and S. A. Berger Regulation of Calpain Activity by c-Myc through Calpastatin and Promotion of Transformation in c-Myc-negative Cells by Calpastatin Suppression J. Biol. Chem., August 1, 2008; 283(31): 21371 - 21381. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Cao, R. L. Bennett, and W. S. May c-Myc and Caspase-2 Are Involved in Activating Bax during Cytotoxic Drug-induced Apoptosis J. Biol. Chem., May 23, 2008; 283(21): 14490 - 14496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. G. Bajaj, M. Murakami, Q. Cai, S. C. Verma, K. Lan, and E. S. Robertson Epstein-Barr Virus Nuclear Antigen 3C Interacts with and Enhances the Stability of the c-Myc Oncoprotein J. Virol., April 15, 2008; 82(8): 4082 - 4090. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Di Leo, M Tanner, C Desmedt, M Paesmans, F Cardoso, V Durbecq, S Chan, T Perren, M Aapro, C Sotiriou, et al. p-53 gene mutations as a predictive marker in a population of advanced breast cancer patients randomly treated with doxorubicin or docetaxel in the context of a phase III clinical trial Ann. Onc., June 1, 2007; 18(6): 997 - 1003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. B. Dansen, J. Whitfield, F. Rostker, L. Brown-Swigart, and G. I. Evan Specific Requirement for Bax, Not Bak, in Myc-induced Apoptosis and Tumor Suppression in Vivo J. Biol. Chem., April 21, 2006; 281(16): 10890 - 10895. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Alazzouzi, V. Davalos, A. Kokko, E. Domingo, S. M. Woerner, A. J. Wilson, L. Konrad, P. Laiho, E. Espin, M. Armengol, et al. Mechanisms of Inactivation of the Receptor Tyrosine Kinase EPHB2 in Colorectal Tumors Cancer Res., November 15, 2005; 65(22): 10170 - 10173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L L Loro, A C Johannessen, and O K Vintermyr Loss of BCL-2 in the progression of oral cancer is not attributable to mutations J. Clin. Pathol., November 1, 2005; 58(11): 1157 - 1162. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. D. Miller, J. Smeds, J. George, V. B. Vega, L. Vergara, A. Ploner, Y. Pawitan, P. Hall, S. Klaar, E. T. Liu, et al. From The Cover: An expression signature for p53 status in human breast cancer predicts mutation status, transcriptional effects, and patient survival PNAS, September 20, 2005; 102(38): 13550 - 13555. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Rothermund, K. Rogulski, E. Fernandes, A. Whiting, J. Sedivy, L. Pu, and E. V. Prochownik C-Myc-Independent Restoration of Multiple Phenotypes by Two C-Myc Target Genes with Overlapping Functions Cancer Res., March 15, 2005; 65(6): 2097 - 2107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Cui, T. Li, and H.-F. Ding Linking of N-Myc to Death Receptor Machinery in Neuroblastoma Cells J. Biol. Chem., March 11, 2005; 280(10): 9474 - 9481. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. Magal, A. Jackman, S. Ish-Shalom, L. E. Botzer, P. Gonen, R. Schlegel, and L. Sherman Downregulation of Bax mRNA expression and protein stability by the E6 protein of human papillomavirus 16 J. Gen. Virol., March 1, 2005; 86(3): 611 - 621. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. N. Rajabi, S. Baluchamy, S. Kolli, A. Nag, R. Srinivas, P. Raychaudhuri, and B. Thimmapaya Effects of Depletion of CREB-binding Protein on c-Myc Regulation and Cell Cycle G1-S Transition J. Biol. Chem., January 7, 2005; 280(1): 361 - 374. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Ricci, Z. Jin, M. Dews, D. Yu, A. Thomas-Tikhonenko, D. T. Dicker, and W. S. El-Deiry Direct Repression of FLIP Expression by c-myc Is a Major Determinant of TRAIL Sensitivity Mol. Cell. Biol., October 1, 2004; 24(19): 8541 - 8555. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Brunelle, M. T. Santore, G. R. S. Budinger, Y. Tang, T. A. Barrett, W.-X. Zong, E. Kandel, B. Keith, M. C. Simon, C. B. Thompson, et al. c-Myc Sensitization to Oxygen Deprivation-induced Cell Death Is Dependent on Bax/Bak, but Is Independent of p53 and Hypoxia-inducible Factor-1 J. Biol. Chem., February 6, 2004; 279(6): 4305 - 4312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tajiri, X. Liu, P. M. Thompson, S. Tanaka, S. Suita, H. Zhao, J. M. Maris, G. C. Prendergast, and M. D. Hogarty Expression of a MYCN-interacting Isoform of the Tumor Suppressor BIN1 Is Reduced in Neuroblastomas with Unfavorable Biological Features Clin. Cancer Res., August 1, 2003; 9(9): 3345 - 3355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Montagna, M.-S. Lyu, K. Hunter, L. Lukes, W. Lowther, T. Reppert, B. Hissong, Z. Weaver, and T. Ried The Septin 9 (MSF) Gene Is Amplified and Overexpressed in Mouse Mammary Gland Adenocarcinomas and Human Breast Cancer Cell Lines Cancer Res., May 1, 2003; 63(9): 2179 - 2187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Klefstrom, E. W. Verschuren, and G. Evan c-Myc Augments the Apoptotic Activity of Cytosolic Death Receptor Signaling Proteins by Engaging the Mitochondrial Apoptotic Pathway J. Biol. Chem., November 1, 2002; 277(45): 43224 - 43232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Juin, A. Hunt, T. Littlewood, B. Griffiths, L. B. Swigart, S. Korsmeyer, and G. Evan c-Myc Functionally Cooperates with Bax To Induce Apoptosis Mol. Cell. Biol., September 1, 2002; 22(17): 6158 - 6169. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Bellosillo, N. Villamor, A. Lopez-Guillermo, S. Marce, F. Bosch, E. Campo, E. Montserrat, and D. Colomer Spontaneous and drug-induced apoptosis is mediated by conformational changes of Bax and Bak in B-cell chronic lymphocytic leukemia Blood, August 13, 2002; 100(5): 1810 - 1816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Eischen, J. E. Rehg, S. J. Korsmeyer, and J. L. Cleveland Loss of Bax Alters Tumor Spectrum and Tumor Numbers in ARF-deficient Mice Cancer Res., April 1, 2002; 62(7): 2184 - 2191. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-F. Cartron, L. Oliver, S. Martin, C. Moreau, M.-T. LeCabellec, P. Jezequel, K. Meflah, and F. M. Vallette The expression of a new variant of the pro-apoptotic molecule Bax, Bax{psi}, is correlated with an increased survival of glioblastoma multiforme patients Hum. Mol. Genet., March 1, 2002; 11(6): 675 - 687. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Jansson and X.-F. Sun Bax Expression Decreases Significantly From Primary Tumor to Metastasis in Colorectal Cancer J. Clin. Oncol., February 1, 2002; 20(3): 811 - 816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Hawcroft, M. D'Amico, C. Albanese, A. F. Markham, R. G. Pestell, and M. A. Hull Indomethacin induces differential expression of {beta}-catenin, {gamma}-catenin and T-cell factor target genes in human colorectal cancer cells Carcinogenesis, January 1, 2002; 23(1): 107 - 114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Eischen, M. F. Roussel, S. J. Korsmeyer, and J. L. Cleveland Bax Loss Impairs Myc-Induced Apoptosis and Circumvents the Selection of p53 Mutations during Myc-Mediated Lymphomagenesis Mol. Cell. Biol., November 15, 2001; 21(22): 7653 - 7662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Soucie, M. G. Annis, J. Sedivy, J. Filmus, B. Leber, D. W. Andrews, and L. Z. Penn Myc Potentiates Apoptosis by Stimulating Bax Activity at the Mitochondria Mol. Cell. Biol., July 15, 2001; 21(14): 4725 - 4736. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
