| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
NeoRx Corporation, Seattle, Washington 98119-4007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Pretargeted RIT is a multistep process that exploits the high-affinity
interaction between streptavidin and biotin (Ka
10-15 M). In the first step of the
process, an antibody linked to streptavidin is administered
systemically. After sufficient time has elapsed to enable peak tumor
uptake, the excess antibody/streptavidin is removed from the
circulation by in vivo complexation with a
biotinylated poly(GalNAc) "clearing" agent. The resultant complexes
are excreted via the liver. The clearing step is essential to achieve
the highest absolute concentration of antibody receptor at tumor sites
but still maintain low absolute blood and whole body concentrations.
Radiation is delivered to the tumor in a third step by administration
of radiolabeled DOTA-biotin. This low molecular weight cytotoxic
molecule readily penetrates into the tumor, where it is captured by
prelocalized antibody-streptavidin conjugate. Unbound radioactivity is
eliminated from the body via the urine. Rapid uptake of the therapeutic
isotope at tumor sites (before significant loss of potency attributable
to radioactive decay) and efficient renal elimination of excess
radioactivity represent the fundamental advantages of the pretargeted
approach as compared with conventional RIT, in which the radioisotope
is directly conjugated to the antibody. This approach has been tested
preclinically in mice, producing cures of human small cell lung, colon,
and breast cancer xenografts (6)
, and clinically in
patients with adenocarcinoma (7, 8, 9)
and NHL
(10)
.
In contrast to antibody-streptavidin chemical conjugates, a genetically fused targeting agent has a well-defined, homogeneous composition and is simpler and less expensive to manufacture. Here, we report the genetic engineering and in vitro and in vivo characterization of Escherichia coli-produced B9E9 scFvSA fusion protein for use as a first component in pretargeted RIT.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and
VH of B9E9 were obtained by a reverse
transcription reaction using oligonucleotides for the antibody constant
regions (5'-TAGCTGGCGGCCGCCCTGTTGAAGCTCTTGACAAT for
VL and 5'-TAGCTGGCGGCCGCTTTCTTGTCCACCTTGGTGC for
VH). The variable regions were PCR-amplified from
the cDNA using the constant region primers and degenerate variable
region primers (5'-TGCCGTGAATTCCATTSWGCTGACCARTCTC for
VL and 5'-TGCCGTGAATTCGTSMARCTGCAGSARTCWGG for
VH). The DNA sequences of the variable regions
have been deposited in the GenBank database (accession numbers AF277091
for VH and AF277092 for
VL). The PCR fragments were cloned into an
EcoRI/NotI-digested vector and sequenced using a
BigDye kit (PE Applied Biosystems). The
NH2-terminal amino acids of the variable regions
were reconstituted based on the consensus sequence (11)
,
including introduction of a serine residue at position 5 in the
VL gene. Primers used were
5'-TTACGGCCATGGCTGACATCGTGCTGTCGCAGTCTCCAGCAATCCTGTCT and
5'-CACCAGAGATCTTCAGCTCCAGCTTGGTCCCA for VL and
5'-CGGAGGCTCGAGCCAGGTTCAGCTGGTCCAGTCAGGGGCTGAGCTGGTGAAG and
5'-GAGCCAGAGCTCACGGTGACCGTGGTCCCTGCGCCCCA for VH.
The variable regions were ordered in the
VH-VL or
VL-VH configuration and
separated by linkers of various lengths or compositions (Table 1)
. The streptavidin coding region, leader sequence, and approximately
310 bp of the upstream region were PCR-amplified from
Streptomyces avidinii (ATCC 27419; Ref. 12
).
The streptavidin gene was separated from the scFv gene by a linker
encoding amino acids GSGSA. Plasmids contained a lac
promoter, a pBR origin of replication, and a gene encoding either
ß-lactamase (bla; ampicillin resistant) or aminoglycoside
3'-phosphotransferase (neo from Tn5; kanamycin resistant).
|
For fermentation cultures, the primary inoculum (50 ml) was grown
overnight at 30°C in a shake flask containing Terrific broth plus
kanamycin or carbenicillin (50 µg/ml), depending on the selectable
marker of the plasmid. The culture was then diluted 100-fold into the
same medium and grown at 30°C for an additional 4–5 h. This
secondary inoculum (0.5 liter) was transferred to a 14 liter BioFlo
3000 fermentor (New Brunswick Scientific) containing 8 liters of
complete E. coli medium [per liter: 6 grams of
Na2HPO4, 3 grams of
KH2PO4, 0.5 gram of NaCl, 3
grams of
(NH4)2SO4,
48 grams of yeast extract (Difco), 0.25 ml of Mazu DF204 antifoam
(PPG Industries Inc., Pittsburgh, PA), 0.79 gram of
MgSO4-7H2O, 0.044 gram of
CaCl2-2H2O, and 3 ml of
trace elements (per liter: 0.23 gram of CoCl2,
0.57 gram of H3BO3, 0.2
gram of CuCl2-2H2O, 3.5
grams of FeCl3-6H2O, 4.0
grams of MnCl2-4H2O, 0.5
gram of ZnCl2, 1.35 grams of thiamine, and 0.5
gram of
Na2MoO4-2H2O)].
