| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Division of Clinical Sciences, National Cancer Institute, NIH, Bethesda, Maryland 20892-7058 [D. R., J. A. T., P. R. T., D. A.]; New Chemical Entities, Inc., Thetagen Division, Bothell, Washington 98011 [M. R. A.]; Information Management Services, Inc., Silver Spring, Maryland 20904 [M. J. B.]; and National Public Health Institute, SF00300 Helsinki, Finland [J. V.]
| ABSTRACT |
|---|
|
|
|---|
-Tocopherol, ß-Carotene Cancer Prevention Study
cohort to evaluate the association between the proline to leucine
polymorphism at codon 198 of hGPX1 and lung cancer risk.
Cases (n = 315) were matched to controls
on age (±5 years), intervention group, and study clinic using
incidence density sampling in a 1:1 ratio. The prevalence of the hGPX1
Pro198leu variant allele was 58% for controls
and 71% for cases (P < 0.001). Using
conditional logistic regression, we found a significant association
between hGPX1 genotype and lung cancer risk. The odds ratio
for heterozygotes was 1.8 (95% confidence interval, 1.22.8) and 2.3
(95% confidence interval, 1.33.8) for homozygous variants compared
to wild-type individuals. Due to its high prevalence, the
hGPX1 variant may contribute significantly to lung cancer
risk among Caucasians but not among ethnic Chinese who do not exhibit
this polymorphism. | INTRODUCTION |
|---|
|
|
|---|
The risk of developing cancer is determined by both the number and nature of cumulative carcinogenic exposures and by individual genetic variation (1) . For example, genetic polymorphisms in detoxification enzymes can substantially alter the magnitude of exposure to carcinogenic substances. hGPX13 is a selenium-dependent enzyme that participates in the detoxification of hydrogen peroxide and a wide range of organic peroxides with reduced glutathione (2) . From a sequence analysis of lung tumor specimens, Moscow et al. (3) reported a nucleotide substitution at codon 198 of hGPX1, resulting in the substitution of leucine for proline. They also reported that other polymorphisms cosegregate with the proline to leucine substitution, including six alanines in the polyalanine sequence (instead of five or seven alanines with the wild-type proline), a T for C substitution at +2, and a G for A substitution at -592.
In the present study, we sought to confirm the presence of an hGPX1 germ-line codon 198 (Pro198leu) polymorphism among members of a cancer prevention trial in Finland and explored the association between the polymorphism and lung cancer risk. We also examined whether age, smoking behavior, serum antioxidant levels, or the trial antioxidant supplementation could modify the hGPX1-lung cancer association.
| PATIENTS AND METHODS |
|---|
|
|
|---|
-Tocopherol, ß-Carotene Cancer Prevention Study, a randomized,
placebo-controlled prevention trial designed to determine whether
-tocopherol (50 mg/day), ß-carotene (20 mg/day), or both would
reduce the incidence of lung, prostate and other cancers. The overall
design, rationale, and objectives of this study have been published, as
have the main trial findings (4, 5, 6)
. The trial was
conducted between 1985 and 1993 in southwestern Finland as a joint
project between the National Public Health Institute of Finland and the
National Cancer Institute of the United States. Potential participants,
all men aged 5069 years residing in southwestern Finland
(n = 290,406) were identified from the
computer list of the national population registry of Finland.
Participants (29,133) had to be current smokers of five or more
cigarettes per day, eligible and willing to participate, and give
informed consent. Information on variables that possibly could confound
the association between the polymorphism of hGPX1 and lung
cancer risk were available from
-Tocopherol, ß-Carotene Cancer
Prevention Study baseline questionnaires. Baseline measurements of
serum
-tocopherol and ß-carotene levels were also available.
Selection of Cases and Controls.
The cases consist of 315 men diagnosed with primary lung cancer (ICD-9,
162) during the years 19851994 among those who gave a whole blood
sample in 1992 and 1993. Seventy-eight percent of the cases donated
blood before cancer diagnosis. Using incidence density sampling, the
controls were selected from cohort participants who were alive and free
of cancer at the time the matched case was diagnosed. Controls were
selected from those who donated blood matched to cases on age (±5
years), intervention group, and study clinic in a 1:1 ratio.
Genotype Analyses.
