Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ratnasinghe, D.
Right arrow Articles by Albanes, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ratnasinghe, D.
Right arrow Articles by Albanes, D.
[Cancer Research 60, 6381-6383, November 15, 2000]
© 2000 American Association for Cancer Research


Regular Articles

Glutathione Peroxidase Codon 198 Polymorphism Variant Increases Lung Cancer Risk1

Duminda Ratnasinghe2, Joseph A. Tangrea, Mark R. Andersen, Michael J. Barrett, Jarmo Virtamo, Philip R. Taylor and Demetrius Albanes

Division of Clinical Sciences, National Cancer Institute, NIH, Bethesda, Maryland 20892-7058 [D. R., J. A. T., P. R. T., D. A.]; New Chemical Entities, Inc., Thetagen Division, Bothell, Washington 98011 [M. R. A.]; Information Management Services, Inc., Silver Spring, Maryland 20904 [M. J. B.]; and National Public Health Institute, SF–00300 Helsinki, Finland [J. V.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human cellular glutathione peroxidase 1 (hGPX1) is a selenium-dependent enzyme that participates in the detoxification of hydrogen peroxide and a wide range of organic peroxides. We conducted a case-control study nested within the {alpha}-Tocopherol, ß-Carotene Cancer Prevention Study cohort to evaluate the association between the proline to leucine polymorphism at codon 198 of hGPX1 and lung cancer risk. Cases (n = 315) were matched to controls on age (±5 years), intervention group, and study clinic using incidence density sampling in a 1:1 ratio. The prevalence of the hGPX1 Pro198leu variant allele was 58% for controls and 71% for cases (P < 0.001). Using conditional logistic regression, we found a significant association between hGPX1 genotype and lung cancer risk. The odds ratio for heterozygotes was 1.8 (95% confidence interval, 1.2–2.8) and 2.3 (95% confidence interval, 1.3–3.8) for homozygous variants compared to wild-type individuals. Due to its high prevalence, the hGPX1 variant may contribute significantly to lung cancer risk among Caucasians but not among ethnic Chinese who do not exhibit this polymorphism.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although environmental and industrial exposures such as radon can increase lung cancer risk, it is well established that tobacco smoke is principally responsible for the incidence of this malignancy. However, not all persons exposed to high concentrations of airborne carcinogens develop lung cancer. Differences in lung cancer risk among individuals with similar carcinogen exposures may be due to genetic predisposition and dietary factors that have been shown to modulate or neutralize carcinogen-derived oxidative radicals.

The risk of developing cancer is determined by both the number and nature of cumulative carcinogenic exposures and by individual genetic variation (1) . For example, genetic polymorphisms in detoxification enzymes can substantially alter the magnitude of exposure to carcinogenic substances. hGPX13 is a selenium-dependent enzyme that participates in the detoxification of hydrogen peroxide and a wide range of organic peroxides with reduced glutathione (2) . From a sequence analysis of lung tumor specimens, Moscow et al. (3) reported a nucleotide substitution at codon 198 of hGPX1, resulting in the substitution of leucine for proline. They also reported that other polymorphisms cosegregate with the proline to leucine substitution, including six alanines in the polyalanine sequence (instead of five or seven alanines with the wild-type proline), a T for C substitution at +2, and a G for A substitution at -592.

In the present study, we sought to confirm the presence of an hGPX1 germ-line codon 198 (Pro198leu) polymorphism among members of a cancer prevention trial in Finland and explored the association between the polymorphism and lung cancer risk. We also examined whether age, smoking behavior, serum antioxidant levels, or the trial antioxidant supplementation could modify the hGPX1-lung cancer association.


    PATIENTS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study Cohort.
The cases and controls for this study were selected from the cohort of the {alpha}-Tocopherol, ß-Carotene Cancer Prevention Study, a randomized, placebo-controlled prevention trial designed to determine whether {alpha}-tocopherol (50 mg/day), ß-carotene (20 mg/day), or both would reduce the incidence of lung, prostate and other cancers. The overall design, rationale, and objectives of this study have been published, as have the main trial findings (4, 5, 6) . The trial was conducted between 1985 and 1993 in southwestern Finland as a joint project between the National Public Health Institute of Finland and the National Cancer Institute of the United States. Potential participants, all men aged 50–69 years residing in southwestern Finland (n = 290,406) were identified from the computer list of the national population registry of Finland. Participants (29,133) had to be current smokers of five or more cigarettes per day, eligible and willing to participate, and give informed consent. Information on variables that possibly could confound the association between the polymorphism of hGPX1 and lung cancer risk were available from {alpha}-Tocopherol, ß-Carotene Cancer Prevention Study baseline questionnaires. Baseline measurements of serum {alpha}-tocopherol and ß-carotene levels were also available.