The medium contained galactose at an initial concentration of 5
grams/liter as a carbon source plus 50 µg/ml kanamycin or
carbenicillin for plasmid retention. The culture was grown at 30°C
and induced with IPTG (0.2 mM) at 6 h
postinoculation. The pH was maintained at 7.0 by the automatic addition
of either phosphoric acid or NaOH. Dissolved oxygen concentration was
maintained at 
30% throughout the run, using agitation speeds of
400–800 rpm and oxygen supplementation as necessary. A galactose
solution (50%) was fed to a total of 20–25 grams/liter over a 9-h
period after exhaustion of the initial galactose present in the medium.
Cells were harvested at 24–26 h postinoculation in a continuous flow
centrifuge (Pilot Powerfuge; Carr Separations, Franklin, MA), washed
with PBS [10 mM sodium phosphate and 150
mM NaCl (pH 7.2)], and pelleted by
centrifugation. A typical fermentation produced 80–90 grams of cells
(wet weight) per liter of culture medium.
A rhodamine-biotin assay was used for quantifying the fusion protein in fermentor-grown cells. Cells were washed twice in PBS, resuspended in ice-cold 30 mM Tris and 1 mM EDTA (pH 8.0) to 20% (w/v), and disrupted through two cycles of microfluidization (Microfluidics International, Newton, MA). The fusion protein in centrifuged lysates was complexed with excess rhodamine-derivatized biotin, which was prepared as follows: 5 (and 6-)-carboxytetramethylrhodamine succinimidyl ester (Molecular Probes, Eugene OR) was coupled to biocytin (Pierce, Rockford IL) through the formation of a stable amide bond. The reaction mixture was purified by HPLC using a Dynamax semipreparative C-18 column (Rainin Instrument Co., Woburn, MA). The effluent was monitored at 547 nm, and peak fractions were collected and analyzed by mass spectrometry. Fractions corresponding in molecular weight to biocytin-rhodamine conjugate were pooled and concentrated by roto-evaporation (Büchi, Flawil, Switzerland). An excess of purified biocytin-rhodamine conjugate was added to the supernatant of a centrifuged sample of crude lysate and analyzed by size exclusion chromatography using a Zorbax GF-250 column (MAC-MOD, Chadds Ford, PA) equilibrated in 20 mM sodium phosphate containing 15% DMSO at a 1.0 ml/min flow rate. The effluent was monitored at 547 nm using a Varian Dynamax PDA-2 detector, and the peak area corresponding to fusion protein elution was determined using a Varian Dynamax HPLC Data System (Walnut Creek, CA). The concentration of fusion protein in the crude lysate was calculated by comparison with a standard analyzed under the same conditions. The molar extinction coefficient for the fusion protein standard was calculated using a previously described method summing the relative contributions of amino acids absorbing at 280 nm (13) .
Purification.
The iminobiotin affinity matrix used for the isolation of fusion
protein was prepared by reacting epoxide-activated Macro-prep matrix
(Bio-Rad, Hercules, CA) with 112 µmol of
N-(3-amino-propyl)-1,3 propane diamine (Sigma) per gram of
matrix in 0.2 M carbonate buffer. The reaction
was stopped after 8 h by filtering the slurry through a sintered
glass funnel and rinsing the matrix with distilled water. Residual
epoxides were inactivated by reacting the matrix with 0.1
M sulfuric acid for 4 h at 80°C, and the
matrix was rinsed again. The amine-derivatized matrix was suspended in
PBS, and the pH was increased to 8.5 by the addition of a 10% volume
of 0.5 M sodium borate (pH 8.5).
N-hydroxy-succinimide-iminobiotin (Pierce) was
dissolved in DMSO and added to the suspended matrix at a ratio of 2.6
mg/gram of matrix. After a 4-h reaction, the matrix was rinsed with
distilled water, followed by several alternating washes with sodium
carbonate buffer (pH 11) and sodium acetate buffer (pH 4) and a final
rinse with distilled water. The matrix was stored as a slurry in 20%
ethanol.
Cells (650–750 grams, wet weight) from the fermentation culture were washed and lysed at a concentration of 20% (w/v) by microfluidization as described above. A 5% solution of polyethylenimine (Mr 1,200; Aldrich, Milwaukee, WI), adjusted to pH 8.0 with concentrated HCl, was added to the lysate (0.3 ml/g cells) and precipitated overnight at 4°C. The lysate solution was centrifuged (10,000 x g for 90 min) to pellet the cellular debris. The supernatant was decanted and filtered through a 0.2 µm filter. Glycine was added to the clarified lysate solution to a final concentration of 50 mM, and NaCl was added to a final concentration of 0.3 M. The lysate solution was then applied over an iminobiotin affinity column equilibrated in 50 mM glycine (pH 9.2) containing 0.5 M NaCl. The column was washed with 20 column volumes of equilibration buffer and then eluted with 0.2 M sodium acetate buffer (pH 5.0) containing 0.1 M NaCl. The pH of the eluted product was neutralized with 0.5 M Tris buffer (pH 8.0), and then the product was exhaustively dialyzed in PBS at 4°C.