PCR primers and dual-labeled allele discrimination probes were designed
using PrimerExpress version 1.0 (PE Biosystems). Probes were selected
that have a predicted Tm near 68°C, with the
polymorphic base near the center. Flanking PCR primers were selected
based on the calculated penalty score, Tm,
length, and amplimer size. Primers and probes were synthesized and
purified by PE Biosystems. Oligonucleotide sequences for primers and
probes to detect the C to T polymorphism in codon 198 of
hGPX1 were: PCR forward, TGTGCCCCTACGCAGGTACA; PCR reverse,
CCCCCGAGACAGCAGCA; C allele probe,
VICCTGTCTCAAGGGCCCAGCTGTGCTAMRA;
and T allele probe,
FAMCTGTCTCAAGGGCTCAGCTGTGCCTTAMRA.
Reactions (10 µl) contained
20 ng of genomic DNA isolated from
whole blood, 1x TaqMan Master Mix, dual-labeled probes (100
nM each), and PCR primers (900 nM each).
Reactions were performed in 96-well MicroAmp Optical reaction plates
and caps (PE Biosystems). Plates were incubated in PE Biosystems 9600
thermal cyclers at 50°C for 2 min, 95°C for 10 min, followed by 40
cycles of 95°C for 15 s and 62°C for 1 min. Fluorescence was
measured using the ABI Prism 7700 Sequence Detector and analyzed with
Sequence Detection System version 1.6.3. Amplified DNA from several
individuals exhibiting each genotype was electrophoresed on an agarose
gel to confirm amplimer size and sequenced to confirm each genotype.
When possible, each plate contained two control DNA samples for each
homozygous genotype and four no template controls. All laboratory
personnel were blind to the case-control status of the samples. A
random sample of 10% was repeated for quality control and was 100%
concordant.
Statistical Analyses.
The
2 test for heterogeneity was used to test
whether the distribution of allele prevalences was the same for cases
and controls. Conditional logistic regression was used to examine the
association between genotype and lung cancer risk. Potential
confounding of the association between the hGPX1 genotype
and cancer risk by other related risk factors was explored using
Spearman rank correlation analysis and multivariate logistic regression
models, including stepwise regression models. If the potential
confounder caused a significant change in the log likelihood estimate
(P < 0.05) and a >20% change in the
ß-coefficient, it was kept in the model for further multivariate
analysis. Modification of the effect of genotype by age, tobacco,
-tocopherol, and/or ß-carotene supplementation, serum ß-carotene
and
-tocopherol on lung cancer risk was examined by statistical
tests of the first order interaction term in the logistic regression
models. Exclusion of cases diagnosed before blood draw did not
materially alter any of the risk estimates, therefore, all cases were
included in the statistical analyses. All analyses were performed using
the statistical software package STATA (STATA Corporation, College
Station, TX).
| RESULTS |
|---|
|
|
|---|
-tocopherol, and ß-carotene were not
different in lung cancer cases compared with controls.
|
2
P for distributions <0.001). In addition, we observed an
association between the hGPX1 genotype and lung cancer risk.
Individuals with the heterozygous genotype were at 80% greater risk
for lung cancer compared to those with the homozygous wild-type
(pro/pro) genotype. Individuals with the homozygous variant genotype
(leu/leu) were at 130% greater risk for lung cancer
compared with homozygous wild-type individuals. Adjustment for baseline
covariates such as years smoked or cigarettes smoked per day did not
materially alter the risk estimates. However, the risk estimates shown
in Table 2
|
-tocopherol and/or ß-carotene at baseline, and trial intervention
of
-tocopherol and/or ß-carotene as potential modifiers of the
association between hGPX1 and lung cancer risk showed no statistically
significant interactions (data not shown). | DISCUSSION |
|---|
|
|
|---|
Many studies have shown that selenium increases hGPX1 activity and expression (12, 13, 14) . It is generally assumed that selenium increases the antioxidant capacity of a cell, consequently reducing intracellular oxidative stress. The association between prospectively collected serum selenium and lung cancer has been reported in over a dozen studies (15, 16, 17, 18, 19) . Most of these studies found that selenium concentrations were slightly lower in the lung cancer cases than in controls.