Selection of Cases and Controls.
The cases consist of 315 men diagnosed with primary lung cancer (ICD-9, 162) during the years 1985–1994 among those who gave a whole blood sample in 1992 and 1993. Seventy-eight percent of the cases donated blood before cancer diagnosis. Using incidence density sampling, the controls were selected from cohort participants who were alive and free of cancer at the time the matched case was diagnosed. Controls were selected from those who donated blood matched to cases on age (±5 years), intervention group, and study clinic in a 1:1 ratio.

Genotype Analyses.
PCR primers and dual-labeled allele discrimination probes were designed using PrimerExpress version 1.0 (PE Biosystems). Probes were selected that have a predicted Tm near 68°C, with the polymorphic base near the center. Flanking PCR primers were selected based on the calculated penalty score, Tm, length, and amplimer size. Primers and probes were synthesized and purified by PE Biosystems. Oligonucleotide sequences for primers and probes to detect the C to T polymorphism in codon 198 of hGPX1 were: PCR forward, TGTGCCCCTACGCAGGTACA; PCR reverse, CCCCCGAGACAGCAGCA; C allele probe, VICCTGTCTCAAGGGCCCAGCTGTGCTAMRA; and T allele probe, FAMCTGTCTCAAGGGCTCAGCTGTGCCTTAMRA.

Reactions (10 µl) contained ~20 ng of genomic DNA isolated from whole blood, 1x TaqMan Master Mix, dual-labeled probes (100 nM each), and PCR primers (900 nM each). Reactions were performed in 96-well MicroAmp Optical reaction plates and caps (PE Biosystems). Plates were incubated in PE Biosystems 9600 thermal cyclers at 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 62°C for 1 min. Fluorescence was measured using the ABI Prism 7700 Sequence Detector and analyzed with Sequence Detection System version 1.6.3. Amplified DNA from several individuals exhibiting each genotype was electrophoresed on an agarose gel to confirm amplimer size and sequenced to confirm each genotype. When possible, each plate contained two control DNA samples for each homozygous genotype and four no template controls. All laboratory personnel were blind to the case-control status of the samples. A random sample of 10% was repeated for quality control and was 100% concordant.

Statistical Analyses.
The {chi}2 test for heterogeneity was used to test whether the distribution of allele prevalences was the same for cases and controls. Conditional logistic regression was used to examine the association between genotype and lung cancer risk. Potential confounding of the association between the hGPX1 genotype and cancer risk by other related risk factors was explored using Spearman rank correlation analysis and multivariate logistic regression models, including stepwise regression models. If the potential confounder caused a significant change in the log likelihood estimate (P < 0.05) and a >20% change in the ß-coefficient, it was kept in the model for further multivariate analysis. Modification of the effect of genotype by age, tobacco, {alpha}-tocopherol, and/or ß-carotene supplementation, serum ß-carotene and {alpha}-tocopherol on lung cancer risk was examined by statistical tests of the first order interaction term in the logistic regression models. Exclusion of cases diagnosed before blood draw did not materially alter any of the risk estimates, therefore, all cases were included in the statistical analyses. All analyses were performed using the statistical software package STATA (STATA Corporation, College Station, TX).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Table 1Citation shows a case-control comparison of selected baseline subject characteristics. As expected, cigarette smoking and age-started smoking were significantly different in the cases compared with controls. Levels of serum antioxidants, {alpha}-tocopherol, and ß-carotene were not different in lung cancer cases compared with controls.


View this table:
[in this window]
[in a new window]
 
Table 1 Medians of selected subject baseline characteristics by case-control statusa

 
Table 2Citation shows the association between the hGPX1 genotype and lung cancer risk. The distribution of hGPX1 alleles was different comparing the cases with controls ({chi}2 P for distributions <0.001). In addition, we observed an association between the hGPX1 genotype and lung cancer risk. Individuals with the heterozygous genotype were at 80% greater risk for lung cancer compared to those with the homozygous wild-type (pro/pro) genotype. Individuals with the homozygous variant genotype (leu/leu) were at 130% greater risk for lung cancer compared with homozygous wild-type individuals. Adjustment for baseline covariates such as years smoked or cigarettes smoked per day did not materially alter the risk estimates. However, the risk estimates shown in Table 2Citation were adjusted for years smoked and cigarettes smoked per day because they were significantly associated with lung cancer risk.


View this table:
[in this window]
[in a new window]
 
Table 2 Association between the glutathione peroxidase polymorphism and lung cancer riska

 
We also evaluated the association between the hGPX1 genotype and histological subtypes of lung cancer. The relative risk estimates for squamous cell (n = 140, odds ratio homozygous wild type, heterozygous variant, and homozygous variant; 1.0, 2.4, and 3.2, respectively) and adenocarcinoma (n = 56, odds ratio homozygous wild type, heterozygous variant, and homozygous variant; 1.0, 3.9, and 3.3, respectively) of the lung were statistically significant for both the heterozygous and homozygous variant genotypes compared to those with the homozygous wild-type genotype. By contrast, risk of small cell lung carcinoma (n = 49) was not associated with hGPX1, possibly due to the relatively small number of cases for this subtype. Evaluation of age, cigarette smoking, serum {alpha}-tocopherol and/or ß-carotene at baseline, and trial intervention of {alpha}-tocopherol and/or ß-carotene as potential modifiers of the association between hGPX1 and lung cancer risk showed no statistically significant interactions (data not shown).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A large proportion of lung cancers have a deletion of the short arm of chromosome 3, in the region of 3p21 (7 , 8) . hGPX1 is a selenium-dependent detoxifying enzyme that has been mapped to chromosome 3p21 by in situ hybridization of lymphocyte metaphase spreads (3) . Glutathione peroxidases protect cells against oxidative damage by reducing hydrogen peroxide and a wide range of organic peroxides with reduced glutathione (2) . The cytosolic form of hGPX1 belongs to a family of selenium-dependent peroxidases that include another cytosolic form, hGPX2 (9) , the plasma-based hGPX3 (10) , and the phospholipid hydroperoxidase hGPX4 (11) .

Many studies have shown that selenium increases hGPX1 activity and expression (12, 13, 14) . It is generally assumed that selenium increases the antioxidant capacity of a cell, consequently reducing intracellular oxidative stress. The association between prospectively collected serum selenium and lung cancer has been reported in over a dozen studies (15, 16, 17, 18, 19) . Most of these studies found that selenium concentrations were slightly lower in the lung cancer cases than in controls.

In the current study, we confirm the presence of a germ-line polymorphism in the coding region of hGPX1 with notable prevalence of allele variants among middle-aged Finnish smokers. We also show that individuals with one or two variant alleles were at increased risk of lung cancer compared with homozygous wild-type individuals. One possible explanation for the increased lung cancer risk observed among individuals with just one variant allele is that, because different hGPX1 alleles encode structurally different hGPX1 subunits, heterozygote individuals may have a less efficient final glutathione peroxidase complex. In addition, serum antioxidant levels or supplements of {alpha}-tocopherol (50 mg daily) or ß-carotene (20 mg daily) did not seem to modify lung cancer risk associated with the variant hGPX1 genotypes. This may be due to lack of chemical reactivity of {alpha}-tocopherol and/or ß-carotene with hydrogen peroxide or organic peroxides. Smoking also did not modify the risk of lung cancer due to hGPX1 variants.

The association we report here is complicated by the other polymorphisms that cosegregate with the codon 198 polymorphism. These polymorphisms include six alanines in the hGPX1 polyalanine sequence (instead of five or seven alanines with the wild-type proline), a T for C substitution at +2, and a G for A substitution at -592 with the proline to leucine substitution. Although the exact structural or functional consequences of these hGPX1 coding region polymorphisms are not known, the substitution of the {alpha}-imino acid proline (cyclic amino acid) by leucine is probably the polymorphism that causes the most profound secondary and tertiary conformational change of hGPX1, because proline is the only amino acid without a free unsubstituted amino group on the {alpha} carbon atom and is known to cause a unique kink in the secondary structure of peptides.