To reduce protein aggregation, the iminobiotin-purified scFvSA fusion protein was treated with 30% DMSO in PBS for 5–7 h at room temperature and dialyzed in PBS at 4°C. Preparations were concentrated to 2–3 mg/ml using a YM30 membrane (Millipore) and filter sterilized for aseptic storage at 4°C.
Biochemical Characterization.
Purified fusion proteins were analyzed on 4–20% Tris-glycine SDS-PAGE
gels under nonreducing conditions. Before electrophoresis, samples were
mixed with SDS loading buffer and incubated at either room temperature
or 100°C for 5 min. Gels were stained with Coomassie Blue, or the
protein bands were transferred to polyvinylidene difluoride membranes
(Novex). Immunoblot analysis was performed essentially as
described previously (14)
. Peroxidase-conjugated goat
anti-streptavidin polyclonal antibody (Zymed, San Francisco, CA) and
TMB substrate (Vector Laboratories, Burlingame, CA) were used
for detection.
Size exclusion HPLC (Beckman) was performed on a Zorbax GF-250 column with a 20 mM sodium phosphate/0.5 M NaCl mobile phase and a Varian Dynamax detector set at A280 nm. This system, connected in series with a Varian Star 9040 refractive index detector and a MiniDawn light-scattering instrument (Wyatt Technologies, Santa Barbara, CA), was also used to determine the molecular weight of the intact tetramer and aggregate. A dn/dc value of 0.185 for a protein in an aqueous buffer solution was used in the calculations (15) . Automated amino acid sequencing was performed using a Procise 494 sequenator (Applied Biosystems, Inc., Foster City, CA).
For molecular weight determination, liquid chromatographic separation was conducted with a Hewlett Packard series 1100 system fitted with a Jupiter C-18 column (300 Å; 3.2 x 50 mm; 5 µm) and a C-18 "SafeGuard" column (Phenomenex, Torrance, CA) at a flow rate of 500 µl/min. The mobile phase was composed of water/1% formic acid (buffer A) and acetonitrile/1% formic acid (buffer B). The gradient applied was 2% buffer B for 3 min, rising to 99% buffer B within 7 min. B9E9 scFvSA was eluted at a retention time of 8.7 min. The analytical column was interfaced with an electrospray ionization ion trap mass spectrometer (LSQ, Thermoquest, San Jose, CA). The instrument was calibrated with myoglobin and operated in the positive ion mode with the heated capillary set to 200°C and 5.1 kV applied to the electrospray needle. The data were acquired in a full scan mass spectrometry mode [m/z (500–2000 Da/z)]. The molecular weights and amino acid sequences of tryptic peptides generated from B9E9 scFvSA were determined by liquid chromatography-mass spectrometry/mass spectrometry as described by Covey et al. (16) .
Relative immunoreactivity was assessed in a competitive binding assay using flow cytometry that measured the binding of fluorescein-labeled B9E9 mAb to the CD20-positive Ramos cell line (Burkitt lymphoma; ATCC CRL-1596) in the presence of various concentrations of unlabeled antibody or fusion. B9E9 mAb was labeled using fluorescein N-hydroxysuccinimidate, and an optimized amount of this conjugate was mixed with serial dilutions (3–200 µg/ml) of B9E9 mAb standard or molar equivalents of B9E9 scFvSA and incubated with 1 x 106 cells at 4°C for 30 min. Samples were washed and then analyzed on a single laser FACSCalibur (Becton Dickinson). After gating on single cells, the geometric mean fluorescence intensity was determined from a histogram plot of fluorescence. The concentration of competitor antibody required for IC50 of fluorescein-B9E9 binding was calculated using nonlinear regression analysis for one-site binding. The percentage of immunoreactivity was calculated according to the following formula: (IC50 mAb /IC50 scFvSA) x 100.
Immunoreactivity of radiolabeled antibodies was determined by a cell binding assay. The B9E9 scFvSA fusion protein was stably radioiodinated using [125I]-N-succinimidyl para-iodobenzoyl ester (NEN Research Products) according to the method of Wilbur et al. (17) . 125I-labeled B9E9 mAb or fusion protein was incubated with a fixed concentration of radiolabeled protein (50 ng/ml) and varying amounts of antigen (0.25–10 x 106 Ramos cells). Nonspecific binding was determined in the presence of excess cold mAb or fusion protein (50 µg/ml). After a 2-h incubation at ambient temperature, bound and free antibodies were separated by centrifugation through oil (1:1, dinonyl phthalate:dibutyl phthalate) and counted on a gamma counter. Immunoreactivity was calculated from nonlinear regression analysis of a plot of bound (specific - nonspecific binding)/total (bound + free) versus cell number (18) .
Avidity was assessed using saturation binding experiments that measure specific binding of radiolabeled mAb or fusion protein (0.025–50 ng/ml) at equilibrium in the presence of excess antigen (107 cells). Nonspecific binding was determined in the presence of excess cold mAb or fusion protein (50 µg/ml). Mixtures were incubated and centrifuged as described above. The equilibrium dissociation constant (Kd) was calculated from nonlinear regression analysis of nanomolar bound versus nanomolar total radioligand using immunoreactivity-adjusted antibody concentrations (19) . The calculated immunoreactivities for 125I-labeled scFvSA and mAb were 79% and 67%, respectively.