In the current study, we confirm the presence of a germ-line
polymorphism in the coding region of hGPX1 with notable
prevalence of allele variants among middle-aged Finnish smokers. We
also show that individuals with one or two variant alleles were at
increased risk of lung cancer compared with homozygous wild-type
individuals. One possible explanation for the increased lung cancer
risk observed among individuals with just one variant allele is that,
because different hGPX1 alleles encode structurally
different hGPX1 subunits, heterozygote individuals may have
a less efficient final glutathione peroxidase complex. In addition,
serum antioxidant levels or supplements of
-tocopherol (50 mg daily)
or ß-carotene (20 mg daily) did not seem to modify lung cancer risk
associated with the variant hGPX1 genotypes. This may be due
to lack of chemical reactivity of
-tocopherol and/or ß-carotene
with hydrogen peroxide or organic peroxides. Smoking also did not
modify the risk of lung cancer due to hGPX1 variants.
The association we report here is complicated by the other
polymorphisms that cosegregate with the codon 198 polymorphism. These
polymorphisms include six alanines in the hGPX1 polyalanine sequence
(instead of five or seven alanines with the wild-type proline), a T for
C substitution at +2, and a G for A substitution at -592 with the
proline to leucine substitution. Although the exact structural or
functional consequences of these hGPX1 coding region
polymorphisms are not known, the substitution of the
-imino acid
proline (cyclic amino acid) by leucine is probably the polymorphism
that causes the most profound secondary and tertiary conformational
change of hGPX1, because proline is the only amino acid without a free
unsubstituted amino group on the
carbon atom and is known to cause
a unique kink in the secondary structure of peptides.
One of the strengths of this study is its prospective design. The
collection of covariate data (e.g., smoking) before case
diagnoses minimized the potential for recall bias. The availability of
detailed exposure data also allowed us to explore several relevent
gene-environment interactions. The availability of data on prospective
serum antioxidant levels and supplements of
-tocopherol or
ßcarotene given during the intervention trial added another
dimension to our study because of the antioxidant functions of hGPX1.
The generalizability of these results, however, may be somewhat
restricted because the study was conducted among Finnish male smokers.
Other case-control studies examining the association of
hGPX1 polymorphisms and lung cancer risk are clearly needed.
In future studies, our group will attempt to examine the association
between the hGPX1 polymorphism and lung cancer risk in other
Caucasian populations. Our analysis of ethnic Chinese members of the
Yunnan tin corporation cohort (20)
revealed that they do
not exhibit the codon 198 hGPX1 polymorphism (all 92 noncase samples
analyzed were wild type).
In summary, we show that the codon 198 hGPX1 polymorphism is
associated with increased risk of lung cancer among male smokers. We
also found that neither smoking nor supplementation with either
-tocopherol and/or ß-carotene altered the association between the
hGPX1 proline to leucine substitution polymorphism and risk
of lung cancer. Because of its high prevalence, the codon 198 variant
allele of hGPX1 may have substantial public health impact by
influencing lung cancer risk among Caucasians but not among ethnic
Chinese.
| FOOTNOTES |
|---|
1 Supported by USPHS National Cancer Institute
contract NO1-CN45165 from the National Cancer Institute, NIH,
Department of Health and Human Services. The content of this
publication does not necessarily reflect the views or policies of the
Department of Health and Human Services, nor does mention of trade
names, commercial products, or organization imply endorsement by the
United States Government. ![]()
2 To whom requests for reprints should be
addressed, at Division of Clinical Sciences, Cancer Prevention Studies
Branch, 6006 Executive Boulevard, MSC 7058, Bethesda, MD 20892-7058.
E-mail: DR132K{at}NIH.gov ![]()
3 The abbreviation used is: hGPX1, human
glutathione peroxidase 1. ![]()
Received 3/ 2/00. Accepted 9/13/00.
| REFERENCES |
|---|
|
|
|---|
-Tocopherol and ß-carotene supplements and lung cancer incidence in the
-tocopherol, ß-carotene cancer prevention study: effects of base-line characteristics and study compliance. J. Natl. Cancer Inst., 88: 1560-1570, 1996.