One of the strengths of this study is its prospective design. The collection of covariate data (e.g., smoking) before case diagnoses minimized the potential for recall bias. The availability of detailed exposure data also allowed us to explore several relevent gene-environment interactions. The availability of data on prospective serum antioxidant levels and supplements of {alpha}-tocopherol or ßcarotene given during the intervention trial added another dimension to our study because of the antioxidant functions of hGPX1. The generalizability of these results, however, may be somewhat restricted because the study was conducted among Finnish male smokers. Other case-control studies examining the association of hGPX1 polymorphisms and lung cancer risk are clearly needed. In future studies, our group will attempt to examine the association between the hGPX1 polymorphism and lung cancer risk in other Caucasian populations. Our analysis of ethnic Chinese members of the Yunnan tin corporation cohort (20) revealed that they do not exhibit the codon 198 hGPX1 polymorphism (all 92 noncase samples analyzed were wild type).

In summary, we show that the codon 198 hGPX1 polymorphism is associated with increased risk of lung cancer among male smokers. We also found that neither smoking nor supplementation with either {alpha}-tocopherol and/or ß-carotene altered the association between the hGPX1 proline to leucine substitution polymorphism and risk of lung cancer. Because of its high prevalence, the codon 198 variant allele of hGPX1 may have substantial public health impact by influencing lung cancer risk among Caucasians but not among ethnic Chinese.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by USPHS National Cancer Institute contract NO1-CN45165 from the National Cancer Institute, NIH, Department of Health and Human Services. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organization imply endorsement by the United States Government. Back

2 To whom requests for reprints should be addressed, at Division of Clinical Sciences, Cancer Prevention Studies Branch, 6006 Executive Boulevard, MSC 7058, Bethesda, MD 20892-7058. E-mail: DR132K{at}NIH.gov Back