The rate of biotin dissociation was determined at 37°C in 0.25 M sodium phosphate, 0.15 M NaCl, and 0.25% BSA (pH 7.0) containing 10 µM fusion protein or recombinant streptavidin (control), 0.06 µM [3 H]biotin (58 mCi/µmol; NEN Research Products) and 30 mM ascorbate as [3 H]biotin stabilizer. After incubation to reach equilibrium, biocytin (4 mM; Sigma) was added to initiate irreversible dissociation of [3 H]biotin. Aliquots were withdrawn periodically and diluted 20-fold in PBS containing 0.5% BSA. The samples were split for assessment of total and free [3 H]biotin, the latter determined after protein precipitation using sequential additions of ZnSO4/NaOH (60 µM each). Radioactivity was assessed in a fluoroscintillate using a Hewlett Packard beta counter. Linear regression analysis of a plot of the natural logarithm (fraction bound) versus time yielded a dissociation rate constant.
Biotin binding capacity was determined by incubation of the fusion protein with a 9-fold molar excess of [3 H]biotin. The amount of [3 H]biotin associated with the fusion protein was determined by liquid scintillation after the removal of uncomplexed biotin using a PD-10 size exclusion column (Pharmacia).
Immunohistology was conducted by PhenoPath Laboratories (Seattle, WA). Fluoresceinated B9E9 scFvSA, C2B8/SA chemical conjugate, B9E9 mAb, or a murine IgG2a isotype-matched control (Sigma F6522) was reacted with cryosections of normal and tumor human tissues, which were peroxidase blocked with 0.3% H2O2 and biotin blocked with Biotin Blocking System (DAKO X0590). Binding was detected with horseradish peroxidase-conjugated rabbit anti-FITC mAb (DAKO P0404).
Preclinical Pretargeting Studies.
The B9E9 scFvSA fusion protein was labeled with
125I as described above. Methods have been
described previously for preparation of the synthetic clearing agent,
designated as biotin-LC-NM-(GalNAc)16
(20)
, radiolabeled DOTA-biotin (6)
, and the
anti-CD20 C2B8/SA chemical conjugate (10)
. The murine CC49
scFvSA (VH-VL 25-mer)
fusion protein, which was immunoreactive to TAG-72 antigen and used as
a negative control, was prepared in
house.4
All animal studies were conducted under the supervision of the NeoRx Animal Care and Use Committee. Disappearance of the fusion protein from the blood was assessed by measuring the amount of radioactivity in serially collected blood samples after i.v. injection of 125I-labeled scFvSA (600 µg) in normal female BALB/cBkl mice (B&K Universal, Kent, WA). At 18 h postinjection, some mice received a single i.v. injection of the synthetic clearing agent (100 µg). Blood samples were obtained by retro-orbital bleeding.
Pretargeted RIT studies were conducted in female nude mice bearing well-established Ramos xenografts (100–400 mm3 ). Tumor-bearing Bkl:BALB/c/nu/nu nude mice were obtained by implanting 5–25 x 106 cultured cells s.c. in the flank 10–25 days before study initiation. Mice were injected i.v. at t = -24 h with 125I-labeled B9E9 scFvSA (600 µg; 3.488 nmol; 5 µCi) or with the positive control C2B8/SA chemical conjugate (400 µg; 1.905 nmol; 5 µCi), followed 20 h later (t = -4) by 100 µg (11.558 nmol) of the synthetic clearing agent. 111In-labeled DOTA-biotin (1.0 µg; 1.239 nmol; 10 µCi) was injected into each mouse 4 h after the clearing agent (t = 0).
In the 90Y-DOTA-biotin studies, mice received i.v. injections of the unlabeled B9E9 scFvSA (600 µg; 3.488 nmol) or anti-TAG-72 murine CC49 scFvSA (600 µg; 3.488 nmol) and received an injection of 100 µg (11.558 nmol) of the synthetic clearing agent 20 h later. 90Y-DOTA-biotin (1.0 µg; 1.239 nmol; 100 µCi) was injected into each mouse 4 h after the clearing agent. Groups of four mice per time point were bled and sacrificed at 2, 24, 48, and 120 h after the injection of radiolabeled DOTA-biotin. Whole organs and tissue were isolated and weighed, and radioactivity was assessed in a Packard Cobra-II gamma counter as described previously (6) .
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Refs. 21
and 22
). The
VH and VL cDNAs were
constructed as a scFv, which was fused to the full-length streptavidin
gene of Streptomyces avidinii (Fig. 2)
. The scFv-streptavidin gene was designed for expression of soluble,
tetrameric fusion protein in the E. coli periplasm, which
has an oxidizing environment enabling disulfide bond formation. The
tetrameric structure of the protein is derived from using streptavidin,
which spontaneously forms a stable homotetramer resistant to
proteolysis. The scFvSA gene encodes a mature protein of 421 amino
acids with a calculated monomeric weight of
Mr 43,400 (most abundant mass),
whereas the soluble tetramer that forms in the periplasm is
Mr 173,600.
|
|
. These constructs were analyzed first in
shake flask cultures for expression, as visualized on Coomassie
Blue-stained SDS-PAGE gels. The fusion protein migrated as a tetramer
in nonboiled, nonreduced samples and as a monomer in samples boiled for
5 min. The linker size, composition, and order of the variable regions
significantly affected the expression level (Table 1)
. Several clones
that showed good expression in shake flask cultures were grown further
in an 8-liter fermentor and analyzed for expression level and
purification recovery. One scFvSA with a 25-mer
Gly4Ser scFv linker (Fig. 2
, L1) in
the VH-VL orientation
expressed at 250–300 mg/liter and was purified from homogenized cell
extracts with a 50–60% yield on a single iminobiotin affinity
column. This purified fusion protein was analyzed further for
protein characterization, immunoreactivity, biotin binding ability,
immunohistology, blood clearance rate, and in vivo tumor
targeting.
Biochemical Characterization.
SDS-PAGE demonstrated that the fusion protein was purified to >95%
homogeneity after iminobiotin chromatography (Fig. 3A)
. The major band migrated at the expected molecular weight
of 
174,000, and minor isoforms were evident. These isoforms
were also detected with polyclonal anti-streptavidin antibody on
Western gel analysis (Fig. 3B)
. However, all bands resolved
into a single species of Mr 43,000
when the protein was boiled before electrophoresis, consistent with a
single protein entity dissociable into its homogeneous subunit.
|
5%)
peak representing a higher molecular weight, aggregated species (Fig. 4)
. Light-scattering HPLC indicated that the aggregate peak had a
molecular weight of 350,000, suggesting it was a dimer of the
tetramer. The deconvoluted mass spectrum of the monomer showed a
molecular weight of 43,402, which is in agreement with the calculated
most abundant mass of 43,400. Liquid chromatography-mass
spectrometry/mass spectrometry analysis of the tryptic peptides of B9E9
scFvSA identified 15 of 21 predicted peptide fragments with the correct
molecular weight and amino acid sequences yielding near complete
sequence information. In addition, N2-terminal sequencing
of the purified protein revealed that the leader sequence was cleaved
at the expected signal peptidase site adjacent to the first amino acid
of the VH region.
|
185%) as the divalent B9E9 mAb on a
molar basis and nearly equivalent (93%) to B9E9 mAb when
adjusted for its tetravalency (Fig. 5)
. Scatchard analysis indicated that the fusion protein retained the
same relative nanomolar avidity as the B9E9 mAb.
Kd values were 9.75 and 12.44
nM, and Ka
values were 1.02 x 108 and
0.80 x 108
M-1 for B9E9 mAb and
scFvSA, respectively.
|
The binding of B9E9 scFvSA to cryosections of normal and human tumor tissues was compared with that of B9E9 mAb, C2B8/SA chemical conjugate (10) , and a murine IgG2a isotype control mAb. All of the CD20 antibodies showed positive signals in a cell membrane pattern on B-cell aggregates, as expected from the known distribution of these cells. Thus, appropriate foci in sections of the intestine (large and small), lymph node, spleen, thymus, and tonsil and in malignant B-cell lymphoma showed strong signals with the B9E9 scFvSA, B9E9 mAb, and C2B8/SA conjugate.
Clearance Rate and Biodistributions.
Blood clearance studies were conducted in normal mice to examine the
potential of the fusion protein in pretargeted RIT and to compare it
with the C2B8/SA chemical conjugate. 125I-labeled
B9E9 scFvSA had a blood clearance half-life
(t1/2ß) of 16 h, which was
faster than the 46-h half-life of the C2B8/SA chemical conjugate (Fig. 6)
. The fusion protein was rapidly removed from the blood by a single
i.v. injection of biotinylated poly(GalNAc) clearing agent. The scFvSA
concentration dropped from 102 to 6.3 µg/gram of whole blood
at 1 h after administration of the clearing agent.
|
. Liver uptake and retention are functions of complexation with the
clearing agent, which binds to asialoglycoprotein receptors in the
liver. The kidney and intestinal concentrations are believed to be the
result of hepatic metabolism of the fusion protein and subsequent renal
or biliary excretion of radiolabel. A relatively high concentration of
the labeled scFvSA targeted the tumor and was retained there. The
apparent concentration decrease is attributable to the tumor volume
doubling time of approximately 24 h in this xenograft model.
|
. The highest concentration was at the tumor (both stoichiometrically
and relative to blood pool concentration) at all time points. Peak
concentrations of 111In-DOTA-biotin at the tumor
were 17–24% ID/g (mean, 21.66 ± 3.17% ID/g) and
occurred by 2 h postadministration. This was a significantly
higher peak uptake than that observed with the pretargeted C2B8/SA
conjugate at the comparable time point (mean, 8.40 ± 0.62% ID/g; P < 0.05; data not shown).
