| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Center for Prostate Disease Research, Department of Surgery, Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814-4799 [L. L. X., W. Z., N. S., Z. Z., V. S., M. A., D. G. M., J. W. M., S. S.]; Urology Service, Walter Reed Army Medical Center, Washington, D.C. 20307-5001 [B. G. S., D. G. M., J. W. M.]; Armed Forces Institute of Pathology, Department of Genitourinary Pathology, Washington, D.C. 20307 [I. A. S.]; and Human Genome Sciences, Inc., Rockville, Maryland 20850 [K. F., M. A., V. R., K. C., D. S.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The discovery of additional prostate-specific genes has also resulted in enthusiasm for evaluating their potential utility in the diagnosis and prediction of disease progression of CaP. HK2, another member of the kallikrein gene family, is currently being evaluated for this role in CaP (6) . Increased expression of PSMA has been correlated with more aggressive disease (7) . CaP-associated expression of PSMA is also being evaluated for imaging of prostate cancer by radiolabeled anti-PSMA monoclonal antibodies (7) . Furthermore, promising immunotherapy approaches are being pursued using PSMA peptide (8) . Recent gene discovery approaches have led to the identification of several new prostate-specific/abundant genes, such as NKX3.1 (9) , prostase (10) , prostate stem cell antigen (11) , TMPRSS2 (12) , STEAP (13) , PDEF (14) , PART-1 (15) , HOXB13 (16) , DD3 (17) , PCGEM1 (18) , and PMEPA1 (19) , that exhibit diverse characteristics.
In this report, we describe the discovery of a new prostate-specific gene, PSGR, a member of the G-protein coupled OR family that maps to chromosome 11p15. The most striking aspects of PSGR characterization are its highly prostate tissue-specific expression and its tumor-associated overexpression. The predicted protein sequence of the PSGR revealed seven transmembrane-spanning domains with homology to G protein-coupled receptor odorant receptors. Tumor-associated overexpression and the prostate tissue-specific nature of PSGR, a G protein-coupled trans-membrane receptor, suggest its potential as a novel target for immunotherapeutic strategies of prostate cancer.
| Materials and Methods |
|---|
|
|
|---|
Analysis of Tissue-specific Expression of PSGR Using
MTN Blots.
Multiple tissue Northern blots containing mRNA samples from 23 human
tissues and Master dot blots containing mRNA samples from 50 different
human tissues (Clontech) were hybridized with the
[
-32P]dCTP-labeled 513-bp PSGR
cDNA fragment, which was amplified from a PSGR cDNA clone
using primers 5'-GCCACCTGTGTGCTTATTGGTATCC-3' (sense) and
5'-GACACAATAGGAGTGCGAGAGGACATTG-3' (antisense). As an internal control,
GAPDH probe was used to hybridize all of the blots.
Prostate Tissue Specimens, Pathological Evaluation, and
Microdissection.
Matched prostate cancer and normal tissues were derived from radical
prostatectomy specimens from 52 prostate cancer patients treated at
Walter Reed Army Medical Center (under an institutional review
board-approved protocol). All radical prostatectomy patients in
this study are enrolled in the Department of Defense Center for
Prostate Disease Research Triservice Multicenter Longitudinal Prostate
Cancer Database. The genitourinary pathologist (I. A. S.) was present
in the operating room to immediately accept the prostate gland from the
urologists. If a palpable tumor was present, the surface overlying it
was painted with black ink, and a wedge from the center was immediately
embedded in Tissue-tek OCT (Miles Inc. Diagnostics Division, Elkhart,
IN) and frozen at -70°C. Sextant 14-gauge true cut biopsies were
also obtained on each case and processed similarly. Sextant biopsies
include apex, mid, and base of the right and left lobes of the
prostate performed ex vivo. The volume of biopsy specimens
was about 1 x 0.5 x 0.5
cm3. Ten-µm frozen sections were prepared and
archived at -70°C. One set of slides was stained with H&E and read
by the pathologist (I. A. S.) to define tumor cells. The
frozen sections on slides were dissected using laser captured
microdissection (35 pairs) according to the protocol provided by the
manufacturer (Arcturus Engineering, Mountain View, CA) or
manual microdissection (17 pairs). Total RNA was prepared from
harvested normal and tumor prostate epithelial cells as described
previously (20)
. The expression of PSGR was
correlated with clinicopathological features of the patients.
RT-PCR Assay.
