Cancer Research Meeting Calendar  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roh, H. J.
Right arrow Articles by Hittelman, W. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roh, H. J.
Right arrow Articles by Hittelman, W. N.
[Cancer Research 60, 6496-6502, November 15, 2000]
© 2000 American Association for Cancer Research


Tumor Biology

Visualization of the Timing of Gene Amplification during Multistep Head and Neck Tumorigenesis1

Hwan J. Roh2, Dong M. Shin, Jin S. Lee, Jae Y. Ro, Michael A. Tainsky3, Waun K. Hong and Walter N. Hittelman4

Departments of Thoracic/Head and Neck Medical Oncology [H. J. R., D. M. S., J. S. L., W. K. H.], Experimental Therapeutics [H. J. R., W. N. H.], Pathology [J. Y. R.], and Tumor Biology [M. A. T.], University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Head and neck tumorigenesis is thought to represent a multistep process whereby carcinogen exposure leads to genetic instability in the tissue and the accumulation of specific genetic events, which result in dysregulation of proliferation, differentiation, and cell loss and the acquisition of invasive capacity. Chromosome 11q13 amplification is frequently observed in head and neck squamous cell carcinoma (HNSCC), and the amplified gene products are assumed to play important functional roles in the tumor phenotype. However, it is not well understood whether gene amplification precedes carcinoma development or results from the unstable nature of intact tumors. To determine the timing of gene amplification during tumorigenesis, tissue sections from amplified HNSCC specimens (containing a contiguous transition from normal epithelium to hyperplasia to dysplasia to carcinoma) were probed for INT2 gene copy number by chromosome in situ hybridization. In addition, representative epithelia were microdissected from the tissue sections, and the DNA was isolated and assessed for INT2 gene copy number by semiquantitative PCR. In those cases containing amplified INT2 in the carcinoma, gene amplification appeared to precede HNSCC development. In one case, INT2 gene amplification appeared in the hyperplasia to dysplasia transition, whereas in two other cases, gene amplification was apparent at dysplasia. These results suggest that gene amplification can occur early during head and neck tumorigenesis and that genetic instability is an important driving force in the tumorigenesis process.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HNSCC5 has been hypothesized to represent a multistep evolutionary process in an anatomical field repeatedly exposed to carcinogenic insult. Induced genetic instability is then postulated to lead to the accumulation of specific genetic hits important for expression of the carcinoma phenotype (1, 2, 3, 4) . Reflective of this multistep process, histological sections from HNSCC resections often exhibit an apparently contiguous and continuous transition from normal to hyperplastic to dysplastic epithelium to carcinoma. Previously published studies using such informative tissue specimens demonstrated that this histological progression was marked by increasing genetic instability (5) , increasingly dysregulated proliferation (6) , and increasingly abnormal expression of growth regulatory molecules, such as epidermal growth factor receptor (7) and p53 (8) . Thus, this tissue model system provides a unique opportunity to map out genotype/phenotype interactions associated with head and neck tumorigenesis.

Over recent years, the specific genetic events important in the development of head and neck tumors have been increasingly elucidated at the chromosome (9, 10, 11, 12) and molecular (13, 14, 15) levels. More recently, larger scale gains and losses in specific chromosome regions have been detected by comparative genomic hybridization (16, 17, 18) . Several candidate genes associated with these genetic anomalies have now been identified (19, 20, 21) , and in vitro studies and in vivo gene knock-out or knock-in studies are beginning to elucidate the in vivo consequences of gene alterations. Little is known about when these specific genetic events occur during multistep head and neck tumorigenesis, their specific pathobiological downstream consequences, or the in vivo interactions between different genetic events. However, recent studies have suggested that some molecular events can be detected as clonal outgrowths in premalignant epithelium (22, 23, 24, 25) .

Amplification of the chromosome 11q13 region is a frequently described event in HNSCC, detected in a reported 30–50% of cases (26) . Several genes that have potential functional importance for head and neck tumorigenesis are frequently coamplified from this region, including INT2/FGF3 (a member of the fibroblast growth factor family), cyclin D1 (an important factor in the activation of cyclin-dependent kinases regulating cell cycle transit), EMS1 (a human homologue of chicken cortactin, an actin-binding protein putatively involved in cellular adhesion), FGF4 (another member of the fibroblast growth factor family), vascular endothelial growth factor ß, PPP1CA, and glutathione S-transferase {pi} (a protein important in detoxification of carcinogens; Ref. 27 ). Although gene amplification is frequently reported in many epithelial tumors, it has generally been thought to be a very late event in tumorigenesis for several reasons: (a) random evaluations of premalignant lesions have not demonstrated gene amplification (28) ; and (b) permissiveness for gene amplification has been shown to require the prior inactivation of other cellular checkpoint mechanisms (e.g., p53 mutation) and/or the overexpression of factors that overcome checkpoint controls following cellular insult (29 , 30) . To determine the timing of gene amplification and its functional consequences during head and neck tumorigenesis, tissue sections of head and neck tumors and their contiguous premalignant lesions were assessed for INT2 gene copy number by chromosome in situ hybridization and semiquantitative PCR of dissected epithelium. The results suggest that gene amplification can be an early genetic event during the multistep evolution of HNSCC.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines.
HNSCC cell lines 886, 1386, 1986, and 1186, kindly provided by Dr. Peter Sacks (Memorial-Sloan Kettering Cancer Center), and normal human fibroblast cell line1509 (American Type Culture Collection, Rockville, MD) were cultivated in Hsu’s modified McCoy’s 5A medium (Life Technologies, Inc., Grand Island, NY) with 15 or 20% FCS (Flow, Costa Mesa, CA), respectively. Cell pellets of trypsinized populations were fixed in 10% buffered formalin and embedded in paraffin.

DNA Probes and Probe Labeling.
The cosmid probe for human INT2, a 40-kb genomic DNA fragment in a pCOS2 EMBL vector, was isolated by alkaline lysis, biotin-labeled by nick translation using the BioNick Labeling system (Life Technologies, Inc., Gaithersburg, MD), and purified using G50 DNA purification spin columns (Worthington Biochemical Co., Freehold, NJ). The digoxigenin-labeled total chromosome 11 painting probe was obtained from Oncor, Inc. (Gaithersburg, MD).

FISH.
Metaphase spreads of cultured cells were treated with 100 µl of 1 mg/ml RNase in 2x SSC at 37°C for 60 min, washed twice in 2x SSC, dehydrated through an ethanol series, and air dried. After warming the slides at 37°C, they were denatured for 2 min at 72°C in 70% formamide/2x SSC and then dehydrated through an ethanol series. The biotinylated INT2 probe was mixed with cot-1 DNA (Life Technologies, Inc.) at a ratio of 1:30, dried by speed vacuum, and dissolved in hybridization solution (50% formamide/2x SSC/10% dextran sulfate/1 mg/ml salmon sperm DNA). After denaturing the probe solution at 70°C for 5 min, hybridization was carried out at 37°C for 16 h in a humidified chamber. Posthybridization washing included 65% formamide/2x SSC (pH 7.0) at 43°C for 20 min, followed by two 15-min washes at 37°C in 2x SSC. The digoxigenin-labeled total chromosome 11 painting probe was denatured at 70°C for 10 min, reannealed at 37°C for 2.5 h, and hybridized to the INT2-labeled slides for 20 h at 37°C. The posthybridization wash included 50% formamide/2x SSC (pH 7.0) at 43°C for 15 min and 0.1x SSC at 60°C for 15 min. The slides were then transferred to 1x PBD (0.2% Tween 20 in 1x PBS). The slides were double labeled with fluorescein-labeled avidin and rhodamine-labeled anti-digoxigenin (Oncor, Inc.) per the manufacturer’s recommendations and counterstained with 4',6-diamidino-2-phenylindole/antifade solution (Oncor, Inc.).

Tissue sections from paraffin blocks were processed as described previously (6) , with the following exceptions: the slides were denatured in 70% formamide/2x SSC (pH 7.0) at 85°C for 12 min and dehydrated through an ethanol series, and the posthybridization wash conditions were 65% formamide/2x SSC (pH 7.0) at 42°C for 10 min twice, followed by two washes in 0.1x SSC at 37°C. The slides were counterstained with 20 µl of propidium iodide/antifade (Oncor, Inc.).

Semiquantitative PCR.
Ten-µm tissue sections were stained with H&E, rehydrated, and air dried. After washing in 1x TE buffer (100 mM Tris-HCl, 0.1 mM EDTA, pH 7.5), the slides were washed again in distilled water and air dried. The relevant epithelial regions were located under x100 and x400, lightly wetted, and microdissected with a 25–27 gauge needle tip. The dissected tissue was transferred to the bottom of an Eppendorf tube, mixed with 20 µl of GeneReleaser (Bioventure, Inc., Murfreesboro, TN), vortexed, and heated in a microwave oven at maximum power setting for 5–7 min (4500 W-min). The PCR reaction mixture included released target DNA, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 200 µM deoxynucleotide triphosphates, 0.06–0.1 µM of IFN-{gamma} oligonucleotide primers, 0.5–0.6 µM INT2 primers, 1 unit of AmpliTaq DNA polymerase (Perkin-Perkin-Elmer Corp., Norwalk, CT), 2.5 µCi [{alpha}-32P]dCTP (3000 Ci/mmol; ICN) in 50 µl of total volume. The primer and deoxynucleotide triphosphate concentrations were chosen from preliminary studies designed to ensure that the PCR reaction was not saturated and was stoichiometric for both the amplified and unamplified situations. The following primers were used for INT2 (9801–9945; 5' end, TGGGTCTGTGTGGCAGGAAG; 3' end, CTACCAAACGACAGAGTAGA) and IFN-{gamma} (4647–4731; 5' end, AGTGATGGCTGAACTGTCGC; 3' end, CTGGGATGCTCTTCGACCT), yielding 145- and 85-bp products, respectively. The PCR reaction protocol included cycle 1, 94°C for 5 min; cycles 2–36, 94°C for 30 s, 57°C for 30 s, 72°C for 1 min; and cycle 37, 72°C for 7 min and held at 4°C. After PCR, 10 µl of each reaction were electrophoresed on a 12.5% polyacrylamide gel. The dried gel was subjected to autoradiography for documentation and then analyzed using the PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The relative intensity of the INT2 target band to the IFN-{gamma} reference band was measured after background subtraction.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of HNSCC Cell Lines with INT2 Amplification.
To identify suitable HNSCC resection specimens that were likely to carry INT2 gene amplification, several HNSCC cell lines [originally developed from tumors resected at M. D. Anderson Cancer Center by Dr. Peter Sacks (31) ] were examined by Southern blot analyses using probes for INT2 and BCL1. Three HNSCC cell lines (886, 1386, and 1986) were identified that showed increased copy number for INT2 and BCL1. A fourth cell line (1186) was identified that did not show increased copy number in this region (Fig. 1)Citation . To characterize the nature of this increased copy number (e.g., double minutes versus homogeneous staining region), metaphase spreads of these four cell lines were subjected to FISH using an INT 2 cosmid probe (labeled green with FITC) and a total chromosome 11 probe (labeled red with rhodamine). As shown in Fig. 2Citation , the nonamplified cell line 1186 showed two normal chromosome 11s with a single INT2 signal on the q arm of each chromosome. In contrast, all three cell lines with increased INT2 gene copy numbers by Southern blot analysis demonstrated evidence for region-specific gene amplification. In the cases of cell lines 1386 and 1986, the amplified region was located telomeric to the residual single copy site on chromosome 11. In the case of cell line 886, the amplified regions were located on a chromosome other than chromosome 11, leaving behind the normal single copy of INT2 on the remnant chromosome 11q- fragment. The finding of red-labeled chromosome 11 sequences adjacent to one of the amplified sites support the possibility that a chromosome translocation preceded the amplification event. The finding of a single retained copy of INT2 on chromosome 11 in all cases is consistent with the bridge-breakage-fusion pathway for gene amplification (32) .



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. INT2 and BCL1 gene copy number determinations by Southern blot analysis in human HNSCC cell lines. Human placental DNA was included as a normal control. Note the presence of increased copy numbers of INT2 and BCL1 in cell lines 886, 1386, and 1986 and single copy status in cell line 1186.

 


View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. FISH analysis of metaphase preparations of head and neck cell lines 886 (A), 1386 (B), 1986 (C), and 1186 (D). The INT2 probe signal is shown in green (fluorescein), the total chromosome 11 probe is shown in red (rhodamine), and the preparations are counterstained with 4',6-diamidino-2-phenylindole (blue). Note three regions of increased INT2 copy number for 886 cells, one of which shows adjacent remnant chromosome 11 material. Note the presence of two chromosomes 11, each retaining the single copy INT2 signal. Metaphases from cell lines 1386 and 1986 each show single regions of INT2 amplification, whereas cell line 1186 shows two normal chromosomes 11 and single INT2 copy status.

 
FISH Analysis on HNSCC Resections to Determine the Timing of Gene Amplification.
Paraffin blocks of the HNSCC resection specimens corresponding to these four cell lines were identified and obtained from the M. D. Anderson Cancer Center Department of Pathology archives. Tissue sections were then stained with H&E and closely examined to identify regions exhibiting a contiguous and continuous histopathological transition from normal adjacent epithelium through hyperplastic and dysplastic morphology to invasive carcinoma (Fig. 3)Citation . To characterize the histological stage at which gene amplification occurred during head and neck tumor development in these cases, the adjacent tissue sections were subjected to FISH analysis using a labeled INT2 probe. FISH analysis of the tumor paraffin block corresponding to the nonamplified cell line 1186 showed no in situ evidence of INT2 amplification in the tumor region or in the adjacent premalignant regions (data not shown). In contrast, tissue sections from the HNSCC specimens associated with cell lines 886, 1386, and 1986 showed distinct in situ evidence for the presence of INT2 amplification in the carcinoma regions. Moreover, the HNSCC specimens associated with amplified cell lines 1386 and 1986 showed in situ evidence of increased INT2 copy number in the dysplastic region adjacent to the carcinoma, and that associated with cell line 886 demonstrated INT2 amplification at the hyperplastic to dysplastic transition (Fig. 4)Citation . The amplified signal was detected throughout the thickness of the premalignant epithelium, an intact basement membrane was apparent, and normal stromal cells and lymphocytes on the other side of the basement membrane exhibited single copy status. In addition, the amplified signal appeared regionally constrained within the nuclei from the first evidence of amplification in the premalignant regions, and the size of the amplified signal remained constant during subsequent histological evolution. Thus, in these three head and neck tumors examined, the formation of double minutes was not evident as an early event during in vivo gene amplification, and the amplification event appeared in the tissue sections as a quantum jump rather than as an evolving increase in gene copy number.