3 The abbreviation used is: hGPX1, human glutathione peroxidase 1. Back

Received 3/ 2/00. Accepted 9/13/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kitson K. E., Watanabe J., Eguchi H., Hayashi S. Genetic polymorphisms of drug-metabolizing enzymes and lung cancer susceptibility. Pharmacogenetics, 5: 70-73, 1995.
  2. Flohe L. Glutathione peroxidase. Basic Life Sci., 49: 663-668, 1988.[Medline]
  3. Moscow J. A., Schmidt L., Ingram D. T., Gnarra J., Johnson B., Cowan K. H. Loss of heterozygosity of the human cytosolic glutathione peroxidase I gene in lung cancer. Carcinogenesis (Lond.), 15: 2769-2773, 1994.[Abstract/Free Full Text]
  4. Taylor P. R., Dawsey S., Albanes D. Cancer prevention trials in China and Finland. Ann. Epidemiol., 1: 195-203, 1990.[Medline]
  5. ATBC Cancer Prevention Study Group. The effect of vitamin E and ß-carotene on the incidence of lung cancer and other cancers in male smokers. N. Engl. J. Med., 330: 1029–1035, 1994.
  6. Albanes D., Heinonen O. P., Taylor P. R., Virtamo J., Edwards B. K., Rautalahti M., Hartman A. M., Palmgren J., Freedman L. S., Haapakoski J., Barrett M. J., Pietinen P., Malila N., Tala E., Liippo K., Salomaa E. R., Tangrea J. A., Teppo L., Askin F. B., Taskinen E., Erozan Y., Greenwald P., Huttunen J. K. {alpha}-Tocopherol and ß-carotene supplements and lung cancer incidence in the {alpha}-tocopherol, ß-carotene cancer prevention study: effects of base-line characteristics and study compliance. J. Natl. Cancer Inst., 88: 1560-1570, 1996.[Abstract/Free Full Text]
  7. Whang-Peng J., Knutsen T., Gazdar A., Steinberg S. M., Oie H., Linnoila I., Mulshine J., Nau M., Minna J. D. Nonrandom structural and numerical chromosome changes in non-small cell lung cancer. Genes Chromosomes Cancer, 3: 168-188, 1991.[Medline]
  8. Yokoyama S., Yamakawa K., Tsuchiya E., Murata M., Sakiyama S., Nakamura Y. Deletion mapping on the short arm of chromosome 3 in squamous cell carcinoma and adenocarcinoma of the lung. Cancer Res., 52: 873-877, 1992.[Abstract/Free Full Text]
  9. Chu F. F., Doroshow J. H., Esworthy R. S. Expression, characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase. GSHPx-GI. J. Biol. Chem., 268: 2571-2576, 1993.[Abstract/Free Full Text]
  10. Takahashi K., Akasaka M., Yamamoto Y., Kobayashi C., Mizoguchi J., Koyama J. Primary structure of human plasma glutathione peroxidase deduced from cDNA sequences. J. Biochem. (Tokyo), 108: 145-148, 1990.[Abstract/Free Full Text]
  11. Maiorino M., Chu F. F., Ursini F., Davies K. J., Doroshow J. H., Esworthy R. S. Phospholipid hydroperoxide glutathione peroxidase is the 18-kDa selenoprotein expressed in human tumor cell lines. J. Biol. Chem., 266: 7728-7732, 1991.[Abstract/Free Full Text]
  12. Moscow J. A., Morrow C. S., He R., Mullenbach G. T., Cowan K. H. Structure and function of the 5'-flanking sequence of the human cytosolic selenium-dependent glutathione peroxidase gene (hgpx1). J. Biol. Chem., 267: 5949-5958, 1992.[Abstract/Free Full Text]
  13. Chada S., Whitney C., Newburger P. E. Post-transcriptional regulation of glutathione peroxidase gene expression by selenium in the HL-60 human myeloid cell line. Blood, 74: 2535-2541, 1989.[Abstract/Free Full Text]
  14. Saedi M. S., Smith C. G., Frampton J., Chambers I., Harrison P. R., Sunde R. A. Effect of selenium status on mRNA levels for glutathione peroxidase in rat liver. Biochem. Biophys. Res. Commun., 153: 855-861, 1988.[Medline]
  15. Willett W. C., Polk B. F., Morris J. S., Stampfer M. J., Pressel S., Rosner B., Taylor J. O., Schneider K., Hames C. G. Prediagnostic serum selenium and risk of cancer. Lancet, 2: 130-134, 1983.[Medline]
  16. Menkes M. S., Comstock G. W., Vuilleumier J. P., Helsing K. J., Rider A. A., Brookmeyer R. Serum ß-carotene, vitamins A and E, selenium, and the risk of lung cancer. N. Engl. J. Med., 315: 1250-1254, 1986.[Abstract]
  17. Kok F. J., van Duijn C. M., Hofman A., Vermeeren R., de Bruijn A. M., Valkenburg H. A. Antioxidants and the risk of lung cancer. N. Engl. J. Med., 316: 1416 1987.[Medline]
  18. Comstock G. W., Alberg A. J., Huang H. Y., Wu K., Burke A. E., Hoffman S. C., Norkus E. P., Gross M., Cutler R. G., Morris J. S., Spate V. L., Helzlsouer K. J. The risk of developing lung cancer associated with antioxidants in the blood: ascorbic acid, carotenoids, {alpha}-tocopherol, selenium, and total peroxyl radical absorbing capacity. Cancer Epidemiol. Biomark. Prev., 6: 907-916, 1997.[Abstract]
  19. Ratnasinghe D., Tangrea J. A., Forman M. R., Hartman T., Gunter E. W., Qiao Y-L., Yao S-X., Barett M. J., Giffen C. A., Erozan Y., Tockman M. S., Taylor P. R. Serum tocopherols, selenium and lung cancer risk among tin miners in China. Cancer Causes Control, 11: 129-135, 2000.[Medline]
  20. Qiao Y. L., Taylor P. R., Yao S. X., Schatzkin A., Mao B. L., Lubin J., Rao J. Y., McAdams M., Xuan X. Z., Li J. Y. Relation of radon exposure and tobacco use to lung cancer among tin miners in Yunnan Province, China. Am. J. Ind. Med., 16: 511-521, 1989.[Medline]



This article has been cited by other articles:


Home page
JCOHome page
M. Udler, A.-T. Maia, A. Cebrian, C. Brown, D. Greenberg, M. Shah, C. Caldas, A. Dunning, D. Easton, B. Ponder, et al.
Common Germline Genetic Variation in Antioxidant Defense Genes and Survival After Diagnosis of Breast Cancer
J. Clin. Oncol., July 20, 2007; 25(21): 3015 - 3023.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J.-Y. Choi, M. L. Neuhouser, M. Barnett, M. Hudson, A. R. Kristal, M. Thornquist, I. B. King, G. E. Goodman, and C. B. Ambrosone
Polymorphisms in Oxidative Stress-Related Genes Are Not Associated with Prostate Cancer Risk in Heavy Smokers
Cancer Epidemiol. Biomarkers Prev., June 1, 2007; 16(6): 1115 - 1120.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Walshe, M. M. Serewko-Auret, N. Teakle, S. Cameron, K. Minto, L. Smith, P. C. Burcham, T. Russell, G. Strutton, A. Griffin, et al.
Inactivation of Glutathione Peroxidase Activity Contributes to UV-Induced Squamous Cell Carcinoma Formation
Cancer Res., May 15, 2007; 67(10): 4751 - 4758.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. C. Mathers and J. E. Hesketh
The Biological Revolution: Understanding the Impact of SNPs on Diet-Cancer Interrelationships
J. Nutr., January 1, 2007; 137(1): 253S - 258S.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Diwadkar-Navsariwala, G. S. Prins, S. M. Swanson, L. A. Birch, V. H. Ray, S. Hedayat, D. L. Lantvit, and A. M. Diamond
Selenoprotein deficiency accelerates prostate carcinogenesis in a transgenic model
PNAS, May 23, 2006; 103(21): 8179 - 8184.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
H. B. Ketelslegers, R. W.H. Gottschalk, R. W.L. Godschalk, A. M. Knaapen, F. J. van Schooten, R. F.M.H. Vlietinck, J. C.S. Kleinjans, and J. H.M. van Delft
Interindividual variations in DNA adduct levels assessed by analysis of multiple genetic polymorphisms in smokers.
Cancer Epidemiol. Biomarkers Prev., April 1, 2006; 15(4): 624 - 629.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
G. Ravn-Haren, A. Olsen, A. Tjonneland, L. O. Dragsted, B. A. Nexo, H. Wallin, K. Overvad, O. Raaschou-Nielsen, and U. Vogel
Associations between GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol consumption and breast cancer risk in a prospective cohort study
Carcinogenesis, April 1, 2006; 27(4): 820 - 825.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Sutton, P. Nahon, D. Pessayre, P. Rufat, A. Poire, M. Ziol, D. Vidaud, N. Barget, N. Ganne-Carrie, N. Charnaux, et al.
Genetic polymorphisms in antioxidant enzymes modulate hepatic iron accumulation and hepatocellular carcinoma development in patients with alcohol-induced cirrhosis.
Cancer Res., March 1, 2006; 66(5): 2844 - 2852.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Cebrian, P. D. Pharoah, S. Ahmed, P. L. Smith, C. Luccarini, R. Luben, K. Redman, H. Munday, D. F. Easton, A. M. Dunning, et al.
Tagging Single-Nucleotide Polymorphisms in Antioxidant Defense Enzymes and Susceptibility to Breast Cancer
Cancer Res., January 15, 2006; 66(2): 1225 - 1233.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
Y. Hu, R. V. Benya, R. E. Carroll, and A. M. Diamond
Allelic Loss of the Gene for the GPX1 Selenium-Containing Protein Is a Common Event in Cancer
J. Nutr., December 1, 2005; 135(12): 3021S - 3024S.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Ahn, M. D. Gammon, R. M. Santella, M. M. Gaudet, J. A. Britton, S. L. Teitelbaum, M. B. Terry, A. I. Neugut, and C. B. Ambrosone
No Association Between Glutathione Peroxidase Pro198Leu Polymorphism and Breast Cancer Risk
Cancer Epidemiol. Biomarkers Prev., October 1, 2005; 14(10): 2459 - 2461.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. A. Carlson, X.-M. Xu, V. N. Gladyshev, and D. L. Hatfield
Selective Rescue of Selenoprotein Expression in Mice Lacking a Highly Specialized Methyl Group in Selenocysteine tRNA
J. Biol. Chem., February 18, 2005; 280(7): 5542 - 5548.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
D. G. Cox, S. E. Hankinson, P. Kraft, and D. J. Hunter
No Association between GPX1 Pro198Leu and Breast Cancer Risk
Cancer Epidemiol. Biomarkers Prev., November 1, 2004; 13(11): 1821 - 1822.
[Full Text] [PDF]


Home page
J. Nutr.Home page
V. Diwadkar-Navsariwala and A. M. Diamond
The Link between Selenium and Chemoprevention: A Case for Selenoproteins
J. Nutr., November 1, 2004; 134(11): 2899 - 2902.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Yang, W.R. Bamlet, J.O. Ebbert, W.R. Taylor, and M. de Andrade
Glutathione pathway genes and lung cancer risk in young and old populations
Carcinogenesis, October 1, 2004; 25(10): 1935 - 1944.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. M. Diamond
On the road to selenocysteine
PNAS, September 14, 2004; 101(37): 13395 - 13396.
[Full Text] [PDF]


Home page
J. Nutr.Home page
J. A. Milner
Molecular Targets for Bioactive Food Components
J. Nutr., September 1, 2004; 134(9): 2492S - 2498S.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
U. Vogel, A. Olsen, H. Wallin, K. Overvad, A. Tjonneland, and B. A. Nexo
No Association between GPX Pro198Leu and Risk of Basal Cell Carcinoma
Cancer Epidemiol. Biomarkers Prev., August 1, 2004; 13(8): 1412 - 1413.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
P. R. Taylor, H. L. Parnes, and S. M. Lippman
Science Peels the Onion of Selenium Effects on Prostate Carcinogenesis
J Natl Cancer Inst, May 5, 2004; 96(9): 645 - 647.
[Full Text] [PDF]


Home page
Cancer Res.Home page
K. Felix, S. Gerstmeier, A. Kyriakopoulos, O. M. Z. Howard, H.-F. Dong, M. Eckhaus, D. Behne, G. W. Bornkamm, and S. Janz
Selenium Deficiency Abrogates Inflammation-Dependent Plasma Cell Tumors in Mice
Cancer Res., April 15, 2004; 64(8): 2910 - 2917.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Zhu, M. R. Spitz, C. I. Amos, J. Lin, M. B. Schabath, and X. Wu
An Evolutionary Perspective on Single-Nucleotide Polymorphism Screening in Molecular Cancer Epidemiology
Cancer Res., March 15, 2004; 64(6): 2251 - 2257.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. A. Knight, U. V. Onay, S. Wells, H. Li, E. J. Q. Shi, I. L. Andrulis, and H. Ozcelik
Genetic Variants of GPX1 and SOD2 and Breast Cancer Risk at the Ontario Site of the Breast Cancer Family Registry
Cancer Epidemiol. Biomarkers Prev., January 1, 2004; 13(1): 146 - 149.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. A. Milner
Incorporating Basic Nutrition Science into Health Interventions for Cancer Prevention
J. Nutr., November 1, 2003; 133(11): 3820S - 3826.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
U. Nair, H. Bartsch, and J. Nair
Prevention of degenerative diseases; clues from studies investigating oxidative stress, Brussels, 13 November 2002
Mutagenesis, September 1, 2003; 18(5): 477 - 483.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. E. Moustafa, E. Kumaraswamy, N. Zhong, M. Rao, B. A. Carlson, and D. L. Hatfield
Models for Assessing the Role of Selenoproteins in Health
J. Nutr., July 1, 2003; 133(7): 2494S - 2496.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. J. Hu and A. M. Diamond
Role of Glutathione Peroxidase 1 in Breast Cancer: Loss of Heterozygosity and Allelic Differences in the Response to Selenium
Cancer Res., June 15, 2003; 63(12): 3347 - 3351.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. J. Duffield-Lillico, M. E. Reid, B. W. Turnbull, G. F. Combs Jr., E. H. Slate, L. A. Fischbach, J. R. Marshall, and L. C. Clark
Baseline Characteristics and the Effect of Selenium Supplementation on Cancer Incidence in a Randomized Clinical Trial: A Summary Report of the Nutritional Prevention of Cancer Trial
Cancer Epidemiol. Biomarkers Prev., July 1, 2002; 11(7): 630 - 639.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ratnasinghe, D.
Right arrow Articles by Albanes, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ratnasinghe, D.
Right arrow Articles by Albanes, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online