Tumor:blood ratios of pretargeted B9E9 scFvSA increased from 90 at
2 h after DOTA-biotin injection to >700 by 24 h after
DOTA-biotin injection. 111In-DOTA-biotin
concentration in the blood and in most well-perfused soft tissues was
very low, generally <2% of the injected dose in any of the
assayed tissues at all time points. Significant liver uptake of
111In-DOTA-biotin was not observed, indicating
that the 125I-labeled scFvSA had been efficiently
internalized by the action of the clearing agent, making it unable to
bind subsequently administered radiobiotin. In these experiments, no
effort was made to optimize the dose of the fusion protein, clearing
agent, or DOTA-biotin, nor was any effort made to optimize the schedule
of administration of these components.
|
, whereas the % ID/g-h AUCs of blood showed similar total values (9%
ID/g-h versus 18% ID/g-h for B9E9 and CC49 fusion proteins,
respectively). Ratios of tumor AUC:blood AUC were >60 for the
B9E9 group versus 1.2 for the CC49 group.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Although high level E. coli expression of antibody fragments has been achieved, most scFvSA fusion proteins are poorly expressed or insoluble in the periplasmic space (23, 24, 25, 26, 27) . Despite the fact that insoluble proteins in the cytoplasm or periplasm can occasionally be refolded from inclusion bodies, this approach is not practical for large scale or high molecular weight proteins. Multiple factors, such as the leader sequence, the linker used, the order of variable regions, the host strain, and the growth conditions, affect the periplasmic expression of antibody fragments and the degree of aggregation (28, 29, 30, 31) . In this study, the scFvSA expression levels were affected dramatically by the order of the variable regions and the length and/or composition of the scFv linker. No variations were made in the leader sequence or the linker between the scFv and streptavidin, and these also may be amenable to further optimization.
The in vitro and in vivo functionality demonstrated by the B9E9 scFvSA is consistent and reproducible. In vitro, the competitive immunoreactivity with the B9E9 mAb showed evidence of increased avidity of the tetramer, a phenomenon already noted with trivalent and tetravalent Fab' constructs (32) . Also exhibited is the intact immunoreactivity of the variable regions of the whole antibody when incorporated into the scFv motif. The biotin binding capacity of the scFvSA was nearly equivalent to that of commercially available recombinant streptavidin, whereas the biotin dissociation rate of the B9E9 scFvSA at physiological temperature was unperturbed. These data indicate that the fusion of B9E9 scFv to the NH2 terminus of each subunit of streptavidin had a negligible effect on the tertiary and quanternary structural requirements of streptavidin to mediate high-affinity biotin binding. The biochemical uniformity of the purified B9E9 scFvSA alone makes it a superior test agent compared with our first-generation mAb-streptavidin covalent conjugates. In addition, the fusion protein exhibits increased antigen-binding avidity, which should decrease streptavidin dissociation from tumor, a key factor in the mathematical modeling of multistep delivery protocols (33 , 34) . This could be particularly critical in our pretargeting protocol, which rapidly and dramatically disrupts the equilibrium between tumor-bound and circulating immunoconjugate by administration of a clearing agent.
In vivo, the B9E9 scFvSA exhibited more rapid systemic
clearance than our mAb-streptavidin conjugates, which is consistent
with its lack of the Fc region of the antibody. However, the greater
molecular weight of the scFvSA tetramer (174,000) compared with
conventional antibody fragments (Fab, Fab', and scFv) provides the
fusion protein with sufficient hydrodynamic radius to avoid direct
renal elimination via glomerular filtration. In fact, no intact fusion
protein or monomeric subunits can be detected in animals’ urine after
systemic administration (data not shown). The B9E9 scFvSA half-life of
16 h appears to be sufficient to allow extravasation from the blood
and efficient binding to the tumor-associated antigen. Dual-label
coinjection studies of equimolar amounts of C2B8 mAb and B9E9 scFvSA in
mice bearing lymphoma xenografts have shown that peak tumor
concentrations of both proteins are equivalent, despite the prolonged,
elevated blood concentration of the C2B8 molecule. In general, the
absence of the whole antibody Fc region should minimize uptake of B9E9
scFvSA in specialized antibody reservoirs, such as the Brambell
receptor (35)
. In our full pretargeting protocol, B9E9
scFvSA is directed quantitatively from the blood to the liver for
hepatic processing in a manner similar to that described for other
conjugates and tumor models (6)
.
In recent years, immunotherapy of relapsed or refractory low-grade NHL
with CD20 mAbs has been shown to be effective in inducing an objective
tumor response. Clinical studies using unlabeled antibody (C2B8,
rituximab) and radiolabeled antibodies (Y2B8 and Bexxar) have been
recently reviewed by others (1, 2, 3)
. The work of Press
et al. (4)
and Liu et al.
(5)
using myeloablative doses of
131I-labeled B1 has proven that dose
intensification of I-131 by a factor of 8 results in a higher
complete response rate and a longer duration of response, albeit at the
cost of stem cell rescue. Whether given in nonmyeloablative or
myeloablative protocols, RIT continues to show promise for replacing
total body irradiation in the treatment of NHL. Our own pilot clinical
pretargeting efforts in this indication using C2B8/SA conjugate as a
model targeting vehicle yielded promising results in terms of clinical
responses, absolute tumor-targeting efficiency, and minimal
myelotoxicity, even at high 90Y doses
(10)
.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by SBIR Grant 1 R44
CA85130-01. 
2 To whom requests for reprints should be
addressed, at NeoRx Corporation, Molecular Biology Research, 410 West
Harrison Street, Seattle, WA 98119-4007.
3 The abbreviations used are: mAb, monoclonal
antibody; NHL, non-Hodgkin’s lymphoma; RIT, radioimmunotherapy; scFv,
single-chain Fv; scFvSA, scFv-streptavidin; VL, variable
light chain; VH, variable heavy chain; IPTG,
isopropyl-ß-D-galactopyranoside; HPLC, high performance
liquid chromatography; GalNAc, N-acetyl galactosamine;
DOTA, 1,4,7,10-tetra-azacyclododecane-1,4,7,10-tetraacetic acid; %
ID/g, percentage of injected dose per gram; AUC, area under the
curve.
4 J. Schultz, Y. Lin, J. Sanderson, and Y. Zuo,
unpublished data.
Received 7/17/00. Accepted 9/27/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. Hu, X. Huang, C.-C. Ling, D. R. Bundle, and N.-K. V. Cheung Reducing Epitope Spread during Affinity Maturation of an Anti-Ganglioside GD2 Antibody J. Immunol., November 1, 2009; 183(9): 5748 - 5755. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Green, J. M. Pagel, E. R. Nemecek, Y. Lin, A. Kenoyer, A. Pantelias, D. K. Hamlin, D. S. Wilbur, D. R. Fisher, J. G. Rajendran, et al. Pretargeting CD45 enhances the selective delivery of radiation to hematolymphoid tissues in nonhuman primates Blood, August 6, 2009; 114(6): 1226 - 1235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Pagel, N. Orgun, D. K. Hamlin, D. S. Wilbur, T. A. Gooley, A. K. Gopal, S. I. Park, D. J. Green, Y. Lin, and O. W. Press A comparative analysis of conventional and pretargeted radioimmunotherapy of B-cell lymphomas by targeting CD20, CD22, and HLA-DR singly and in combinations Blood, May 14, 2009; 113(20): 4903 - 4913. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Buchegger, O. W. Press, A. B. Delaloye, and N. Ketterer Radiolabeled and Native Antibodies and the Prospect of Cure of Follicular Lymphoma Oncologist, June 1, 2008; 13(6): 657 - 667. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Green, J. M. Pagel, A. Pantelias, N. Hedin, Y. Lin, D. S. Wilbur, A. Gopal, D. K. Hamlin, and O. W. Press Pretargeted Radioimmunotherapy for B-Cell Lymphomas Clin. Cancer Res., September 15, 2007; 13(18): 5598s - 5603s. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pantelias, J. M. Pagel, N. Hedin, L. Saganic, S. Wilbur, D. K. Hamlin, D. S. Wilbur, Y. Lin, D. Stone, D. Axworthy, et al. Comparative biodistributions of pretargeted radioimmunoconjugates targeting CD20, CD22, and DR molecules on human B-cell lymphomas Blood, June 1, 2007; 109(11): 4980 - 4987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Pagel, Y. Lin, N. Hedin, A. Pantelias, D. Axworthy, D. Stone, D. K. Hamlin, D. S. Wilbur, and O. W. Press Comparison of a tetravalent single-chain antibody-streptavidin fusion protein and an antibody-streptavidin chemical conjugate for pretargeted anti-CD20 radioimmunotherapy of B-cell lymphomas Blood, July 1, 2006; 108(1): 328 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Lin, J. M. Pagel, D. Axworthy, A. Pantelias, N. Hedin, and O. W. Press A Genetically Engineered Anti-CD45 Single-Chain Antibody-Streptavidin Fusion Protein for Pretargeted Radioimmunotherapy of Hematologic Malignancies. Cancer Res., April 1, 2006; 66(7): 3884 - 3892. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. J. Forster, E. B. Santos, P. M. Smith-Jones, P. Zanzonico, and S. M. Larson Pretargeted Radioimmunotherapy with a Single-Chain Antibody/Streptavidin Construct and Radiolabeled DOTA-Biotin: Strategies for Reduction of the Renal Dose J. Nucl. Med., January 1, 2006; 47(1): 140 - 149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Buchsbaum, M.B. Khazaeli, D. B. Axworthy, J. Schultz, T. R. Chaudhuri, K. R. Zinn, M. Carpenter, and A. F. LoBuglio Intraperitoneal Pretarget Radioimmunotherapy with CC49 Fusion Protein Clin. Cancer Res., November 15, 2005; 11(22): 8180 - 8185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sato, R. Hassan, D. B. Axworthy, K. J. Wong, S. Yu, L. J. Theodore, Y. Lin, L. Park, M. W. Brechbiel, I. Pastan, et al. Pretargeted Radioimmunotherapy of Mesothelin-Expressing Cancer Using a Tetravalent Single-Chain Fv-Streptavidin Fusion Protein J. Nucl. Med., July 1, 2005; 46(7): 1201 - 1209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Forero, P. L. Weiden, J. M. Vose, S. J. Knox, A. F. LoBuglio, J. Hankins, M. L. Goris, V. J. Picozzi, D. B. Axworthy, H. B. Breitz, et al. Phase 1 trial of a novel anti-CD20 fusion protein in pretargeted radioimmunotherapy for B-cell non-Hodgkin lymphoma Blood, July 1, 2004; 104(1): 227 - 236. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Savage, L. Gao, K. Vento, P. Cowburn, S. Man, N. Steven, G. Ogg, A. McMichael, A. Epenetos, E. Goulmy, et al. Use of B cell-bound HLA-A2 class I monomers to generate high-avidity, allo-restricted CTLs against the leukemia-associated protein Wilms tumor antigen Blood, June 15, 2004; 103(12): 4613 - 4615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N.-K. V. Cheung, S. Modak, Y. Lin, H. Guo, P. Zanzonico, J. Chung, Y. Zuo, J. Sanderson, S. Wilbert, L. J. Theodore, et al. Single-Chain Fv-Streptavidin Substantially Improved Therapeutic Index in Multistep Targeting Directed at Disialoganglioside GD2 J. Nucl. Med., May 1, 2004; 45(5): 867 - 877. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yao, M. Zhang, K. Garmestani, D. B. Axworthy, R. W. Mallett, A. R. Fritzberg, L. J. Theodore, P. S. Plascjak, W. C. Eckelman, T. A. Waldmann, et al. Pretargeted {alpha} Emitting Radioimmunotherapy Using 213Bi 1,4,7,10-Tetraazacyclododecane-N,N',N'',N'''-Tetraacetic Acid-Biotin Clin. Cancer Res., May 1, 2004; 10(9): 3137 - 3146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Stebbing, B. Gazzard, S. Patterson, M. Bower, D. Perumal, M. Nelson, A. McMichael, G. Ogg, A. Epenetos, F. Gotch, et al. Antibody-targeted MHC complex-directed expansion of HIV-1- and KSHV-specific CD8+ lymphocytes: a new approach to therapeutic vaccination Blood, March 1, 2004; 103(5): 1791 - 1795. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Graves, E. Dearstyne, Y. Lin, Y. Zuo, J. Sanderson, J. Schultz, A. Pantalias, D. Gray, D. Axworthy, H. M. Jones, et al. Combination Therapy with Pretarget CC49 Radioimmunotherapy and Gemcitabine Prolongs Tumor Doubling Time in a Murine Xenograft Model of Colon Cancer More Effectively Than Either Monotherapy Clin. Cancer Res., September 1, 2003; 9(10): 3712 - 3721. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Pagel, N. Hedin, K. Subbiah, D. Meyer, R. Mallet, D. Axworthy, L. J. Theodore, D. S. Wilbur, D. C. Matthews, and O. W. Press Comparison of anti-CD20 and anti-CD45 antibodies for conventional and pretargeted radioimmunotherapy of B-cell lymphomas Blood, March 15, 2003; 101(6): 2340 - 2348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. C. Boerman, F. G. van Schaijk, W. J.G. Oyen, and F. H.M. Corstens Pretargeted Radioimmunotherapy of Cancer: Progress Step by Step J. Nucl. Med., March 1, 2003; 44(3): 400 - 411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Subbiah, D. K. Hamlin, J. M. Pagel, D. S. Wilbur, D. L. Meyer, D. B. Axworthy, R. W. Mallett, L. J. Theodore, P. S. Stayton, and O. W. Press Comparison of Immunoscintigraphy, Efficacy, and Toxicity of Conventional and Pretargeted Radioimmunotherapy in CD20-Expressing Human Lymphoma Xenografts J. Nucl. Med., March 1, 2003; 44(3): 437 - 445. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, Z. Zhang, K. Garmestani, J. Schultz, D. B. Axworthy, C. K. Goldman, M. W. Brechbiel, J. A. Carrasquillo, and T. A. Waldmann Pretarget radiotherapy with an anti-CD25 antibody-streptavidin fusion protein was effective in therapy of leukemia/lymphoma xenografts PNAS, February 18, 2003; 100(4): 1891 - 1895. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. H. Laitinen, H. R. Nordlund, V. P. Hytonen, S. T. H. Uotila, A. T. Marttila, J. Savolainen, K. J. Airenne, O. Livnah, E. A. Bayer, M. Wilchek, et al. Rational Design of an Active Avidin Monomer J. Biol. Chem., January 31, 2003; 278(6): 4010 - 4014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zhang, Z. Yao, K. Garmestani, D. B. Axworthy, Z. Zhang, R. W. Mallett, L. J. Theodore, C. K. Goldman, M. W. Brechbiel, J. A. Carrasquillo, et al. Pretargeting radioimmunotherapy of a murine model of adult T-cell leukemia with the alpha -emitting radionuclide, bismuth 213 Blood, June 17, 2002; 100(1): 208 - 216. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. W. Press, M. Corcoran, K. Subbiah, D. K. Hamlin, D. S. Wilbur, T. Johnson, L. Theodore, E. Yau, R. Mallett, D. L. Meyer, et al. A comparative evaluation of conventional and pretargeted radioimmunotherapy of CD20-expressing lymphoma xenografts Blood, October 15, 2001; 98(8): 2535 - 2543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. W. Press, J. P. Leonard, B. Coiffier, R. Levy, and J. Timmerman Immunotherapy of Non-Hodgkin's Lymphomas Hematology, January 1, 2001; 2001(1): 221 - 240. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
) or mAb (
) were competed with fluorescein-labeled
B9E9 mAb for binding to CD20-positive human lymphoma Ramos cells.