View larger version (138K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. H&E-stained tissue section obtained from head and neck tumor specimen 886 showing an apparent histological transition from normal epithelium (A) to hyperplastic epithelium (B) to dysplastic epithelium (C) to squamous cell carcinoma (D).

 


View larger version (89K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. FISH for INT2 on an adjacent tissue section to that shown for tumor specimen 886 in Fig. 3Citation . The INT2 probe is labeled with fluorescein (green) and the nuclei are counterstained with propidium iodide (red). The normal epithelium adjacent to the tumor (A) shows single INT2 copy number, whereas an amplified INT2 signal (green) is detected in hyperplastic epithelium (B) and continues in dysplastic epithelium (C) and into the tumor region (D). Note that in the dysplastic epithelium (C), an amplified INT2 signal is readily apparent (left side), while stromal cells on the other side of the basement membrane show single INT2 copy status.

 
Molecular Confirmation of INT2 Amplification in Premalignant Regions by Semiquantitative PCR.
Although the FISH studies using an INT2 cosmid probe provided strong evidence that gene amplification could occur during the hyperplastic or dysplastic phases of head and neck tumorigenesis, there was concern that differences in chromatin texture between normal, premalignant, and tumor tissues might influence the hybridization efficiency to yield the observed results. To independently confirm the presence of gene amplification in premalignant sites, epithelial regions corresponding to the normal, hyperplastic, dysplastic, and tumor tissue were separately microdissected from adjacent tissue sections, being careful to exclude stromal regions. Extracted DNA from each region was then subjected to multiplex, semiquantitative PCR analysis using INT2 primers as the target and IFN-{gamma} primers as a single copy reference. Paraffin blocks of cell pellets of normal human fibroblast 1509 cells and 886 head and neck tumor cells served as single copy and amplification controls, respectively. After PCR amplification, the reaction products were run on agarose gels, and the ratios of the INT2 and IFN-{gamma} bands were quantified by PhosphorImager analysis.

As shown in Fig. 5Citation a, the INT2:IFN-{gamma} band intensity ratio was nearly 5-fold higher in the PCR reaction product of DNA from the 886 cell line block (Lane 1) than that from normal 1509 fibroblasts (Lane 2; Table 1Citation ). DNA isolated from normal adjacent epithelium of the HNSCC surgical resection block associated with cell line 886 showed a comparable band ratio to that observed for the normal control 1509 cells (Lane 3). In contrast, the INT2:IFN-{gamma} band intensity ratio was ~2.7-fold higher in DNA derived from epithelium microdissected from the hyperplastic region (Lane 4) and increased to ~5-fold in DNA from the dysplastic and carcinoma regions (Lanes 5 and 6; Table 1Citation ). Interestingly, the relative intensity of the IFN-{gamma} band appeared to be reduced between the hyperplastic and dysplastic regions, suggesting a loss of one IFN-{gamma}allele during this transition. In the head and neck tumor block associated with cell line 1386, the relative band intensity of the INT2:IFN-{gamma} PCR reaction products showed a dramatic increase at the transition from hyperplasia to dysplasia and continued into the carcinoma (Fig. 5b)Citation . A similar but less profound transition was observed for the HNSCC specimen associated with cell line 1986 (Table 1)Citation . This smaller amplification signal observed for the tumor specimen was concordant with that found in the associated cell line. In contrast to that found for the amplified HNSCCs associated with cell lines 886, 1386, and 1986, DNA obtained from the HNSCC specimen associated with nonamplified cell line 1186 showed no evidence of INT2 amplification by this semiquantitative PCR analysis (Fig. 5c)Citation . Thus, these semiquantitative PCR results independently confirm the FISH-based observation that INT2 gene amplification can precede HNSCC development, in these cases at the hyperplastic or dysplastic stage.



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Semiquantitative PCR analysis of INT2 and IFN-{gamma} in premalignant lesions and tumorous regions from tumor specimens 886 (A), 1386 (B), and 1186 (C). Lane 1, control human fibroblast 1509 cells with single copy status for INT2; Lane 2, positive control 886 cells with INT2 gene amplification; Lane 3, microdissected normal adjacent epithelium; Lane 4, microdissected hyperplastic epithelium; Lane 5, microdissected dysplastic epithelium; and Lane 6, microdissected tumor region. Note that increased INT2 copy number is apparent in the hyperplastic epithelium of the 886 tumor and in the dysplastic epithelium of the 1386 epithelium, and evidence of increased INT2 copy numbers remains in the tumors. The 886 tumor also exhibits a loss of one copy of IFN-{gamma} at hyperplasia. Tumor specimen 1186 shows single copy status for INT2.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Analysis of INT2 gene copy number in premalignant epithelium of HNSCC tumors (semiquantitative PCR)

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The results of this study suggest that the INT2 gene amplification can occur early during the multistep evolution of HNSCC. It is unlikely that the observed amplification was a result of tumor infiltration into adjacent premalignant regions for three reasons: (a) there was no histological evidence of tumor cell infiltration into the adjacent premalignant regions; (b) once amplification was detected by in situ hybridization, the majority of the cells throughout the full thickness of the premalignant epithelium showed evidence of amplification; and (c) the semiquantitative PCR analysis used to independently confirm the amplification event is a bulk assay, representing the average genetic state of all of the cells being analyzed. The observation reported here seemingly contradicts a previous report where premalignant lesions were sampled randomly from the tumor field (28) . The present study, however, in an attempt to characterize multistep evolutionary genetic events during tumorigenesis, directed particular attention toward identifying histological regions that exhibited a contiguous and continuous transition from normal through premalignant lesions to tumor. This provided an increased chance for detecting successions of genetic events during tumor development if they occurred. Moreover, the present findings are consistent with other reported observations that allelic imbalance can be detected in premalignant lesions in the field of head and neck tumors (19) .

The head and neck tumor model is particularly useful for functional studies of multistep tumorigenesis, because once contiguous tissue regions are located, specific genetic events purported to be important for tumorigenesis can be spatially correlated with specific downstream physiological consequences. Thus, this model provides a unique in vivo testing ground for paradigms discovered in the in vitro setting. At the initiation of this study, the target gene in the chromosome 11q13 region was postulated to be INT2. Although INT2 amplification has been observed in a number of human tumors, and although INT2 transfection into mammary cells can increase angiogenesis (33) , the role of the INT2 gene itself in head and neck cancer has been questioned because of the low degree of INT2 gene expression found in tumor specimens (34) . Subsequently, several other genes of potential functional importance for tumor development have been reported to be frequently coamplified with INT2, including cyclin D1, EMS, FGF4, SEA, vascular endothelial growth factor ß, phosphatase 1{alpha}, and glutathione S-transferase {pi} (27) . For this reason, increased attention has been focused on the role of cyclin D1 and EMS expression in head and neck tumors. For example, high cyclin D1 expression has been found in head and neck tumors, where the cyclin D1 gene is amplified and has been shown to be associated with poor prognosis in laryngeal tumors (35) .

The findings reported here are relevant to understanding the mechanisms of gene amplification in vivo. A number of models for gene amplification have been proposed based on studies carried out in in vitro systems, where it is difficult to follow the sequential set of events in an individual clone of cells. In one mechanistic model, gene amplification is proposed to be associated with the accumulation of double minutes, thought to be the product of dysregulated replication of genomic regions and preferential selection of cells containing the extra genomic copies. In another mechanistic model, gene amplification is proposed to evolve through repetitive chromosome bridge-breakage-fusion reactions or by a bridge-breakage-fusion mechanism, followed by an unknown amplification event(s) near the disrupted region of the genome (32) . With regard to the first model, there was no evidence for the presence of minute chromosomes in the amplified head and neck tissue regions reported here because the in situ hybridization products within nuclei were always focal rather than diffuse.

Three findings reported here are of interest for the bridge-breakage-fusion model: (a) in all cases, the cell lines derived from the tumors appeared to retain the normal INT2 copy on chromosome 11q13; (b) the amplification event appeared either more telomeric on chromosome 11 than the INT2 chromosomal location or was translocated onto another chromosome. Double labeling studies on tissue sections using chromosome 11 centromere probes in combination with INT2, cyclin D1, and EMS1 probes suggest that the same held true in the original tumor (36) ; (c) the amplification reaction appeared to be a quantum event rather than a sequential set of events in vivo, because the degree of amplification remained constant once amplification was detected. However, this last observation must be taken with caution because the PCR assay was only semiquantitative, and gene amplification was characterized at only one point in actual time (at tumor resection). Thus, it is possible that cells with intermediate gene amplification events did not expand within the premalignant epithelium and that the cells with increased amplification were preferentially selected for clonal outgrowth in vivo.

Gene amplification has been traditionally presumed to be a late event in tumorigenesis, perhaps associated with intrinsic genetic instability in tumors (37) . However, there is increasing evidence that genetic instability is an important driving force for the tumorigenesis process (38, 39, 40) . The present report provides evidence that another type of genetic instability event, gene amplification, can also occur early in the tumorigenesis process. Previous in vitro studies have suggested that altered p53 gene function (29 , 30) , cyclin D1 gene overexpression (41) , and/or disruption of the cyclin D1/cdk complex activity balance (42) makes cells unstable and permissive for gene amplification. Of interest, our previous studies indicated that dysregulated p53 expression can occur early in the multistep process (9) and is spatially associated with increased chromosome instability (43) . Recent studies in this HNSCC model system indicate that cyclin D1 overexpression precedes cyclin D1 gene amplification and is spatially associated with several forms of genomic instability (44 , 45) . Thus, the HNSCC model system provides a unique opportunity to examine the spatial relationship between specific genetic alterations, changes in gene expression, and downstream phenotypic consequences associated with multistep tumorigenesis.


    ACKNOWLEDGMENTS
 
We thank Susan Cwerin for technical assistance. Dr. Hong holds an American Cancer Society Professorship. Dr. Hittelman holds the Sophie Caroline Steves Professorship in Cancer Research.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by National Cancer Institute Grant PO1 52051. Back

2 Present address: Department of Otolaryngology, Head and Neck Surgery, College of Medicine, Pusan National University, Pusan, Korea. Back

3 Present address: Karmanos Cancer Institute, 110 East Warren Avenue, Detroit, MI. Back

4 To whom requests for reprints should be addressed, at Department of Experimental Therapeutics, The University of Texas M. D. Anderson Cancer Center, Box 19, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: (713) 792-2961; Fax: (713) 792-3754; E-mail: whittelm{at}mail.mdanderson.org Back

5 The abbreviations used are: HNSCC, head and neck squamous cell carcinoma; FISH, fluorescence in situ hybridization. Back

Received 2/19/00. Accepted 9/13/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Farber E. The multistep nature of cancer development. Cancer Res., 44: 4217-4223, 1984.[Free Full Text]
  2. Choi S. Y., Kahyo H. Effect of cigarette smoking and alcohol consumption in the aetiology of cancer of the oral cavity, pharynx, and larynx. Int. J. Epidemiol., 20: 878-885, 1991.[Abstract/Free Full Text]
  3. Mashberg A., Boffetta P., Winkelman R., Garfinkel L. Tobacco smoking, alcohol drinking, and cancer of the oral cavity and oropharynx among U. S. veterans. Cancer (Phila.), 72: 1369-1375, 1993.
  4. Slaughter D., Southwick H. W., Smejkal W. A. Field cancerization in oral stratified squamous epithelium: clinical implications of multicentric origin. Cancer (Phila.), 6: 693-698, 1953.
  5. Voravud N., Shin D. M., Ro J. Y., Lee J. S., Hong W. K., Hittelman W. N. Increased polysomies of chromosomes 7 and 17 during head and neck cancer multistage tumorigenesis. Cancer Res., 53: 2874-2883, 1993.[Abstract/Free Full Text]
  6. Shin D. M., Voravud N., Ro J. Y., Lee J. S., Hong W. K., Hittelman W. N. Sequential increase in proliferating cell nuclear antigen in head and neck tumorigenesis: a potential biomarker. J. Natl. Cancer Inst., 85: 971-978, 1993.[Abstract/Free Full Text]
  7. Shin D. M., Ro J. Y., Shaw T., Hong W. K., Hittelman W. N. Dysregulation of epidermal growth factor receptor (EGFR) expression in the multistage process of head and neck carcinogenesis. Cancer Res., 54: 3153-3159, 1994.[Abstract/Free Full Text]
  8. Shin D. M., Kim J., Ro Y. J., Hittelman J., Roth J. A., Hong W. K., Hittelman W. N. Activation of p53 gene expression in premalignant lesions during head and neck tumorigenesis. Cancer Res., 54: 321-326, 1994.[Abstract/Free Full Text]
  9. Jin Y., Mertens F., Mandahl N., Heim S., Olegard C., Wennerberg J., Bjorkland A., Mittelman G. Chromosome abnormalities in eighty-three head and neck squamous cell carcinomas: influence of culture conditions on karyotypic pattern. Cancer Res., 53: 2140-2146, 1993.[Abstract/Free Full Text]
  10. Van Dyke D. L., Worsham M. J., Benningen M. S., Krause C. J., Baker S. R., Wolf G. T., Drumheller T., Tiley B. C., Carey T. E. Recurrent cytogenetic abnormalities in squamous cell carcinomas of the head and neck region. Genes Chromosomes Cancer, 9: 192-206, 1994.[Medline]
  11. Lammie G. A., Peters G. Chromosome 11q13 abnormalities in human cancer. Cancer Cells, 3: 413-420, 1991.[Medline]
  12. Sreekantayah C., Rao P. H., Xu L., Sachs P. G., Schantz S. P., Chaganti R. S. K. Consistent chromosomal losses in head and neck squamous cell carcinoma cell lines. Genes Chromosomes Cancer, 11: 29-39, 1994.[Medline]
  13. Nawroz H., Vander Riet P., Hruban R. H., Koch W., Ruppert J. M., Sidransky D. Allelotype of head and neck squamous cell carcinoma. Cancer Res., 54: 1152-1155, 1994.[Abstract/Free Full Text]
  14. Ah-See K. W., Cooke T. G., Pickford I. R., Soutar D., Balmain A. An allelotype of squamous carcinoma of the head and neck using microsatellite markers. Cancer Res., 54: 1617-1621, 1994.[Abstract/Free Full Text]
  15. Gonzalez M. V., Pello M. F., Lopez-Larrea C., Suarez C., Menendez M. J., Coto E. Loss of heterozygosity and mutation analysis of the p16 (9p21) and p53 (17p13) genes in squamous cell carcinoma of the head and neck. Clin. Cancer Res., 1: 1043-1049, 1995.[Abstract]
  16. Speicher M. R., Howe C., Crotty P., duManoir S., Costa J., Ward D. C. Comparative genomic hybridization detects novel deletions and amplifications in head and neck squamous cell carcinomas. Cancer Res., 55: 1010-1013, 1995.[Abstract/Free Full Text]
  17. Brzoska P. M., Levin N. A., Fu K. K., Kaplan M. J., Singer M. I., Gray J. W., Christman M. F. Frequent novel DNA copy number increase in squamous cell head and neck tumors. Cancer Res., 55: 3055-3059, 1995.[Abstract/Free Full Text]
  18. Bockmuhl U., Schwendel A., Dietel M., Petersen I. Distinct patterns of chromosomal alterations in high- and low-grade head and neck squamous cell carcinomas. Cancer Res., 56: 5325-5329, 1996.[Abstract/Free Full Text]
  19. van der Riet P., Nawroz H., Hruban R. H., Corio R., Tokino K., Koch W., Sidransky D. Frequent loss of chromosome 9p 21–22 early in head and neck cancer progression. Cancer Res., 54: 1156-1158, 1994.[Abstract/Free Full Text]
  20. Boyle J. O., Hakim J., Koch W., Van der Riet P., Hruban R. H., Roa R. A., Corio R., Eby Y. J., Ruppert J. M., Sidransky D. The incidence of p53 mutations increases with progression of head and neck cancer. Cancer Res., 53: 4477-4480, 1993.[Abstract/Free Full Text]
  21. Mao L., Fan Y-H., Lotan R., Hong W. K. Frequent abnormalities of FHIT, a candidate tumor suppressor gene, in head and neck cancer cell lines. Cancer Res., 56: 5128-5131, 1996.[Abstract/Free Full Text]
  22. Roz L., Wu C. L., Porter S., Scully C., Speight P., Read A., Sloan P., Thakker N. Allelic imbalance on chromosome 3p in oral dysplastic lesions: an early event in oral carcinogenesis. Cancer Res., 56: 1228-1231, 1996.[Abstract/Free Full Text]
  23. Califano J., van der Riet P., Westra W., Nawroz H., Clayman G., Piantadosi S., Corio R., Lee D., Greenberg B., Koch W., Sidransky D. Genetic progression model for head and neck cancer: implications for field cancerization. Cancer Res., 56: 2488-2492, 1996.[Abstract/Free Full Text]
  24. Mao L., Lee J. S., Fan Y-H., Ro J. Y., Batsakis J. G., Lippman S., Hittelman W. N., Hong W. K. Frequent microsatellite alterations at chromosomes 9p21 and 3p14 in oral premalignant lesions and their value in cancer risk assessment. Nat. Med., 2: 682-685, 1996.[Medline]
  25. El-Naggar A., Hurr K., Batsakis J. G., Luna M. A., Goepfert H., Huff V. Sequential loss of heterozygosity at microsatellite mitosis in preinvasive and invasive head and neck squamous carcinoma. Cancer Res., 55: 2656-265, 1995.[Abstract/Free Full Text]
  26. Williams M. E., Gaffey M. J., Weiss L. M., Wilczynski S. P., Schuuring E., Levine P. A. Chromosome 11q13 amplification in head and neck squamous cell carcinoma. Arch. Otolarygol. Head Neck Surg., 119: 1238-1243, 1993.
  27. Schuuring E. The involvement of chromosome 11q13 region in human malignancies: cyclin D1 and EMS1 are two candidate oncogenes–a review. Gene (Amst.), 159: 83-96, 1995.[Medline]
  28. Lese C. M., Rossie K. M., Appel B. N., Jaya K. R., Johnson J. T., Myers E. N., Gollin S. M. Visualization on INT-2 and HST-1 amplification in oral squamous cell carcinomas. Genes Chromosomes Cancer, 12: 288-295, 1995.[Medline]
  29. Tlsty T. D., White A., Sanchez J. Suppression of gene amplification in human cell hybrids. Science (Washington DC), 255: 1425-1427, 1992.[Abstract/Free Full Text]
  30. Tainsky M. A., Bischoff F. Z., Strong L. C. Genomic instability due to germline p53 mutations drives preneoplastic progression toward cancer in human cells. Cancer Metastasis Rev., 14: 43-48, 1995.[Medline]
  31. Schantz S. P., Racz T., Ordonez N. G., Terry N., Taylor D. L., Bugis S., Sacks P. G. Differential sensitivity of head and neck cancers to nonmajor histocompatibility-restricted killer cell activity. J. Surg. Res., 48: 154-164, 1990.[Medline]
  32. Stark G. M. Regulation and mechanisms of mammalian gene amplification. Adv. Cancer Res., 61: 87-113, 1993.[Medline]
  33. Costa M., Danesi R., Agen C., Di Paolo A., Basolo F., Del Bianchi S., Del Tacca M. MCF-10A cells infected with the int-2 oncogene induce angiogenesis in the chick chorioallantoic membrane and in the rat mesentery. Cancer Res., 54: 9-11, 1994.[Abstract/Free Full Text]
  34. Berenson J. R., Yang J., Mickel R. Frequent amplification of the bcl-1 locus in head and neck squamous cell carcinomas. Oncogene, 4: 1111-1116, 1989.[Medline]
  35. Jares P., Fernandez P. L., Campo E., Nadal A., Bosch F., Aiza G., Nayach I., Traserra J., Cardesa A. PRAD-1/Cyclin D1 gene amplification correlates with messenger RNA overexpression and tumor progression in human laryngeal carcinomas. Cancer Res., 54: 4813-4817, 1994.[Abstract/Free Full Text]
  36. Izzo J., Papadimitrakopoulou V., Lee J. S., Ro J. Y., Li X. Q., Hong W. K., Hittelman W. N. Role of Cyclin D1 in the multistep tumorigenesis process of head and neck squamous cell carcinomas (HNSCC). Oncogene, 17: 2313-2322, 1998.[Medline]
  37. Akins N. B. Chromosome in human malignant tumors: a review and assessment German J. eds. . Chromosomes and Cancer, : 375-422, Wiley & Sons New York 1974.
  38. Lee J. S., Kim S. Y., Hong W. K., Lippman S. M., Ro J. Y., Gay M. L., Hittelman W. N. Detection of chromosomal polysomy in oral leukoplakia, a premalignant lesion. J. Natl. Cancer Inst., 85: 1951-1954, 1993.[Free Full Text]
  39. Loeb L. A. Microsatellite instability: marker of a mutation phenotype in cancer. Cancer Res., 54: 5059-5063, 1994.[Free Full Text]
  40. Lengauer C., Kinzler K. W., Vogelstein B. Genetic instabilities in human cancers. Nature (Lond.), 396: 643-649, 1998.[Medline]
  41. Zhou P., Jiang W., Weghorst C. M., Weinstein B. I. Overexpression of cyclin D1 enhances gene amplification. Cancer Res., 56: 36-39, 1996.[Abstract/Free Full Text]
  42. Terada Y., Tatsuka M., Jinno S., Okayama H. Requirement for tyrosine phosphorylation of Cdk4 in G1 arrest induced by ultraviolet irradiation. Nature (Lond.), 376: 358-362, 1995.[Medline]
  43. Shin D. M., Ro J. Y., Shaw T., Hong W. K., Hittelman W. N. p53 expression and genetic instability in head and neck tumorigenesis. Proc. Am. Assoc. Cancer Res., 35: 944 1994.
  44. Izzo J., Papadimitrakopoulou V., Mao L., Ro J. Y., Hong W. K., Hittelman W. N. Cyclin D1 (CCDN1) overexpression and 9p21 loss promote CCND1 amplification and p53 alterations during head and neck (HNSC) tumorigenesis. Proc. Am. Assoc. Cancer Res., 39: 348 1998.
  45. Izzo J., Papadimitrakopoulou V., El-Naggar A., Lee J. J., Hong W. K., Hittelman W. N. Detection of clonal genetic events preceding tetraploidization and cyclin D1 (CCND1) gene amplification during head and neck (HNSCC) tumorigenesis. Proc. Am. Assoc. Cancer Res., 40: 945 1999.



This article has been cited by other articles:


Home page
JCOHome page
J. G. Izzo, T.-T. Wu, X. Wu, J. Ensor, R. Luthra, J. Pan, A. Correa, S. G. Swisher, C. K.S. Chao, W. N. Hittelman, et al.
Cyclin D1 Guanine/Adenine 870 Polymorphism With Altered Protein Expression Is Associated With Genomic Instability and Aggressive Clinical Biology of Esophageal Adenocarcinoma
J. Clin. Oncol., February 20, 2007; 25(6): 698 - 707.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
J. G. Izzo, V. A. Papadimitrakopoulou, D. D. Liu, P. L. C. den Hollander, I. M. Babenko, J. Keck, A. K. El-Naggar, D. M. Shin, J. J. Lee, W. K. Hong, et al.
Cyclin D1 Genotype, Response to Biochemoprevention, and Progression Rate to Upper Aerodigestive Tract Cancer
J Natl Cancer Inst, February 5, 2003; 95(3): 198 - 205.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. M. Lippman and L. M. Matrisian
Protease Inhibitors in Oral Carcinogenesis and Chemoprevention
Clin. Cancer Res., December 1, 2000; 6(12): 4599 - 4603.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roh, H. J.
Right arrow Articles by Hittelman, W. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roh, H. J.
Right arrow Articles by Hittelman, W. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online