Cancer Research Cancer Epigenetics  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, L. L.
Right arrow Articles by Srivastava, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, L. L.
Right arrow Articles by Srivastava, S.
[Cancer Research 60, 6568-6572, December 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

PSGR, a Novel Prostate-specific Gene with Homology to a G Protein-coupled Receptor, Is Overexpressed in Prostate Cancer1

Linda L. Xu, Bennett G. Stackhouse, Kim Florence, Wei Zhang, Naga Shanmugam, Iasbell A. Sesterhenn, Zhiqiang Zou, Vasantha Srikantan, Meena Augustus2, Viktor Roschke, Kenneth Carter2, David G. McLeod, Judd W. Moul, Dan Soppett2 and Shiv Srivastava3

Center for Prostate Disease Research, Department of Surgery, Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814-4799 [L. L. X., W. Z., N. S., Z. Z., V. S., M. A., D. G. M., J. W. M., S. S.]; Urology Service, Walter Reed Army Medical Center, Washington, D.C. 20307-5001 [B. G. S., D. G. M., J. W. M.]; Armed Forces Institute of Pathology, Department of Genitourinary Pathology, Washington, D.C. 20307 [I. A. S.]; and Human Genome Sciences, Inc., Rockville, Maryland 20850 [K. F., M. A., V. R., K. C., D. S.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
PSGR, a new prostate tissue-specific gene with homology to the G protein-coupled odorant receptor gene family, has been identified. Here we report the characteristics of the predicted protein sequence of PSGR and its prostate tissue specificity and expression profile in human prostate cancer and matched normal tissues. Using multiple tissue Northern blots from over 50 different tissues, PSGR expression was restricted to human prostate tissues. Paired normal and tumor specimens from 52 primary prostate cancers, obtained by laser capture microdissection or manual microdissection, were analyzed for PSGR expression by semiquantitative and real-time PCR assays. The differential expression of PSGR between normal and tumor tissues was highly significant (P < 0.001), and 32 of 52 (62%) matched prostate specimens exhibited tumor-associated overexpression of PSGR. Of note, there was very little or no expression of PSGR in many normal specimens in comparison with the generally high expression of PSGR seen in matched tumor specimens. In situ hybridization assays showed restricted PSGR expression in the epithelial cells of the normal and tumor tissue sections. Restricted expression of PSGR in prostatic epithelial cells, overexpression of the PSGR in a significant percentage of prostate cancers, and the predicted protein sequence of PSGR with seven transmembrane domains provide a foundation for future studies evaluating the potential of PSGR as a prostate cancer gene expression marker and the utility of PSGR protein as a novel target for developing immunotherapeutic strategies for prostate cancer.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
CaP4 is the most common malignancy in men in the United States and the second leading cause of cancer mortality (1) . The serum PSA or HK3 test has revolutionized the early detection of CaP (2) . Due to the prostatic epithelial cell-specific expression of PSA, it is also of value as a biomarker for disease remission/progression after treatment (2) . Although PSA is effective at identifying men who may have prostate cancer, it is often elevated in men with benign prostatic hyperplasia, prostatitis, and other nonmalignant disorders (2) . Therefore, identification of additional prostate cancer-specific molecular markers, especially those exhibiting tumor-associated overexpression, is needed to refine the diagnosis as well as prognosis for CaP. It is also recognized that early detection of CaP presents new challenges with respect to predicting the clinical course of the disease for the individual patient (2) . The wide spectrum of biological behavior exhibited by prostatic neoplasms calls for the identification of novel biomarkers that may be able to distinguish a slow-growing cancer from a more aggressive cancer with a potential to metastasize (2) . Prostate cancer-associated molecular genetic alterations are being unraveled by using various strategies including: (a) analyses of genes commonly involved in human cancer; (b) positional cloning of putative genes on frequently affected chromosome loci in CaP; and (c) gene expression profiling of normal and tumor tissues from individuals with prostate cancer (3, 4, 5) .

The discovery of additional prostate-specific genes has also resulted in enthusiasm for evaluating their potential utility in the diagnosis and prediction of disease progression of CaP. HK2, another member of the kallikrein gene family, is currently being evaluated for this role in CaP (6) . Increased expression of PSMA has been correlated with more aggressive disease (7) . CaP-associated expression of PSMA is also being evaluated for imaging of prostate cancer by radiolabeled anti-PSMA monoclonal antibodies (7) . Furthermore, promising immunotherapy approaches are being pursued using PSMA peptide (8) . Recent gene discovery approaches have led to the identification of several new prostate-specific/abundant genes, such as NKX3.1 (9) , prostase (10) , prostate stem cell antigen (11) , TMPRSS2 (12) , STEAP (13) , PDEF (14) , PART-1 (15) , HOXB13 (16) , DD3 (17) , PCGEM1 (18) , and PMEPA1 (19) , that exhibit diverse characteristics.

In this report, we describe the discovery of a new prostate-specific gene, PSGR, a member of the G-protein coupled OR family that maps to chromosome 11p15. The most striking aspects of PSGR characterization are its highly prostate tissue-specific expression and its tumor-associated overexpression. The predicted protein sequence of the PSGR revealed seven transmembrane-spanning domains with homology to G protein-coupled receptor odorant receptors. Tumor-associated overexpression and the prostate tissue-specific nature of PSGR, a G protein-coupled trans-membrane receptor, suggest its potential as a novel target for immunotherapeutic strategies of prostate cancer.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Identification of PSGR.
PSGR was identified as a prostate tissue-specific cDNA, HPRAJ during a search of the expressed sequence tag database at Human Genome Sciences using approaches that previously led to the identification of NKX3.1 (9) .

Analysis of Tissue-specific Expression of PSGR Using MTN Blots.
Multiple tissue Northern blots containing mRNA samples from 23 human tissues and Master dot blots containing mRNA samples from 50 different human tissues (Clontech) were hybridized with the [{alpha}-32P]dCTP-labeled 513-bp PSGR cDNA fragment, which was amplified from a PSGR cDNA clone using primers 5'-GCCACCTGTGTGCTTATTGGTATCC-3' (sense) and 5'-GACACAATAGGAGTGCGAGAGGACATTG-3' (antisense). As an internal control, GAPDH probe was used to hybridize all of the blots.

Prostate Tissue Specimens, Pathological Evaluation, and Microdissection.
Matched prostate cancer and normal tissues were derived from radical prostatectomy specimens from 52 prostate cancer patients treated at Walter Reed Army Medical Center (under an institutional review board-approved protocol). All radical prostatectomy patients in this study are enrolled in the Department of Defense Center for Prostate Disease Research Triservice Multicenter Longitudinal Prostate Cancer Database. The genitourinary pathologist (I. A. S.) was present in the operating room to immediately accept the prostate gland from the urologists. If a palpable tumor was present, the surface overlying it was painted with black ink, and a wedge from the center was immediately embedded in Tissue-tek OCT (Miles Inc. Diagnostics Division, Elkhart, IN) and frozen at -70°C. Sextant 14-gauge true cut biopsies were also obtained on each case and processed similarly. Sextant biopsies include apex, mid, and base of the right and left lobes of the prostate performed ex vivo. The volume of biopsy specimens was about 1 x 0.5 x 0.5 cm3. Ten-µm frozen sections were prepared and archived at -70°C. One set of slides was stained with H&E and read by the pathologist (I. A. S.) to define tumor cells. The frozen sections on slides were dissected using laser captured microdissection (35 pairs) according to the protocol provided by the manufacturer (Arcturus Engineering, Mountain View, CA) or manual microdissection (17 pairs). Total RNA was prepared from harvested normal and tumor prostate epithelial cells as described previously (20) . The expression of PSGR was correlated with clinicopathological features of the patients.

RT-PCR Assay.
Total RNA (100 ng) was reverse transcribed into cDNA with a RNA PCR kit (Perkin-Elmer, Foster, CA), and one-tenth of the reverse-transcribed product from each sample was used for PCR to amplify PSGR and a housekeeping gene, GAPDH. The primer sequences for amplification of PSGR were the same as those described above. The conditions of PCR for each gene were optimized to analyze the amplified product in the linear range of amplification by adjusting amplification cycles for each set of primers. The optimized PCR condition for amplifying PSGR was 36–42 cycles of 94°C for 30 s, 68°C for 30 s, 72°C for 30 s. The expression of GAPDH was used as an internal control for RNA input (20) . Expression of GAPDH and PSGR was analyzed simultaneously with the same batch of cDNA. Other controls for the RT-PCR assays included PCR amplification of the RNA samples without reverse transcription. Four randomly selected RT-PCR products of the PSGR were sequenced to confirm their identity as PSGR. The computer-stored images of ethidium bromide-stained agarose gels were analyzed by densitometry of the bands with NIH image processing software. The results of PSGR gene expression were presented as relative expression by using the ratio of the intensities of PCR product of PSGR to that of GAPDH. PSGR expression was further quantified as differential expression between tumor (T) and normal (N) tissues as follows: (a) overexpression in tumor tissue (T > N), 1+ (1.5–5-fold), 2+ (6–10-fold), 3+ (11–20-fold), and 4+ (>20-fold) increased expression as compared with matched normal tissue; (b) reduced expression in tumor tissue (T < N), 1- (1.5–5-fold), 2- (6–10-fold), 3- (11–20-fold), and 4- (>20-fold) decreased expression as compared with matched normal tissue; and (c) no change (T = N), the difference in PSGR expression between tumor and normal tissue was <1.5-fold. No detectable PSGR expression in one of the specimens of tumor/normal pairs was scored as 4+ for increased expression or 4- for decreased expression.

RNA from paired normal and tumor specimens from 8 of the 52 patients was also analyzed by real-time RT-PCR using the 7700 sequence detection system (PE Applied Biosystems, Foster, CA). Real-time RT-PCR was conducted using 10 ng of total RNA from paired normal and tumor samples. PCR primers for PSGR were CATGGCCTTTGACCGTTATGT: GCCAATCTGGGCTGTTACTGTAT using a FAM-labeled probe (ACCCACTGCGCCATGCTGCA). 18S rRNA was detected as internal control. Reverse transcription reactions were carried out at 48°C with or without Moloney murine leukemia virus reverse transcriptase for 30 min. PCR reactions were performed in 25 µl volumes containing the manufacturer’s recommended buffer supplemented with 8% glycerol, 0.4% Tween 20, and 0.05% gelatin. Paired quadruplicate samples (one lacking reverse transcription and triplicates with reverse transcription) were heat-denatured for 10 min at 95°C and then amplified using either the 18S or PSGR probe primer combinations. Amplification consisted of 40 cycles using a melting (15 s, 95°C) and annealing/extension (60 s, 60°C) step. Results were plotted as average cycle threshold (cT) values for each triplicate sample minus the average triplicate values for 18S rRNA. Differences between tumor and normal samples were calculated using the formula 2exp(cTtumor - cTnormal) and expressed as fold change in expression.

In Situ Hybridization of PSGR in Prostate Tissues.
A 513-bp PCR fragment (nucleotides 298–810; Fig. 1Citation ) was amplified from the cDNA clone of PSGR and cloned into a PCR blunt II-TOPO vector (Invitrogen, Carlsbad, CA). Digoxigenin-labeled antisense and sense riboprobes were synthesized using an in vitro RNA transcription kit (Boehringer Mannheim, Indianapolis, IN), and a linearized plasmid with PSGR gene fragment as templates. The hybridization was performed as described previously (19) . The slides were evaluated under an Olympus BX-60 microscope.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Characterization of PSGR cDNA sequence. A, nucleotide and predicted amino acid sequence of PSGR. The potential initiation methionine codon and the translation stop codon are indicated in bold. The transmembrane domains are underlined. B, multiple alignments of the predicted protein sequence of PSGR and other human GPCRs shown as a phylogenetic tree. The right part shows the GenBank accession numbers and the name of those genes (the accession number of PSGR is AF311306).

 

    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
PSGR Is a New Member of G Protein-coupled Olfactory Receptors.
Analysis of the 1474-bp PSGR cDNA sequence (Fig. 1A)Citation , previously named as HPRAJ, revealed an ORF of 963 bp nucleotides encoding a 320-amino acid protein with a predicted molecular mass of 35.4 kDa. The PSGR ORF revealed intriguing homology (~50% identity and ~70% similarity) to the G protein-coupled odorant receptor family. Specifically, the analysis of PSGR with Dnastar software showed the closest similarity of PSGR to a human OR gene, HPFH1OR, which was mapped to the ß-globin gene cluster on chromosome 11p15.5 (Fig. 1BCitation ; Ref. 21 ). Furthermore, PSGR ORF exhibited almost complete identity to a rat cDNA sequence (accession number AF079864) in the NCBI GenBank.5 A protein motif search using ProfileScan6 indicated the existence of seven trans-membrane domains between amino acid residues 24–293 that are characteristic of GPCRs. Chromosomal mapping assigned PSGR to 11p15 (data not shown), one of the regions of GPCR clusters.

Prostate Tissue-specific and Epithelial Cell-restricted Expression of PSGR.
The distribution of PSGR mRNA in normal human tissues was examined by Northern blot analysis. Of the 23 different human tissue mRNAs analyzed, a ~2.7-kb mRNA transcript specifically hybridizing to the PSGR cDNA was detected only in prostate tissue (Fig. 2A)Citation . Two independent experiments revealed identical results. Further analysis of RNA Master blot containing RNA from 50 different human tissues confirmed the prostate tissue specificity of the PSGR gene (data not shown). Among the prostate cancer cell lines analyzed, weak expression of PSGR was detected in LNCaP cells by RT-PCR and Northern hybridization (Fig. 2B)Citation . In situ RNA hybridization analysis of PSGR expression in prostate tissues revealed that expression of PSGR was predominantly localized to epithelial cells of the prostate gland (Fig. 2C)Citation . Therefore, a comprehensive expression analysis of PSGR in human prostate tissues revealed prostatic epithelial cell-specific expression of the PSGR.



View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. PSGR expression by Northern hybridization and in situ hybridization analysis. A, multiple tissue Northern blots were hybridized with an [{alpha}-32P]dCTP-labeled PSGR cDNA fragment. A 2.7-kb mRNA transcript specifically hybridizing to PSGR cDNA was detected only in prostate tissue. B, PSGR expression in prostate cancer cell lines. Eight µg of polyadenylated RNA were used to make the Northern blot. The blot was hybridized with [{alpha}-32P]dCTP-labeled PSGR probe. The samples are RNA from PC3 cells (Lane 1), LNCaP cells cultured in androgen-free medium for 5 days and then stimulated with R1881 at 10-8 M for 24 h (Lane 2), and LNCaP cells processed as described for lane 2 but without R1881 stimulation (Lane 3). C, in situ hybridization analysis. A and B show the hybridization signal with PSGR antisense riboprobe in benign and malignant prostate tissues from the same patient. C shows a similarly processed hybridization with sense PSGR riboprobe. The arrow shows the restricted expression of PSGR in glandular epithelial cells.

 
PSGR Expression in Prostate Cancer.
Fig. 3Citation shows a representative semiquantitative RT-PCR analysis of PSGR and GAPDH. The overall expression pattern of the PSGR gene is shown in Table 1Citation . Comparison of PSGR expression between normal and tumor tissues revealed overexpression in 62% of tumor specimens (32 of 52 specimens), decreased expression in 11.5% of specimens (6 of 52 specimens), and no change in 27% of specimens (14 of 52 specimens). The cumulative PSGR expression level in tumor tissues (0.4350 ± 0.4987) are significantly higher (P = 0.001) than that in normal tissues (0.1636 ± 0.2843). Quantitative RT-PCR of eight pairs of tumor and normal tissue analyzed by Taqman procedure revealed tumor-associated overexpression in 7 tumors consistent with the semiquantitative RT-PCR (data not shown). As a complement to RT-PCR, PSGR expression was also analyzed by in situ RNA hybridization in selected specimens. Of the 10 cases analyzed, 7 showed significantly elevated expression of PSGR in malignant prostate epithelial cells as compared with adjacent benign cells (Fig. 2C)Citation . Thus, using three different methods, we have confirmed overexpression of PSGR in prostate cancer. Preliminary analysis of PSGR expression did not show a significant correlation with specific clinicopathological features (such as pathologic and clinical stage) (data not shown). A larger study of whole mount prostate specimens is in progress for further investigation of this issue.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. PSGR expression in primary prostate cancer specimens by RT-PCR. Representative RT-PCR products of tumor and adjacent normal tissues were analyzed on agarose gel. Lanes 1–9 represent PCR results of paired normal and tumor tissues from the same patient. NC, no reverse transcription (control); N, normal prostate tissue; P, prostatic intraepithelial neoplasia; T, prostate tumor tissue.

 

View this table:
[in this window]
[in a new window]

 
Table 1 PSGR expression status in prostate cancer

PSGR expression in 52 matched prostatic cancer (T) and normal tissues (N) was analyzed by RT-PCR. The results were represented as differential expression in T and N as described in "Materials and Methods." T > N, overexpression in tumor tissue, graded as 1+ (1.5–5-fold), 2+ (6–10-fold), 3+ (11–20-fold), and 4+ (>20-fold) increased expression as compared with matched normal tissue; T < N, reduced expression in tumor tissue, graded as 1- (1.5–5-fold), 2- (6–10-fold), 3- (11–20-fold), and 4- (>20-fold) decreased expression as compared with matched normal tissue; and T = N, similar expression in tumor and normal tissue, refers to the difference of PSGR expression between tumor and normal tissues as <1.5-fold (graded as 0).

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Recent gene discovery efforts in prostate cancer have been instrumental in the identification numerous new prostate-specific genes. The biological and biochemical characterization of these genes has a significant impact in understanding the role of these genes in prostate biology. Furthermore, potential utilities of prostate-specific molecules as biomarkers of prostate cancer onset/progression and as a cancer vaccine target are obvious in a clinical setting. PSA (or HK3) as a biomarker for prostate cancer is a success story in human cancer, despite certain limitations. The identification of additional biomarkers that are not only prostate specific but are also overexpressed in cancer will be of special interest. Genes such as TMPRSS2, STEAP, PDEF, DD3, and PCGEM1 (12, 13, 14 , 17, 18) represent efforts in this direction. Here we report novel observations on the identification of a putative GPCR with a remarkable prostate tissue specificity showing tumor-specific overexpression in a large percentage of tumors. The homology of PSGR to the G protein-coupled odorant receptor genes is particularly intriguing because odorant receptors are almost exclusively localized in nasal epithelium. It is important to note that GPCR genes belong to the largest "gene family" in the human genome, and it has been argued that odorant receptors have emerged directly for GPCRs and that any GPCR has the potential to become an OR at a given point in evolution (22) . In addition to nasal epithelium, odorant receptor genes have been detected in testis, and their functional relevance remains unclear (23) . This is the first documentation of the prostate-specific expression of a gene with OR homology. Therefore, pending experimental validation, PSGR should be considered a GPCR and not an OR. Future studies are required to determine the biological significance of the OR-like genes in prostate and testes. PSGR expression also appears to be tissue context specific because we were unable to detect PSGR expression in a number of cultured primary prostate cancers cells or immortalized cell lines and established metastatic prostate cancer cell lines. However, weak expression of PSGR was detected only in LNCaP prostate cancer cells. In this regard, it is important to mention that expression of several prostate-specific genes including PSA is often lost during cell culture condition. Another important finding relates to a highly significant overexpression of PSGR in prostate cancer cells. Of note also is the restricted expression of PSGR in epithelial cells of the prostate gland. In summary, we have demonstrated prostatic epithelial cell-restricted expression of PSGR, and tumor cells exhibit significantly increased expression of this putative seven-transmembrane GPCR. However, it is not yet clear how PSGR overexpression may play a role in the process of tumorigenesis. GPCR may play important roles in cell signaling and cell proliferation (24) . Therefore, future experiments will focus on the biological function of PSGR in tumorigenesis of CaP. Membrane localization of the PSGR makes PSGR protein an attractive target for immunotherapy approaches and antibody-based imaging of metastatic prostate cancer. It also will be very important to determine the signals transduced by PSGR in the prostate gland, and future studies will address these issues.


    ACKNOWLEDGMENTS
 
We thank Roger Connelly for performing the statistical analysis.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The opinions and assertions contained herein are the private views of the authors and are not to be considered as reflecting the views of the US Army or the Department of Defense.

1 Supported in part by a grant from the Center for Prostate Disease Research, a program of the Henry M. Jackson Foundation for the Advancement of Military Medicine (Rockville, MD), funded by the United States Army Medical Research and Materiel Command. Back

2 Present address: Avalon Pharmaceuticals, Gaithersburg, MD 20878. Back

3 To whom requests for reprints should be addressed, at the Center for Prostate Disease Research, Department of Surgery, Uniformed Services University of the Health Sciences, 1530 East Jefferson Street, Rockville, MD 20852. Phone: (240) 453-8952; Fax: (240) 453-8912; E-mail: ssrivastava{at}cpdr.org Back

4 The abbreviations used are: CaP, carcinoma of prostate; PSA, prostate-specific antigen; GPCR, G protein-coupled receptor; OR, odorant receptor; HK, human kallikrein; PSMA, prostate-specific membrane antigen; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcription-PCR; ORF, open reading frame. Back

5 Internet address: www.ncbi.nlm.nih.gov. Back

6 Internet address: http://www.ch.embnet.org/cgi-bin/TMPRED. Back

Received 7/17/00. Accepted 10/17/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Landis S. H., Murray T., Bolden S., Wingo P. A. Cancer statistics. CA Cancer J. Clin., 49: 8-31, 1999.[Abstract/Free Full Text]
  2. Pannek J., Partin A. W. Prostate-specific antigen: what is new in 1997. Oncology (Basel), 11: 1273-1278, 1997.[Medline]
  3. Augustus M., Moul J. W., Srivastava S. The molecular phenotype of the malignant prostate Srivastava S. Henson D. E. Gazden A. eds. . Molecular Pathology of Early Cancer, : 321-340, IOS Press Amsterdam 1999.
  4. Issacs W. B., Bova G. S. Prostate cancer Vogelstein B. Kinzler K. W. eds. . The Genetic Basis of Human Cancer, : 653-660, McGraw-Hill Companies, Inc. New York 1998.
  5. Bussemakers M. J. Changes in gene expression and targets for therapy. Eur. Urol., 35: 408-412, 1999.[Medline]
  6. Young C. Y., Seay T., Hogen K., Charlesworth M. C., Roche P. C., Klee G. G., Tindall D. J. Prostate-specific human kallikrein (hK2) as a novel marker for prostate cancer. Prostate, 7: 17-24, 1996.
  7. Fair W. R., Israeli R. S., Heston W. D. Prostate-specific membrane antigen. Prostate, 32: 140-148, 1997.[Medline]
  8. Murphy G. P., Tjoa B. A., Simmons S. J., Jarisch J., Bowes V. A., Ragde H., Rogers M., Elgamal A., Kenny G. M., Cobb O. E., Ireton R. C., Troychak M. J., Salgaller M. L., Boynton A. L. Infusion of dendritic cells pulsed with HLA-A2-specific prostate-specific membrane antigen peptides: a Phase II prostate cancer vaccine trial involving patients with hormone-refractory metastatic disease. Prostate, 38: 73-88, 1999.[Medline]
  9. He W. W., Sciavolino P. J., Wing J., Augustus M., Hudson P., Meissner S. P., Curtis R. T., Shell B. K., Bostwick D. G., Tindall D. J., Gelmann E. P., Abate-Shen C., Carter K. C. A novel human prostate-specific androgen-regulated homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate cancer. Genomics, 43: 69-77, 1997.[Medline]
  10. Nelson P. S., Gan L., Ferguson C., Moss P., Gelinas R., Hood L., Wang K. Molecular cloning and characterization of prostase, an androgen-regulated serine protease with prostate-restricted expression. Proc. Natl. Acad. Sci. USA, 96: 3114-3119, 1999.[Abstract/Free Full Text]
  11. Reiter R. E., Gu Z., Watabe T., Thomas G., Szigeti K., Davis E., Wahl M., Nisitani S., Yamashiro J., Le Beau M. M., Loda M., Witte O. N. Prostate stem cell antigen: a cell surface marker overexpressed in prostate cancer. Proc. Natl. Acad. Sci. USA, 95: 1735-1740, 1998.[Abstract/Free Full Text]
  12. Lin B., Ferguson C., White J. T., Wang S., Vessella R., True L. D., Hood L., Nelson P. Prostate-localized and androgen-regulated expression of the membrane-bound serine protease TMPRSS2. Cancer Res., 59: 4180-4184, 1999.[Abstract/Free Full Text]
  13. Hubert R. S., Vivanco I., Chen E., Rastegar S., Leong K., Mitchell S. C., Madraswala R., Zhou Y., Kuo J., Raitano A. B., Jakobovits A., Saffran D. C., Afar D. E. STEAP: a prostate-specific cell-surface antigen highly expressed in human prostate tumors. Proc. Natl. Acad. Sci. USA, 96: 14523-14528, 1999.[Abstract/Free Full Text]
  14. Oettgen P., Finger E., Sun Z., Akbarali Y., Thamrongsak U., Boltax J., Grall F., Dube A., Weiss A., Brown L., Quinn G., Kas K., Endress G., Kunsch C., Libermann T. A. PDEF, a novel prostate epithelium-specific Ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J. Biol. Chem., 275: 1216-1225, 2000.[Abstract/Free Full Text]
  15. Lin B., White J. T., Ferguson C., Bumgarner R., Friedman C., Trask B., Ellis W., Lange P., Hood L., Nelson P. S. PART-1: a novel human prostate-specific, androgen-regulated gene that maps to chromosome 5q12. Cancer Res., 60: 858-863, 2000.[Abstract/Free Full Text]
  16. Sreenath T., Orosz A., Fujita K., Bieberich C. J. Androgen-independent expression of hoxb-13 in the mouse prostate. Prostate, 41: 203-207, 1999.[Medline]
  17. Bussemakers M. J. H., Van Bokhoven A., Verhaegh G. W., Smit F. P., Karthaus H. F., Schalken J. A., Debruyne F. M., Ru N., Isaacs W. B. DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res., 59: 5975-5979, 1999.[Abstract/Free Full Text]
  18. Srikantan, V., Zou, Z., Petrovics, G., Xu, L., Augustus, M., Davis, L., Livezey, J. R., Connell, T., Sesterhenn, I. A., Yoshino, K., Buzard, G. S., Mostofi, F. K., McLeod, D. G., Moul, J. W., and Srivastava, S. PCGEM1: a novel prostate specific gene is overexpressed in prostate cancer. Proc. Natl. Acad. Sci. USA 97: 12216–12221, 2000.
  19. Xu L. L., Shanmugam N., Segawa T., Sesterhenn I. A., McLeod D. G., Moul J. W., Srivastava S. A novel androgen-regulated gene, PMEPA1, located on chromosome 20q13 exhibits high level expression in prostate. Genomics, 66: 257-263, 2000.[Medline]
  20. Xu L. L., Srikantan V., Sesterhenn I. A., Augustus M., Dean R., Moul J. W., Carter K. C., Srivastava S. Expression profile of an androgen regulated prostate specific homeobox gene NKX3.1 in primary prostate cancer. J. Urol., 163: 972-979, 2000.[Medline]
  21. Feingold E. A., Penny L. A., Nienhuis A. W., Forget B. G. An olfactory receptor gene is located in the extended human ß-globin gene cluster and is expressed in erythroid cells. Genomics, 61: 15-23, 1999.[Medline]
  22. Dryer L., Berghard A. Odorant receptors: a plethora of G-protein-coupled receptors. TiPS, 20: 413-417, 1999.
  23. Vanderhaeghen P., Schurmans S., Vassart G. Specific repertoire of olfactory receptor genes in the male germ cells of several mammalian species. Genomics, 39: 239-246, 1997.[Medline]
  24. Daub H., Weiss U. F., Wallasch C., Ullrich A. Role of transactivation of the EGF receptor in signaling by G-protein-coupled receptors. Nature (Lond.), 379: 557-560, 1996.[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
M. S. Arredouani, B. Lu, M. Bhasin, M. Eljanne, W. Yue, J.-M. Mosquera, G. J. Bubley, V. Li, M. A. Rubin, T. A. Libermann, et al.
Identification of the Transcription Factor Single-Minded Homologue 2 as a Potential Biomarker and Immunotherapy Target in Prostate Cancer
Clin. Cancer Res., September 15, 2009; 15(18): 5794 - 5802.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. M. Neuhaus, W. Zhang, L. Gelis, Y. Deng, J. Noldus, and H. Hatt
Activation of an Olfactory Receptor Inhibits Proliferation of Prostate Cancer Cells
J. Biol. Chem., June 12, 2009; 284(24): 16218 - 16225.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
N. PISSIMISSIS, E. PAPAGEORGIOU, P. LEMBESSIS, A. ARMAKOLAS, and M. KOUTSILIERIS
The Glutamatergic System Expression in Human PC-3 and LNCaP Prostate Cancer Cells
Anticancer Res, January 1, 2009; 29(1): 371 - 377.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. S. R. Sastry, Y. Karpova, S. Prokopovich, A. J. Smith, B. Essau, A. Gersappe, J. P. Carson, M. J. Weber, T. C. Register, Y. Q. Chen, et al.
Epinephrine Protects Cancer Cells from Apoptosis via Activation of cAMP-dependent Protein Kinase and BAD Phosphorylation
J. Biol. Chem., May 11, 2007; 282(19): 14094 - 14100.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Machlenkin, A. Paz, E. Bar Haim, O. Goldberger, E. Finkel, B. Tirosh, I. Volovitz, E. Vadai, G. Lugassy, S. Cytron, et al.
Human CTL Epitopes Prostatic Acid Phosphatase-3 and Six-Transmembrane Epithelial Antigen of Prostate-3 as Candidates for Prostate Cancer Immunotherapy
Cancer Res., July 15, 2005; 65(14): 6435 - 6442.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R. Foley, D. Hollywood, and M. Lawler
Molecular pathology of prostate cancer: the key to identifying new biomarkers of disease
Endocr. Relat. Cancer, September 1, 2004; 11(3): 477 - 488.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Maeda, S. Nagata, C. D. Wolfgang, G. L. Bratthauer, T. K. Bera, and I. Pastan
The T Cell Receptor {gamma} Chain Alternate Reading Frame Protein (TARP), a Prostate-specific Protein Localized in Mitochondria
J. Biol. Chem., June 4, 2004; 279(23): 24561 - 24568.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. M. O'Hara, J. G. Moreno, D. R. Zweitzig, S. Gross, L. G. Gomella, and L. W.M.M. Terstappen
Multigene Reverse Transcription-PCR Profiling of Circulating Tumor Cells in Hormone-Refractory Prostate Cancer
Clin. Chem., May 1, 2004; 50(5): 826 - 835.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. K. Bera, S. Das, H. Maeda, R. Beers, C. D. Wolfgang, V. Kumar, Y. Hahn, B. Lee, and I. Pastan
NGEP, a gene encoding a membrane protein detected only in prostate cancer and normal prostate
PNAS, March 2, 2004; 101(9): 3059 - 3064.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
Y. Daaka
G Proteins in Cancer: The Prostate Cancer Paradigm
Sci. Signal., January 20, 2004; 2004(216): re2 - re2.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Liu, F. Conrad, M. R. Cooperberg, D. B. Kirpotin, and J. D. Marks
Mapping Tumor Epitope Space by Direct Selection of Single-Chain Fv Antibody Libraries on Prostate Cancer Cells
Cancer Res., January 15, 2004; 64(2): 704 - 710.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. L. Bookout, A. E. Finney, R. Guo, K. Peppel, W. J. Koch, and Y. Daaka
Targeting G{beta}{gamma} Signaling to Inhibit Prostate Tumor Formation and Growth
J. Biol. Chem., September 26, 2003; 278(39): 37569 - 37573.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. L. Xu, Y. Shi, G. Petrovics, C. Sun, M. Makarem, W. Zhang, I. A. Sesterhenn, D. G. McLeod, L. Sun, J. W. Moul, et al.
PMEPA1, an Androgen-regulated NEDD4-binding Protein, Exhibits Cell Growth Inhibitory Function and Decreased Expression during Prostate Cancer Progression
Cancer Res., August 1, 2003; 63(15): 4299 - 4304.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Grzmil, P. Thelen, B. Hemmerlein, S. Schweyer, S. Voigt, D. Mury, and P. Burfeind
Bax Inhibitor-1 Is Overexpressed in Prostate Cancer and Its Specific Down-Regulation by RNA Interference Leads to Cell Death in Human Prostate Carcinoma Cells
Am. J. Pathol., August 1, 2003; 163(2): 543 - 552.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C.-L. Gao, S. K. Rawal, L. Sun, A. Ali, R. R. Connelly, L. L. Banez, I. A. Sesterhenn, D. G. Mcleod, J. W. Moul, and S. Srivastava
Diagnostic Potential of Prostate-specific Antigen Expressing Epithelial Cells in Blood of Prostate Cancer Patients
Clin. Cancer Res., July 1, 2003; 9(7): 2545 - 2550.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
J M M Tan, E P C Tock, and V T K Chow
The novel human MOST-1 (C8orf17) gene exhibits tissue specific expression, maps to chromosome 8q24.2, and is overexpressed/amplified in high grade cancers of the breast and prostate
Mol. Pathol., April 1, 2003; 56(2): 109 - 115.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. A. Herness and R. K. Naz
A Novel Human Prostate-specific Gene-1 (HPG-1): Molecular Cloning, Sequencing, and Its Potential Involvement in Prostate Carcinogenesis
Cancer Res., January 15, 2003; 63(2): 329 - 336.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. L. Dennis, J. K. Vass, E. C. Wit, W. N. Keith, and K. A. Oien
Identification from Public Data of Molecular Markers of Adenocarcinoma Characteristic of the Site of Origin
Cancer Res., November 1, 2002; 62(21): 5999 - 6005.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. W. Asmann, F. Kosari, K. Wang, J. C. Cheville, and G. Vasmatzis
Identification of Differentially Expressed Genes in Normal and Malignant Prostate by Electronic Profiling of Expressed Sequence Tags
Cancer Res., June 1, 2002; 62(11): 3308 - 3314.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. B. de Kok, G. W. Verhaegh, R. W. Roelofs, D. Hessels, L. A. Kiemeney, T. W. Aalders, D. W. Swinkels, and J. A. Schalken
DD3PCA3, a Very Sensitive and Specific Marker to Detect Prostate Tumors
Cancer Res., May 1, 2002; 62(9): 2695 - 2698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Yang, G. E. Holt, M. P. Velders, E. D. Kwon, and W. M. Kast
Murine Six-Transmembrane Epithelial Antigen of the Prostate, Prostate Stem Cell Antigen, and Prostate-specific Membrane Antigen: Prostate-specific Cell-Surface Antigens Highly Expressed in Prostate Cancer of Transgenic Adenocarcinoma Mouse Prostate Mice
Cancer Res., August 1, 2001; 61(15): 5857 - 5860.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, L. L.
Right arrow Articles by Srivastava, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, L. L.
Right arrow Articles by Srivastava, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online