-tocopherol, selenium, and total peroxyl radical absorbing capacity. Cancer Epidemiol. Biomark. Prev., 6: 907-916, 1997.[Abstract]
This article has been cited by other articles:
![]() |
P. Rajaraman, A. Hutchinson, N. Rothman, P. M. Black, H. A. Fine, J. S. Loeffler, R. G. Selker, W. R. Shapiro, M. S. Linet, and P. D. Inskip Oxidative response gene polymorphisms and risk of adult brain tumors Neuro-oncol, January 1, 2008; 10(5): 709 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Udler, A.-T. Maia, A. Cebrian, C. Brown, D. Greenberg, M. Shah, C. Caldas, A. Dunning, D. Easton, B. Ponder, et al. Common Germline Genetic Variation in Antioxidant Defense Genes and Survival After Diagnosis of Breast Cancer J. Clin. Oncol., July 20, 2007; 25(21): 3015 - 3023. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Choi, M. L. Neuhouser, M. Barnett, M. Hudson, A. R. Kristal, M. Thornquist, I. B. King, G. E. Goodman, and C. B. Ambrosone Polymorphisms in Oxidative Stress-Related Genes Are Not Associated with Prostate Cancer Risk in Heavy Smokers Cancer Epidemiol. Biomarkers Prev., June 1, 2007; 16(6): 1115 - 1120. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Walshe, M. M. Serewko-Auret, N. Teakle, S. Cameron, K. Minto, L. Smith, P. C. Burcham, T. Russell, G. Strutton, A. Griffin, et al. Inactivation of Glutathione Peroxidase Activity Contributes to UV-Induced Squamous Cell Carcinoma Formation Cancer Res., May 15, 2007; 67(10): 4751 - 4758. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Mathers and J. E. Hesketh The Biological Revolution: Understanding the Impact of SNPs on Diet-Cancer Interrelationships J. Nutr., January 1, 2007; 137(1): 253S - 258S. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Diwadkar-Navsariwala, G. S. Prins, S. M. Swanson, L. A. Birch, V. H. Ray, S. Hedayat, D. L. Lantvit, and A. M. Diamond Selenoprotein deficiency accelerates prostate carcinogenesis in a transgenic model PNAS, May 23, 2006; 103(21): 8179 - 8184. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Ketelslegers, R. W.H. Gottschalk, R. W.L. Godschalk, A. M. Knaapen, F. J. van Schooten, R. F.M.H. Vlietinck, J. C.S. Kleinjans, and J. H.M. van Delft Interindividual variations in DNA adduct levels assessed by analysis of multiple genetic polymorphisms in smokers. Cancer Epidemiol. Biomarkers Prev., April 1, 2006; 15(4): 624 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ravn-Haren, A. Olsen, A. Tjonneland, L. O. Dragsted, B. A. Nexo, H. Wallin, K. Overvad, O. Raaschou-Nielsen, and U. Vogel Associations between GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol consumption and breast cancer risk in a prospective cohort study Carcinogenesis, April 1, 2006; 27(4): 820 - 825. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sutton, P. Nahon, D. Pessayre, P. Rufat, A. Poire, M. Ziol, D. Vidaud, N. Barget, N. Ganne-Carrie, N. Charnaux, et al. Genetic polymorphisms in antioxidant enzymes modulate hepatic iron accumulation and hepatocellular carcinoma development in patients with alcohol-induced cirrhosis. Cancer Res., March 1, 2006; 66(5): 2844 - 2852. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cebrian, P. D. Pharoah, S. Ahmed, P. L. Smith, C. Luccarini, R. Luben, K. Redman, H. Munday, D. F. Easton, A. M. Dunning, et al. Tagging Single-Nucleotide Polymorphisms in Antioxidant Defense Enzymes and Susceptibility to Breast Cancer Cancer Res., January 15, 2006; 66(2): 1225 - 1233. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hu, R. V. Benya, R. E. Carroll, and A. M. Diamond Allelic Loss of the Gene for the GPX1 Selenium-Containing Protein Is a Common Event in Cancer J. Nutr., December 1, 2005; 135(12): 3021S - 3024S. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ahn, M. D. Gammon, R. M. Santella, M. M. Gaudet, J. A. Britton, S. L. Teitelbaum, M. B. Terry, A. I. Neugut, and C. B. Ambrosone No Association Between Glutathione Peroxidase Pro198Leu Polymorphism and Breast Cancer Risk Cancer Epidemiol. Biomarkers Prev., October 1, 2005; 14(10): 2459 - 2461. [Full Text] [PDF] |
||||
![]() |
B. A. Carlson, X.-M. Xu, V. N. Gladyshev, and D. L. Hatfield Selective Rescue of Selenoprotein Expression in Mice Lacking a Highly Specialized Methyl Group in Selenocysteine tRNA J. Biol. Chem., February 18, 2005; 280(7): 5542 - 5548. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Cox, S. E. Hankinson, P. Kraft, and D. J. Hunter No Association between GPX1 Pro198Leu and Breast Cancer Risk Cancer Epidemiol. Biomarkers Prev., November 1, 2004; 13(11): 1821 - 1822. [Full Text] [PDF] |
||||
![]() |
V. Diwadkar-Navsariwala and A. M. Diamond The Link between Selenium and Chemoprevention: A Case for Selenoproteins J. Nutr., November 1, 2004; 134(11): 2899 - 2902. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang, W.R. Bamlet, J.O. Ebbert, W.R. Taylor, and M. de Andrade Glutathione pathway genes and lung cancer risk in young and old populations Carcinogenesis, October 1, 2004; 25(10): 1935 - 1944. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Diamond On the road to selenocysteine PNAS, September 14, 2004; 101(37): 13395 - 13396. [Full Text] [PDF] |
||||
![]() |
J. A. Milner Molecular Targets for Bioactive Food Components J. Nutr., September 1, 2004; 134(9): 2492S - 2498S. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Vogel, A. Olsen, H. Wallin, K. Overvad, A. Tjonneland, and B. A. Nexo No Association between GPX Pro198Leu and Risk of Basal Cell Carcinoma Cancer Epidemiol. Biomarkers Prev., August 1, 2004; 13(8): 1412 - 1413. [Full Text] [PDF] |
||||
![]() |
P. R. Taylor, H. L. Parnes, and S. M. Lippman Science Peels the Onion of Selenium Effects on Prostate Carcinogenesis J Natl Cancer Inst, May 5, 2004; 96(9): 645 - 647. [Full Text] [PDF] |
||||
![]() |
K. Felix, S. Gerstmeier, A. Kyriakopoulos, O. M. Z. Howard, H.-F. Dong, M. Eckhaus, D. Behne, G. W. Bornkamm, and S. Janz Selenium Deficiency Abrogates Inflammation-Dependent Plasma Cell Tumors in Mice Cancer Res., April 15, 2004; 64(8): 2910 - 2917. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, M. R. Spitz, C. I. Amos, J. Lin, M. B. Schabath, and X. Wu An Evolutionary Perspective on Single-Nucleotide Polymorphism Screening in Molecular Cancer Epidemiology Cancer Res., March 15, 2004; 64(6): 2251 - 2257. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Knight, U. V. Onay, S. Wells, H. Li, E. J. Q. Shi, I. L. Andrulis, and H. Ozcelik Genetic Variants of GPX1 and SOD2 and Breast Cancer Risk at the Ontario Site of the Breast Cancer Family Registry Cancer Epidemiol. Biomarkers Prev., January 1, 2004; 13(1): 146 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Milner Incorporating Basic Nutrition Science into Health Interventions for Cancer Prevention J. Nutr., November 1, 2003; 133(11): 3820S - 3826. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Nair, H. Bartsch, and J. Nair Prevention of degenerative diseases; clues from studies investigating oxidative stress, Brussels, 13 November 2002 Mutagenesis, September 1, 2003; 18(5): 477 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Moustafa, E. Kumaraswamy, N. Zhong, M. Rao, B. A. Carlson, and D. L. Hatfield Models for Assessing the Role of Selenoproteins in Health J. Nutr., July 1, 2003; 133(7): 2494S - 2496. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. J. Hu and A. M. Diamond Role of Glutathione Peroxidase 1 in Breast Cancer: Loss of Heterozygosity and Allelic Differences in the Response to Selenium Cancer Res., June 15, 2003; 63(12): 3347 - 3351. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Duffield-Lillico, M. E. Reid, B. W. Turnbull, G. F. Combs Jr., E. H. Slate, L. A. Fischbach, J. R. Marshall, and L. C. Clark Baseline Characteristics and the Effect of Selenium Supplementation on Cancer Incidence in a Randomized Clinical Trial: A Summary Report of the Nutritional Prevention of Cancer Trial Cancer Epidemiol. Biomarkers Prev., July 1, 2002; 11(7): 630 - 639. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |