| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
-3 Fatty Acid on Growth Inhibition of Breast Cancer Cells1
Departments of Radiation Oncology [M. W., Y. E. L., I. D. G., Y. E. S.] and Pediatrics [B. A.], Long Island Jewish Medical Center, The Long Island Campus for The Albert Einstein College of Medicine, New Hyde Park, New York 11040, and Human Genome Sciences, Inc., Rockville, Maryland 20850-3338 [J. N.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-3 polyunsaturated fatty acids (-3
PUFAs) on growth inhibition were investigated. MRG protein
expression was associated with human mammary gland differentiation,
with the highest expression observed in the differentiated alveolar
mammary epithelial cells from the lactating gland. Overexpression of
MRG in human breast cancer cells induced differentiation with changes
in cellular morphology and a significant increase in the production of
lipid droplets. Treatment of mouse mammary gland in organ culture with
MRG protein resulted in a differentiated morphology and stimulation of
ß-casein expression. Treatment of human breast cancer cells with the
-3 PUFA docosahexaenoic acid resulted in a differential
growth inhibition proportional to their MRG expression. MRG-transfected
cells or MRG protein treated cells were much more sensitive to
docosahexaenoic acid-induced growth inhibition than MRG-negative or
untreated control cells. Our results suggest that MRG is a candidate
mediator of the differentiating effect of pregnancy on breast
epithelial cells and may play a major role in -3 PUFA-mediated tumor
suppression. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
It is well established that -3 PUFAs, primarily DHA and EPA in fish
oil, suppress mammary tumorigenesis in vivo and breast
cancer cell proliferation in vitro (12, 13, 14, 15, 16, 17, 18, 19, 20, 21)
. As
a member of FABP, it has been reported that -3 PUFA DHA is the
physiological ligand for mouse MRG (B-FABP), based on its high binding
affinity (Kd = 10
nM; Ref. 22
). We have demonstrated
that the gene encoding MRG has a strong tumor suppressor activity
(1)
. The magnitude of the tumor-suppressing activity of
MRG on mammary tumor is comparable to that observed previously for
Rb and p53 (23)
. In the current
study, we investigated the effects of MRG on mammary differentiation
and its interaction with DHA on the growth of breast cancer cells. Our
data suggest that MRG is a differentiation factor for breast epithelial
cells and that it may play a major role in DHA-mediated growth
suppression of breast cancer cells.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Preparation of Anti-MRG Antibody.
A peptide sequence corresponding to amino acids 43–57 (1)
was chosen for developing of the antibody because of its unique
sequence for MRG. The peptide synthesis, purification, conjugation, and
immunization of rabbits were conducted as we described previously
(24)
. For final purification, a MRG peptide
affinity column was made by conjugating 20 mg of MRG peptide to 5 ml of
Aminolink resin (Pierce Chemical Co.), using sodium cyanoborohydride
(Sigma).
Immunohistochemical Staining.
As we described previously (1
, 25)
, deparaffinized,
rehydrated, and acid-treated human breast sections (5 µm thick) were
treated with H2O2 and
trypsin, and blocked with normal goat serum. Sections were incubated
with a specific anti-MRG polyclonal antibody (1 µg/ml) at 4°C
overnight, followed by incubation with biotin-conjugated secondary
antirabbit antibodies (DAKO). The colorimetric detection was performed
using a standard indirect streptavidin-biotin immunoreaction method
with DAKO’s Universal LSAB Kit according to the manufacturer’s
instructions. There were some variations in staining intensity for MRG
expression among the specimens. The negative cases were confirmed with
at least two independent experiments. All stainings were reviewed by
two pathologists.
Preparation of MRGp.
The full-length MRG was amplified using standard PCR techniques with
primers corresponding to the 5' and 3' sequences of the gene (5'
primer, GGATCCCGTGGAGGCTTTCTGT; 3' primer,
GGTACCCCAGGGACATTTTTA). The amplified fragment was gel-purified,
and the DNA sequence was confirmed. As we described previously
(24)
, a baculovirus expression vector, pA2-GP, was used to
transform Sf9 cells. The purification of MRGp was performed as follows:
(a) Medium supernatant, adjusted to pH 5.5, was first
applied to tandem Poros HS/HQ columns (PerSeptive Biosystems)
preequilibrated with 50 mM NaOAc (pH 5.5).
(b) MRGp, collected in the flowthrough fraction, was
adjusted to pH 8.0 and reapplied to the tandem Poros HS/HQ column
preequilibrated with 20 mM Tris-HCl (pH 8.0).
(c) MRGp, collected in the flowthrough fraction, was
concentrated 50-fold, using a Filtron 3000
Mr cutoff tangential-flow system and
then separated on a Superdex-75 size-exclusion column equilibrated with
10 mM NaOAc (pH 6.5). (d) Pooled MRGp
fractions were applied to a hydroxyapatite column equilibrated with 10
mM NaOAc (pH 6.5); the weakly bound MRGp was
eluted with 7.5 mM
K2HPO4 (pH 6.8).
(e) MRGp fractions were then separated on a Superdex-75
size-exclusion column equilibrated with 65 mM
Na2HPO4, 100
mM NaCl (pH 7.2). MRGp fractions were pooled and
found to be >98% pure by SDS-PAGE with an endotoxin level <0.5
endotoxin units/mg. Purified MRGp was identified as a single
band at 18 kDa in the SDS-PAGE by silver staining. The protein was
analyzed for glycosylation by determining the monosaccharide content in
a purified preparation, and the N-linked sugar chains were confirmed.
Cell Morphology on Matrigel.
Cell morphology was determined using Matrigel-coated wells. Briefly,
6-well culture plates were coated with growth factor-reduced Matrigel
(Collaborative Research) at 0.5 ml/well. Cells were then cultured in
the coated wells with DMEM containing 5% fetal bovine serum.
The cell morphology was observed under the microscope after 4 days.
Detection of Cytoplasmic Lipids in Breast Cancer Cells.
Lipid accumulation was detected by oil red O-isopropanol
staining as described previously (26)
. The cells were
cultured on either Matrigel-coated plates or regular uncoated plates.
After 4 days, the cells were fixed by 10% formaldehyde and subjected
to oil red O-isopropanol staining. Accumulated lipids in the
cells were stained red, and nuclei were stained blue by hematoxylin.
Three independent observers counted the positive cells, and each
observer randomly counted three fields (x40). The numbers represent
the average percentage of lipid accumulate cells from nine fields
(x40).
Western Analysis.
Western blot analysis was conducted as we described previously
(24)
. Briefly, the blot was incubated with anti-MRG
primary antibody (1:800 dilution) overnight at 4°C, and then
incubated with goat antirabbit IgG-horseradish peroxidase (1:6000
dilution) for 1 h, washed, and visualized by chemiluminescence.
Mammary Gland Organ Culture.
Whole second thoracic mammary glands were removed from 7- and
10-week-old virgin female mice (FVB/n background) as described
previously (27)
. The glands were cultured in medium 199
containing 5% FCS, with medium changed every 2 days. The medium was
supplemented with following components from Clonetics: bovine pituitary
extract (52 µg/ml), insulin (5 µg/ml), epidermal growth
factor (10 ng/ml), and hydrocortisone (1 µg/ml).
In Vitro Assay for Cell Growth.
Cells were seeded in triplicate at 3000 cells/well (24-well plate) in 1
ml of DMEM-5% serum. For treatments with DHA or MRGp, cells were
cultured in DMEM-1% serum. Cell growth was measured using the
CellTiter 96 Aqueous Nonradioactive Cell Proliferation Assay Kit
(Promega Corporation, Madison, WI).
Statistical Analysis.
Values were expressed as means ± SD. Statistical
comparisons were made using the two-tailed Student’s t
test.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Fig. 1
shows a representative immunohistochemical staining for MRG. The
terminally differentiated lactating mammary gland is characterized by
ducts branching into distended and large lipid-rich active secretory
lobuloalveolar structures. An increase in cell volume as a result of
cytoplasmic vacuolation and the presence of secretory vesicles
containing milk proteins was clearly noted in the lactating gland (Fig. 1B)
. We found strongly positive MRG protein staining in the
alveolar mammary epithelial cells from the lactating mammary gland
(Fig. 1C)
. The expression of MRG protein was clearly
detectable in the alveolar epithelial cells in all five lactating
mammary glands. In contrast, either no detectable MRG protein staining
or very weak MRG protein expression was visualized in eight of the
nonpregnant normal breast reduction mammoplasty specimens from
nulliparous women (Fig. 1D)
. Expression of MRG protein was
absent in all 10 cases of malignant breast carcinomas (Fig. 1E)
.
|
. The purified 18-kDa protein was confirmed as MRG by
Western blot using a specific anti-MRG antibody (Fig. 2B)
.
|
shows the MRG protein expression in MRG-231-10 and
MRG-231-6 cells, two MRG-positive clones, but not in parental
MDA-MB-231 and neo-231-1 MRG-negative cells.
|
, a typical differentiated phenotype for mammary
epithelial cells (28)
. In contrast, neo-231-1 cells showed
considerable heterogeneity in cell size, and many cells had
"fibroblast-like" spreading morphology (Fig. 3C)
.
We examined whether MRG-induced morphological changes are consistent
with differentiation. Because the maturation of breast cells is
characterized by the presence of lipid droplets that are milk
components, we examined lipid accumulation in MRG-231 cells compared
with the control cells. Droplets containing neutral lipid were readily
detectable in MRG-231-6 clones cultured in the uncoated culture plates;
in contrast, no obvious lipid droplet could be observed in the
neo-231-1 cells. When the lipid-producing cells were counted, 2 and 5%
of MRG-231-6 and MRG-231-10 cells, respectively, produced lipid
droplets, but virtually no lipid-producing cells were observed in
MDA-MB-231 and neo-231-1 cells. When the cells were cultured in the
Matrigel-coated plates, a significant increase in lipid accumulation
was observed in both MRG-231 cells and MRG-negative control cells.
Representative samples of lipid staining in MRG-231-6 and neo-231-1
cells are shown in Fig. 4
. Fifteen percent of MRG-231-6 and 21% of MRG-231-10 cells produced
lipid droplets, but only 4% of MDA-MB-231 cells and 3% of neo-231-1
contained lipid droplets, which were much smaller in size than those of
MRG-positive cells (Table 1)
.
|
|
. Consistent with these changes, which
are characteristic for the differentiated phenotype, functional
differentiation with stimulation of ß-casein was also observed.
Although no detectable ß-casein mRNA was observed in control mammary
glands, expression of ß-casein mRNA was significantly increased in
MRGp-treated glands (Fig. 5, C and D)
. Therefore,
treatment of mouse mammary gland in organ culture with MRGp resulted in
a histologically differentiated phenotype as well as functional
differentiation.
|
-3 PUFA DHA and MRG on Cell Growth.-3 PUFA DHA, we were interested in studying whether
the growth-suppressing effect of DHA is mediated in part by MRG. We
first studied the effects of DHA on MRG-negative MDA-MB-231 cells. The
cells were treated with DHA at doses of 2, 4, 6, 8, and 12 µg/ml for
4 days, with fresh DHA added every 2 days. A very narrow dose-dependent
growth inhibition was observed for DHA (Fig. 6A)
. Although no significant growth inhibition was observed
for DHA at a dose of 2 µg/ml, 71 and 92% growth inhibition was
observed at doses of 8 and 12 µg/ml, respectively. We therefore chose
the noninhibiting DHA dose of 2 µg/ml to test its growth-regulatory
effect on MRG-positive versus MRG-negative cells. As
demonstrated in Fig. 6B
, when the cells were treated with 2
µg/ml DHA, 55 and 47% growth inhibition was observed in MRG-231-6
and MRG-231-10 MRG-transfected cells, respectively. However, no growth
inhibition was observed in MRG-negative parental MDA-MB-231 cells and
neo-231-1 cells. We also studied the effect of the -6 fatty acid
linoleic acid on the growth of MDA-MB-231 cells. At the same conditions
as for the -3 fatty acid DHA, no significant growth effect was
observed at the similar dose range between 4 to 20 µg/ml (data not
shown).
|
. Although no significant growth inhibition was observed
when the MRGp dose was <50 nM, 10 and 14%
growth inhibition was observed when cells were treated with 50 and 80
nM MRGp, respectively. At 150
nM MRGp, growth was inhibited 58%. A submaximal
MRG dose of 80 nM was used to test the
interaction between MRG and DHA. Treatment of MDA-MB-436 (Fig. 7B)
and MDA-MB-468 (Fig. 7C)
cells with 80
nM MRGp resulted in either a slight inhibition or
a slight stimulation of cell growth, respectively. When the cells were
treated with MRGp together with DHA, a significant synergistic growth
inhibition was observed. The growth of MDA-MB-436 cells was inhibited
by 63% when the cells were treated with DHA and MRGp, compared with
18% inhibition with DHA alone. Similarly, the growth of MDA-MB-468
cells was inhibited by 80% with DHA and MRGp, compared with 22%
inhibition with DHA alone.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
MRG protein expression was undetectable in breast carcinomas by immunohistochemical staining, which is consistent with the previous in situ hybridization data on the loss of MRG transcription in breast carcinomas. Although in the previous in situ hybridization analysis, MRG transcripts could be detected in the epithelial cells from normal mammary glands (1) , in the current immunohistochemical analysis of MRG protein expression, MRG protein staining was either very weak or undetectable in nondifferentiated mammary glands from nulliparous women. This discrepancy may reflect the different sensitivities of the more sensitive in situ hybridization versus the less sensitive immunohistochemical staining. Alternatively, the tested different normal breast specimens may represent different stages of differentiation. It is also possible that this discrepancy between the in situ hybridization and immunohistochemical staining is attributable to the fact that the message may not be translated. Nevertheless, addition of MRGp to cultures of breast cancer cells and to organ cultures of mouse mammary gland induced growth inhibition and gland differentiation. Although the mechanism for cellular uptake of MRGp is not clear, it is likely that MRGp diffuses through the membrane because of its very hydrophobic and lipogenic nature. In fact, some FABPs such as H-FABP (MDGI) can be secreted and detected in milk (9) .
In addition to the differentiating effect on mammary gland, the expression of MRG also correlates with neuronal differentiation in many parts of the mouse central nervous system (31 , 32) . Furthermore, blocking antibody for MRG/B-FABP can block glial cell differentiation (31) . MDGI/H-FABP protein has been detected mainly in myocardium, skeletal and smooth muscle fibers, lipid and steroid-synthesizing cells of adrenals, lactating mammary gland, and terminally differentiated epithelia of the respiratory, intestinal, and urogenital tracts (6) . The results provide evidence that expression of MDGI is associated with an irreversibly postmitotic and terminally differentiated status of cells. Therefore, it seems clear that a differentiation-associated function is a common property of this structurally related subfamily of FABPs.
It is well established that the -3 fatty acids DHA and EPA, found in
fish oil, have a suppressive effect on tumor growth and particularly on
mammary tumorigenesis. Epidemiological studies (33, 34, 35, 36, 37)
support a role for -3 fatty acids as adjunct therapy in the
prevention and treatment of breast cancer. This protective effect of
-3 PUFAs can be demonstrated in animal models with
carcinogen-induced mammary tumors in mouse and rat and mammary
xenografts in nude mice (14, 15, 16, 17, 18, 19)
. Various mechanisms have
been proposed to explain the tumor-suppressive activity of -3 PUFAs;
of special interest are alteration of the oxidative metabolism
of arachidonic acid via the cyclooxygenase pathway
(35)
and changes in lipoxygenase activity (reviewed
in Ref. 36
). Lipid peroxidation, the oxidation of
long-chain PUFAs, can produce an array of secondary products of lipid
oxidation that may possess cytostatic or cytolytic capacity. It has
been proposed that DHA and EPA can both directly and indirectly
modulate gene expression (38)
. The direct effects of DHA
and EPA are most probably mediated by their ability to bind to positive
and/or negative regulatory transcription factors, whereas the indirect
effects appear to be mediated through alterations in the generation of
intracellular lipid second messengers.
At present, the mechanisms by which DHA exerts its tumor suppressing
activity remain controversial and unknown. As a newly identified fatty
acid-binding protein and a growth differentiation factor for mammary
cells, we have demonstrated here that treatment of human breast cancer
cells with DHA resulted in differential growth inhibition proportional
to the MRG expression in the cells: MRG-positive cells or MRGp-treated
cells were much more sensitive to DHA-induced growth inhibition than
MRG-negative cells or control, untreated cells. Our data suggest that
the growth-suppressing activity of DHA on breast cancer cells may be
mediated in part by MRG and presumably by MRG-induced differentiation.
This hypothesis is also supported by a previous report that DHA has the
highest binding affinity for mouse B-FABP (MRG), suggesting that the
physiological ligand for MRG is the -3 PUFA DHA (22)
.
The impact of pregnancy and lactation on breast cancer risk recently
has been of great interest in terms of breast cancer prevention. As
hormonally related processes, it is widely accepted that pregnancy at
an early age and breastfeeding reduce the risk of breast cancer
(39, 40, 41, 42)
. The possibility of preventing breast cancer by
manipulation of these processes with hormones or dietary factors such
as -3 PUFAs that mimic the differentiating effect is a novel and
manipulable approach to breast cancer intervention and prevention.
However, little is known about the regional and developmental
expression of locally acting growth factors and differentiating factors
in the mammary epithelium during pregnancy and lactation. Within this
context, MRG could play a role in both mammary gland differentiation
and -3 PUFA-mediated antitumor effect. The potential application of
MRG as a biomarker for mammary gland differentiation to assess the
efficiency of differentiation-based breast cancer chemoprevention and
to predict tumor-suppressive response to -3 PUFAs warrants further
investigation.
|
FOOTNOTES |
|---|
1 Supported in part by Grant DAMD17-99-1-9255 from
the United States Army Breast Cancer Research Program and Grant
C-015690 from the New York State Breast Cancer Research and Education
Fund. 
2 To whom requests for reprints should be
addressed, at Department of Radiation Oncology, Long Island Jewish
Medical Center, New Hyde Park, NY 11040. Phone: (718) 470-3086; Fax:
(718) 470-9756; E-mail: shi{at}lij.edu
3 The abbreviations used are: MRG, mammary-derived
growth inhibitor-related gene; B-FABP, brain-type fatty acid-binding
protein; H-FABP, heart-derived FABP; MDGI, mammary-derived growth
inhibitor; PUFA, polyunsaturated fatty acid; DHA, docosahexaenoic acid;
EPA, eicosapentaenoic acid; MRGp, recombinant MRG protein.
Received 3/29/00. Accepted 9/20/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  Y. Goto, Y. Matsuzaki, S. Kurihara, A. Shimizu, T. Okada, K. Yamamoto, H. Murata, M. Takata, H. Aburatani, D. S.B. Hoon, et al. A new melanoma antigen Fatty Acid-binding protein 7, involved in proliferation and invasion, is a potential target for immunotherapy and molecular target therapy. Cancer Res., April 15, 2006; 66(8): 4443 - 4449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Wang, D. Xia, N. Li, C. Wang, T. Chen, T. Wan, G. Chen, and X. Cao Bone Marrow Stromal Cell-derived Growth Inhibitor Inhibits Growth and Migration of Breast Cancer Cells via Induction of Cell Cycle Arrest and Apoptosis J. Biol. Chem., February 11, 2005; 280(6): 4374 - 4382. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. E. Hardman (n-3) Fatty Acids and Cancer Therapy J. Nutr., December 1, 2004; 134(12): 3427S - 3430S. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yonezawa, S. Yonekura, Y. Kobayashi, A. Hagino, K. Katoh, and Y. Obara Effects of Long-Chain Fatty Acids on Cytosolic Triacylglycerol Accumulation and Lipid Droplet Formation in Primary Cultured Bovine Mammary Epithelial Cells J Dairy Sci, August 1, 2004; 87(8): 2527 - 2534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wang, Y. E. Liu, I. D. Goldberg, and Y. E. Shi Induction of Mammary Gland Differentiation in Transgenic Mice by the Fatty Acid-binding Protein MRG J. Biol. Chem., November 21, 2003; 278(47): 47319 - 47325. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Wu, Z. Weng, Q. Tao, G. Lin, X. Wu, H. Qian, Y. Zhang, X. Ding, Y. Jiang, and Y. E. Shi Stage-specific Expression of Breast Cancer-specific Gene {gamma}-Synuclein Cancer Epidemiol. Biomarkers Prev., September 1, 2003; 12(9): 920 - 925. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. D Terry, T. E Rohan, and A. Wolk Intakes of fish and marine fatty acids and the risks of cancers of the breast and prostate and of other hormone-related cancers: a review of the epidemiologic evidence Am. J. Clinical Nutrition, March 1, 2003; 77(3): 532 - 543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. E. Hardman Omega-3 Fatty Acids to Augment Cancer Therapy J. Nutr., November 1, 2002; 132(11): 3508S - 3512. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