Total RNA (100 ng) was reverse transcribed into cDNA with a RNA PCR kit
(Perkin-Elmer, Foster, CA), and one-tenth of the reverse-transcribed
product from each sample was used for PCR to amplify PSGR
and a housekeeping gene, GAPDH. The primer sequences
for amplification of PSGR were the same as those described
above. The conditions of PCR for each gene were optimized to analyze
the amplified product in the linear range of amplification by adjusting
amplification cycles for each set of primers. The optimized PCR
condition for amplifying PSGR was 3642 cycles of 94°C
for 30 s, 68°C for 30 s, 72°C for 30 s. The
expression of GAPDH was used as an internal control for RNA
input (20)
. Expression of GAPDH and PSGR was
analyzed simultaneously with the same batch of cDNA. Other controls for
the RT-PCR assays included PCR amplification of the RNA samples without
reverse transcription. Four randomly selected RT-PCR products of the
PSGR were sequenced to confirm their identity as
PSGR. The computer-stored images of ethidium bromide-stained
agarose gels were analyzed by densitometry of the bands with NIH image
processing software. The results of PSGR gene expression
were presented as relative expression by using the ratio of the
intensities of PCR product of PSGR to that of
GAPDH. PSGR expression was further
quantified as differential expression between tumor (T) and normal (N)
tissues as follows: (a) overexpression in tumor tissue
(T > N), 1+ (1.55-fold), 2+ (610-fold), 3+
(1120-fold), and 4+ (>20-fold) increased expression as compared with
matched normal tissue; (b) reduced expression in tumor
tissue (T < N), 1- (1.55-fold), 2- (610-fold),
3- (1120-fold), and 4- (>20-fold) decreased expression as compared
with matched normal tissue; and (c) no change (T = N), the difference in PSGR expression between tumor
and normal tissue was <1.5-fold. No detectable PSGR
expression in one of the specimens of tumor/normal pairs was scored as
4+ for increased expression or 4- for decreased expression.
RNA from paired normal and tumor specimens from 8 of the 52 patients was also analyzed by real-time RT-PCR using the 7700 sequence detection system (PE Applied Biosystems, Foster, CA). Real-time RT-PCR was conducted using 10 ng of total RNA from paired normal and tumor samples. PCR primers for PSGR were CATGGCCTTTGACCGTTATGT: GCCAATCTGGGCTGTTACTGTAT using a FAM-labeled probe (ACCCACTGCGCCATGCTGCA). 18S rRNA was detected as internal control. Reverse transcription reactions were carried out at 48°C with or without Moloney murine leukemia virus reverse transcriptase for 30 min. PCR reactions were performed in 25 µl volumes containing the manufacturers recommended buffer supplemented with 8% glycerol, 0.4% Tween 20, and 0.05% gelatin. Paired quadruplicate samples (one lacking reverse transcription and triplicates with reverse transcription) were heat-denatured for 10 min at 95°C and then amplified using either the 18S or PSGR probe primer combinations. Amplification consisted of 40 cycles using a melting (15 s, 95°C) and annealing/extension (60 s, 60°C) step. Results were plotted as average cycle threshold (cT) values for each triplicate sample minus the average triplicate values for 18S rRNA. Differences between tumor and normal samples were calculated using the formula 2exp(cTtumor - cTnormal) and expressed as fold change in expression.
In Situ Hybridization of PSGR in
Prostate Tissues.
A 513-bp PCR fragment (nucleotides 298810; Fig. 1
) was amplified from the cDNA clone of PSGR and cloned into a
PCR blunt II-TOPO vector (Invitrogen, Carlsbad, CA).
Digoxigenin-labeled antisense and sense riboprobes were synthesized
using an in vitro RNA transcription kit (Boehringer
Mannheim, Indianapolis, IN), and a linearized plasmid with
PSGR gene fragment as templates. The hybridization was
performed as described previously (19)
. The slides were
evaluated under an Olympus BX-60 microscope.
|
| Results |
|---|
|
|
|---|
50% identity and
70% similarity) to the G
protein-coupled odorant receptor family. Specifically, the analysis of
PSGR with Dnastar software showed the closest similarity of
PSGR to a human OR gene, HPFH1OR, which was mapped to
the ß-globin gene cluster on chromosome 11p15.5 (Fig. 1B
Prostate Tissue-specific and Epithelial Cell-restricted
Expression of PSGR.
The distribution of PSGR mRNA in normal human tissues was
examined by Northern blot analysis. Of the 23 different human tissue
mRNAs analyzed, a
2.7-kb mRNA transcript specifically hybridizing to
the PSGR cDNA was detected only in prostate tissue (Fig. 2A)
. Two independent experiments revealed identical results.
Further analysis of RNA Master blot containing RNA from 50 different
human tissues confirmed the prostate tissue specificity of the
PSGR gene (data not shown). Among the prostate cancer cell
lines analyzed, weak expression of PSGR was detected in
LNCaP cells by RT-PCR and Northern hybridization (Fig. 2B)
.
In situ RNA hybridization analysis of PSGR
expression in prostate tissues revealed that expression of
PSGR was predominantly localized to epithelial cells of the
prostate gland (Fig. 2C)
. Therefore, a comprehensive
expression analysis of PSGR in human prostate tissues
revealed prostatic epithelial cell-specific expression of the
PSGR.
|
|
|
| Discussion |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The opinions and assertions contained herein are the private views of the authors and are not to be considered as reflecting the views of the US Army or the Department of Defense.
1 Supported in part by a grant from the Center for
Prostate Disease Research, a program of the Henry M. Jackson Foundation
for the Advancement of Military Medicine (Rockville, MD), funded by the
United States Army Medical Research and Materiel Command. ![]()
2 Present address: Avalon Pharmaceuticals,
Gaithersburg, MD 20878. ![]()
3 To whom requests for reprints should be
addressed, at the Center for Prostate Disease Research, Department of
Surgery, Uniformed Services University of the Health Sciences, 1530
East Jefferson Street, Rockville, MD 20852. Phone: (240) 453-8952;
Fax: (240) 453-8912; E-mail: ssrivastava{at}cpdr.org ![]()
4 The abbreviations used are: CaP, carcinoma of
prostate; PSA, prostate-specific antigen; GPCR, G protein-coupled
receptor; OR, odorant receptor; HK, human kallikrein; PSMA,
prostate-specific membrane antigen; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; RT-PCR, reverse transcription-PCR; ORF, open reading
frame. ![]()
5 Internet address: www.ncbi.nlm.nih.gov. ![]()
6 Internet address:
http://www.ch.embnet.org/cgi-bin/TMPRED. ![]()
Received 7/17/00. Accepted 10/17/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. S. Arredouani, B. Lu, M. Bhasin, M. Eljanne, W. Yue, J.-M. Mosquera, G. J. Bubley, V. Li, M. A. Rubin, T. A. Libermann, et al. Identification of the Transcription Factor Single-Minded Homologue 2 as a Potential Biomarker and Immunotherapy Target in Prostate Cancer Clin. Cancer Res., September 15, 2009; 15(18): 5794 - 5802. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Neuhaus, W. Zhang, L. Gelis, Y. Deng, J. Noldus, and H. Hatt Activation of an Olfactory Receptor Inhibits Proliferation of Prostate Cancer Cells J. Biol. Chem., June 12, 2009; 284(24): 16218 - 16225. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. PISSIMISSIS, E. PAPAGEORGIOU, P. LEMBESSIS, A. ARMAKOLAS, and M. KOUTSILIERIS The Glutamatergic System Expression in Human PC-3 and LNCaP Prostate Cancer Cells Anticancer Res, January 1, 2009; 29(1): 371 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. R. Sastry, Y. Karpova, S. Prokopovich, A. J. Smith, B. Essau, A. Gersappe, J. P. Carson, M. J. Weber, T. C. Register, Y. Q. Chen, et al. Epinephrine Protects Cancer Cells from Apoptosis via Activation of cAMP-dependent Protein Kinase and BAD Phosphorylation J. Biol. Chem., May 11, 2007; 282(19): 14094 - 14100. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Machlenkin, A. Paz, E. Bar Haim, O. Goldberger, E. Finkel, B. Tirosh, I. Volovitz, E. Vadai, G. Lugassy, S. Cytron, et al. Human CTL Epitopes Prostatic Acid Phosphatase-3 and Six-Transmembrane Epithelial Antigen of Prostate-3 as Candidates for Prostate Cancer Immunotherapy Cancer Res., July 15, 2005; 65(14): 6435 - 6442. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Foley, D. Hollywood, and M. Lawler Molecular pathology of prostate cancer: the key to identifying new biomarkers of disease Endocr. Relat. Cancer, September 1, 2004; 11(3): 477 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Maeda, S. Nagata, C. D. Wolfgang, G. L. Bratthauer, T. K. Bera, and I. Pastan The T Cell Receptor {gamma} Chain Alternate Reading Frame Protein (TARP), a Prostate-specific Protein Localized in Mitochondria J. Biol. Chem., June 4, 2004; 279(23): 24561 - 24568. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. O'Hara, J. G. Moreno, D. R. Zweitzig, S. Gross, L. G. Gomella, and L. W.M.M. Terstappen Multigene Reverse Transcription-PCR Profiling of Circulating Tumor Cells in Hormone-Refractory Prostate Cancer Clin. Chem., May 1, 2004; 50(5): 826 - 835. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Bera, S. Das, H. Maeda, R. Beers, C. D. Wolfgang, V. Kumar, Y. Hahn, B. Lee, and I. Pastan NGEP, a gene encoding a membrane protein detected only in prostate cancer and normal prostate PNAS, March 2, 2004; 101(9): 3059 - 3064. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Daaka G Proteins in Cancer: The Prostate Cancer Paradigm Sci. Signal., January 20, 2004; 2004(216): re2 - re2. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Liu, F. Conrad, M. R. Cooperberg, D. B. Kirpotin, and J. D. Marks Mapping Tumor Epitope Space by Direct Selection of Single-Chain Fv Antibody Libraries on Prostate Cancer Cells Cancer Res., January 15, 2004; 64(2): 704 - 710. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Bookout, A. E. Finney, R. Guo, K. Peppel, W. J. Koch, and Y. Daaka Targeting G{beta}{gamma} Signaling to Inhibit Prostate Tumor Formation and Growth J. Biol. Chem., September 26, 2003; 278(39): 37569 - 37573. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Xu, Y. Shi, G. Petrovics, C. Sun, M. Makarem, W. Zhang, I. A. Sesterhenn, D. G. McLeod, L. Sun, J. W. Moul, et al. PMEPA1, an Androgen-regulated NEDD4-binding Protein, Exhibits Cell Growth Inhibitory Function and Decreased Expression during Prostate Cancer Progression Cancer Res., August 1, 2003; 63(15): 4299 - 4304. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Grzmil, P. Thelen, B. Hemmerlein, S. Schweyer, S. Voigt, D. Mury, and P. Burfeind Bax Inhibitor-1 Is Overexpressed in Prostate Cancer and Its Specific Down-Regulation by RNA Interference Leads to Cell Death in Human Prostate Carcinoma Cells Am. J. Pathol., August 1, 2003; 163(2): 543 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-L. Gao, S. K. Rawal, L. Sun, A. Ali, R. R. Connelly, L. L. Banez, I. A. Sesterhenn, D. G. Mcleod, J. W. Moul, and S. Srivastava Diagnostic Potential of Prostate-specific Antigen Expressing Epithelial Cells in Blood of Prostate Cancer Patients Clin. Cancer Res., July 1, 2003; 9(7): 2545 - 2550. [Abstract] [Full Text] [PDF] |
||||
![]() |
J M M Tan, E P C Tock, and V T K Chow The novel human MOST-1 (C8orf17) gene exhibits tissue specific expression, maps to chromosome 8q24.2, and is overexpressed/amplified in high grade cancers of the breast and prostate Mol. Pathol., April 1, 2003; 56(2): 109 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Herness and R. K. Naz A Novel Human Prostate-specific Gene-1 (HPG-1): Molecular Cloning, Sequencing, and Its Potential Involvement in Prostate Carcinogenesis Cancer Res., January 15, 2003; 63(2): 329 - 336. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Dennis, J. K. Vass, E. C. Wit, W. N. Keith, and K. A. Oien Identification from Public Data of Molecular Markers of Adenocarcinoma Characteristic of the Site of Origin Cancer Res., November 1, 2002; 62(21): 5999 - 6005. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. W. Asmann, F. Kosari, K. Wang, J. C. Cheville, and G. Vasmatzis Identification of Differentially Expressed Genes in Normal and Malignant Prostate by Electronic Profiling of Expressed Sequence Tags Cancer Res., June 1, 2002; 62(11): 3308 - 3314. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. de Kok, G. W. Verhaegh, R. W. Roelofs, D. Hessels, L. A. Kiemeney, T. W. Aalders, D. W. Swinkels, and J. A. Schalken DD3PCA3, a Very Sensitive and Specific Marker to Detect Prostate Tumors Cancer Res., May 1, 2002; 62(9): 2695 - 2698. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yang, G. E. Holt, M. P. Velders, E. D. Kwon, and W. M. Kast Murine Six-Transmembrane Epithelial Antigen of the Prostate, Prostate Stem Cell Antigen, and Prostate-specific Membrane Antigen: Prostate-specific Cell-Surface Antigens Highly Expressed in Prostate Cancer of Transgenic Adenocarcinoma Mouse Prostate Mice Cancer Res., August 1, 2001; 61(15): 5857 - 5860. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |