| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Division of Hematology-Oncology, Department of Medicine, and Jonsson Comprehensive Cancer Center [R. S. I., J. F., B. Y. K., J. C. G., D. D. C.], and Departments of Biological Chemistry [D. B., J. C. G.], Obstetrics and Gynecology [B. Y. K.], and Microbiology, Immunology and Molecular Genetics [D. D. C.], University of CaliforniaLos Angeles School of Medicine, Los Angeles, California 90095, and Division of Gynecologic Oncology, Cedars-Sinai Medical Center, Los Angeles, California 90048 [R. L. B., B. Y. K.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
23,000
women will be diagnosed with this disease and close to 14,000 will die
from it. A significant factor contributing to the high mortality rate
of ovarian cancer is the relatively asymptomatic progression of this
disease. As a consequence, most patients are diagnosed with advanced
(stage III/IV) disease when widespread i.p. metastases are already
present (2)
. Greater than 90% of ovarian malignancies
arise from the transformation of the ovarian surface epithelium, a
single continuous layer of epithelial cells surrounding the ovary.
There are estimated to be 20,000 genes expressed in a typical cell, and
1% of those is differentially expressed in cancerous
versus normal cells (3)
. A limited number of
genes has been found to have elevated or depressed levels of expression
in ovarian cancers when compared with normal tissue
(4, 5, 6, 7, 8)
. As in other neoplasm, it is generally accepted
that both activation of oncogenes and inactivation of tumor suppressor
genes are involved in the etiology of ovarian carcinomas. Brca1, Brca2,
and p53 mutations are associated with the development and progression
of ovarian cancer (9, 10, 11)
. Because these proteins are
involved in the maintenance of genomic integrity, loss of their
functions is thought to result in the accumulation of genetic
mutations, leading to extensive changes in gene expression
(12, 13, 14, 15)
. Comparison between gene expression profiles of
normal ovarian epithelial cells and ovarian tumors could identify
candidate genes for biological markers of cellular transformation,
possibly leading to earlier detection and new therapy.
Because ovarian epithelial cells represent a small proportion of the
total cells found in the normal ovary, it is difficult to obtain
primary material that is free of contaminating ovarian stromal cells in
large enough quantities to conduct comparative gene expression studies.
However, ovarian epithelial cells can be isolated and expanded in
culture for
15 passages (16
, 17)
. The ability to
culture human ovarian epithelial cells from both normal ovaries and
ovarian carcinomas provides an opportunity to study differential gene
expression between relatively pure populations of normal
versus tumor-derived epithelial cells. This type of
comparison minimizes gene expression differences that reflect the
presence of nonepithelial cells, such as stromal or germ cells of
normal ovaries and host-derived immune cells in ovarian tumors.
We used cDNA-RDA3 to identify a set of genes that are differentially expressed between primary cultures of normal and tumor-derived ovarian epithelial cells. cDNA-RDA was subsequently combined with cDNA filter array hybridization to identify a subset of genes that are aberrantly expressed in a large number of malignant ovarian epithelial cells. Direct gene expression profiles were obtained by Northern blot analysis on four differentially expressed genes to confirm the cDNA array analysis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines.
TfxH, an SV40 Large T antigen-immortalized HOSE cell line, was grown in
199:MCDB 105 (1:1) medium containing 10% FCS (17)
.
Ovarian carcinoma-derived cell lines, Caov-3 and Sk-OV-3 (American Type
Culture Collection, Manassas, VA), were grown in the presence of
10% FCS in DMEM or McCoys 5A medium, respectively.
Cloning of Differentially Expressed Genes Using cDNA-RDA.
cDNA-RDA was used to compare gene expression between two HOSE and two
CSOC cultures (20)
. Total RNA was prepared from each
culture, using RNA STAT-60 reagent (Tel-Test, Inc., Friendswood, TX).
mRNA was purified from 120 µg of total RNA using Oligotex mRNA
columns (Qiagen, Inc., Chatsworth, CA) and used for cDNA synthesis.
cDNA from HOSE and CSOC samples was digested with Dpn II and
PCR-amplified following the addition of RDA adapters. Subtractive
hybridization was performed in 2.5 µl of 3x EEP buffer [10
mM EPPS[N-(2-hydroxyethyl)
piperazine-N'-3-propanesulfonic acid], 1 mM
EDTA, 1 M NaCl, and 10% polyethylene glycol] for 21 h at 67°C.
Two rounds of subtraction were performed in both directions, using
tester to driver ratios of 1:100 and 1:500 for the first and second
rounds, respectively. Finally, the cDNA-RDA products were digested with
Dpn II and cloned into the BamHI site of pBluescript
KS+ (Stratagene, La Jolla, CA).
Amplification of Individual cDNAs.
Individual bacterial transformants were isolated into 96-well
microtiter plates containing 100 µl of LB-ampicillin (100 µg/ml)
and incubated overnight at 37°C. Using a 96-well replicating tool
(V&P Scientific, San Diego, CA), bacterial culture was transferred into
96-well thermowell plates (Costar, Cambridge, MA) to inoculate 50-µl
PCR reactions containing 250 µM dNTPs, 1 ng/µl SK
(GGCCGCTCTAGAACTAGTGGATC) and KS (TGATATCGAATTCCTGCAGCCCG) primer each,
and 0.03 u/µl Taq polymerase (Qiagen, Inc.). Amplification was
carried out for 35 cycles (94°C for 45 s, 68°C for
45 s, 72°C for 1 min), with a final 10-min extension at 72°C.
The average size of the PCR-amplified fragments was
500 bp.
Identification of Nonredundant Clones.
The PCR-amplified inserts were spotted onto 7.8 x 12.3-cm Hybond N+ membrane (Amersham Corp., Arlington Heights, IL),
using a 96-well replicating tool. Redundant clones were eliminated by
back hybridization, as described previously (21)
. The DNA
sequences of nonredundant clones were determined using a commercially
available sequencing kit (ABI PRISM Dye Terminator Cycle Sequencing
Ready Reaction Kit; Perkin-Elmer Corp., Foster City, CA). The
nucleotide sequences were analyzed using the BLASTN program and the
GenBank database.
cDNA Filter Hybridization of Arrayed Nonredundant Clones.
Nonredundant cDNA-RDA fragments were organized into 96-well plates and
subsequently arrayed in duplicate on nylon membranes. cDNA array
hybridization was carried out as described previously
(21)
. To generate probes,
50 µg of total RNA from
each of 5 HOSE and 10 CSOC cultures were poly(A) selected and used to
synthesize cDNA. One-fifth of the total cDNA obtained was labeled with
[32P]-
-dCTP, using a random primer labeling
kit (Prime-it II; Stratagene). The hybridization signal was quantified
on a phosphorimager (Molecular Dynamics), using the ImageQuaNT software
package.
Standardization of Quantitative Data.
The signal intensity per pixel within each square of the grid was
calculated and corrected for the background. Each filter was also
spotted with actin, tubulin, glyceraldehyde-3-phosphate dehyrdrogenase
and EF-Tu cDNAs. These genes function in housekeeping activities in the
cell and display little variability in expression between normal and
transformed cells (22)
. EF-Tu, which showed the least
variability in mRNA expression between all of the samples, was used as
the internal standard in this study. The signal of each
background-corrected spot was determined relative to average
background-corrected signal for EF-Tu within a given filter, and
averages of HOSE and CSOC standardized signal were compared for each of
the 864 dots on the filter. In this study, only those with differences
>2.5-fold were considered to be differentially expressed.
Northern Blot Analysis.
Total RNA (5 µg) was separated on 0.9% agarose formaldehyde gels and
transferred to Hybond-N+ nylon membranes. Filters were hybridized with
32P-cDNA probes corresponding to the
differentially expressed genes, as described previously
(21)
. The filters were then stripped and rehybridized with
32P-labeled EF-Tu cDNA to control for mRNA
loading.
| RESULTS |
|---|
|
|
|---|
|
cDNA-RDA Was Used to Identify Differentially Expressed Genes in
Ovarian Cancer Cells.
A total of 255 nonredundant genes were identified after two rounds of
subtractive hybridization. Of these, 95 were preferentially expressed
in CSOC cells and 160 in HOSE cells. We then used cDNA array
hybridization to identify a subset of genes that were differentially
expressed in a larger cohort of HOSE and CSOC cultures. Duplicate
filters were spotted with genes identified by cDNA-RDA and hybridized
with 32P-labeled cDNA probes derived from
additional 5 HOSE and 10 CSOC cultures. Forty-four HOSE-specific and 16
CSOC-specific genes displayed a >2.5-fold difference in expression
(Tables 2
and 3)
. An example of cDNA filter arrays probed with
32P-labeled cDNAs from HOSE 224 or CSOC 869 cells
are shown in Fig. 1
. cDNA array hybridization easily identified Cx43 and OSF-2 as HOSE- and
CSOC-specific genes, respectively. The hybridization signal intensity
of Doc-1, which was cloned as a HOSE-specific gene in cDNA-RDA, on the
other hand, did not vary significantly between these two HOSE and CSOC
cultures. The expression levels of EF-Tu, a
housekeeping gene shown to be expressed at a constant level in normal
and cancer cells (22)
, remained unchanged in HOSE 224 and
CSOC 869 cells.
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Because of the variability in signal intensities in array hybridization analysis, we focused our attention on genes displaying a >2.5 fold difference in the expression level. Whereas the reliance on cDNA array hybridization with this arbitrary cutoff may have eliminated some differentially expressed genes from our analysis, it was highly effective in identifying genes that display a consistent pattern of expression differences in a large number of CSOC samples. Among the subset of genes displaying an expression level difference of >2.5-fold there was strong qualitative correlation between cDNA array hybridization data and Northern analysis. Northern analysis confirmed KRT19, Cx43, and STC as HOSE-specific genes and OSF-2 as a CSOC-specific gene. Two genes, Doc-1 and GDN, with expression level differences of <2.5-fold in cDNA array hybridization, on the other hand, displayed only a moderate difference (e.g., GDN) or a high sample-to-sample variability (e.g., Doc-1) in Northern analyses.
The gene expression patterns seen in HOSE and CSOC cells were not consistent with those seen with TfxH cells, an immortalized HOSE cell line, or Caov-3 and Sk-OV-3, two ovarian carcinoma-derived cell lines. Because these cell lines were originally derived from normal epithelial or tumor-derived epithelial cells, similar to HOSE and CSOC cells (27) , our results illustrate the divergence of gene expression that can occur as the result of long-term in vitro manipulation of these cells. Although cell lines provide a relatively simple model to examine gene expression in ovarian cancer-derived cells, our findings emphasize that the use of HOSE and CSOC cultures represents a better model system of normal and cancerous ovarian tissues in comparative gene expression analysis.
The use of cultured ovarian epithelial cells is not without concerns. Ovarian tumors frequently are histologically inhomogeneous (2) . There are reports in the literature of loss of tumor markers associated with continuous tissue culture of some xenograft lines (28, 29, 30, 31) . Despite the primary tumors containing areas of differentiated cells, in each instance, a selection of a poorly differentiated subpopulation had occurred during the propagation of these lines. Although we have used primary cultures to avoid a selection bias inherent in any long-term cultures, we cannot formally exclude the possibility that our cultured CSOC cells represent a subpopulation of cancer cells present in the original tumor, or in vitro expansion conditions may have modified gene expression. In the case of OSF-2, there was a high degree of concordance in its expression in tumors and their corresponding CSOC cells, indicating that despite the in vitro expansion process, the expression of this particular gene is preserved in the cultured cells.
The extent of gene expression differences between HOSE and CSOC cultures is not known. Numerous genes identified in this study, including Doc-1, have previously been shown to be differentially expressed in ovarian carcinomas (4, 5, 6, 7, 8) . Comparing our data to previous studies on ovarian cancer-related genes revealed only a minor degree of overlap, indicating that the extent of gene expression differences far exceeds the number of genes identified in this or other previous studies. Genes associated with protein synthesis or mitochondrial metabolism are frequently identified in differential gene expression analysis of tumor tissues when compared with the normal tissue, and have been attributed to differences in proliferative and metabolic rates (8 , 32) . The absence of such genes in our analysis probably reflects the use of HOSE and CSOC cells, which are morphologically indistinguishable and display similar growth characteristics. This finding further emphasizes the use of HOSE cells as well-matched controls in comparative gene analysis to identify aberrant gene expression in CSOC cells.
Several of the genes identified in this study are noteworthy. OSF-2 was originally reported as a transforming growth factor ß-inducible protein secreted in the extracellular matrix of the periosteum (33) . The potential significance of OSF-2 in ovarian cancer is illustrated by the high degree of OSF-2 overexpression observed in both ovarian tumors and cultured CSOC cells. OSF-2 overexpression in CSOC cells may be a consequence of inappropriate transforming growth factor ß signaling that can be seen in some CSOC cells (19 , 34) . Although the function of OSF-2 is not known, OSF-2 or a related protein, ßig-H3, is believed to function as a matrix protein that promotes cell attachment (33 , 35) . One possibility is that OSF-2 expression may facilitate i.p. spread of cancer cells, which leads to a significant morbidity and mortality in women with ovarian cancer. STC is expressed at high levels in organs derived from the müllerian duct (36) , and, therefore, the loss of STC expression in CSOC cells may reflect cellular de-differentiation. Cx43 and Cx40, which encode gap junction proteins, were cloned as HOSE-specific genes. Decreased gap junction communication and loss of Cx43 expression have been reported in ovarian cancer (37) and may be related to the loss of epithelial cell features in cancer cells, as well as decreased cellular communication that is seen in many types of cancers.
In conclusion, the availability of primary epithelial cultures from
both normal and malignant ovaries has enabled the identification of 60
differentially expressed genes, using a combination of subtractive
hybridization and cDNA array expression studies. Despite the lack of
observable phenotypic or growth differences between HOSE and CSOC
cells, reciprocal expression of OSF-2 with STC, KRT19, and Cx43 was
seen, reflecting differences in these cells at the molecular level. A
large number of genes identified in this study encode transmembrane or
secreted proteins (see Tables 2
and 3
) that may be present in serum and
could be used as marker for ovarian cancer. In addition, the genes
identified in this study may provide clues to the cellular changes
responsible for metastatic progression of ovarian cancer.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by a grant from the United States Army
Medical Research and Materiel Command (DAMD17919503). ![]()
2 To whom requests for reprints should be
addressed, at Division of Hematology-Oncology, University of
CaliforniaLos Angeles School of Medicine, Factor 10-240L, 10833 Le
Conte Avenue, Los Angeles, CA 90095. ![]()
3 The abbreviations used are: cDNA-RDA, cDNA
representational differences analysis; HOSE, human ovarian surface
epithelial; CSOC, Cedars-Sinai Ovarian Cancer; EF-Tu, translation
elongation factor; Cx43, connexin 43; OSF-2, osteoblast-specific factor
2; KRT19, keratin 19; STC, stanniocalcin; GDN, glia-derived nexin. ![]()
Received 2/29/00. Accepted 9/22/00.
| REFERENCES |
|---|
|
|
|---|
1ß1. Biochim. Biophys. Acta, 1451: 196205, 1999.
This article has been cited by other articles:
![]() |
B. Quaresima, F. Romeo, M. C. Faniello, M. Di Sanzo, C.-G. Liu, A. Lavecchia, C. Taccioli, E. Gaudio, F. Baudi, F. Trapasso, et al. BRCA1 5083del19 Mutant Allele Selectively Up-Regulates Periostin Expression In vitro and In vivo Clin. Cancer Res., November 1, 2008; 14(21): 6797 - 6803. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Tchagang, A. H. Tewfik, M. S. DeRycke, K. M. Skubitz, and A. P.N. Skubitz Early detection of ovarian cancer using group biomarkers Mol. Cancer Ther., January 1, 2008; 7(1): 27 - 37. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Castronovo, D. Waltregny, P. Kischel, C. Roesli, G. Elia, J.-N. Rybak, and D. Neri A Chemical Proteomics Approach for the Identification of Accessible Antigens Expressed in Human Kidney Cancer Mol. Cell. Proteomics, November 1, 2006; 5(11): 2083 - 2091. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Y. Yeung, K. P. Lai, H. Y. Chan, N. K. Mak, G. F. Wagner, and C. K. C. Wong Hypoxia-Inducible Factor-1-Mediated Activation of Stanniocalcin-1 in Human Cancer Cells Endocrinology, November 1, 2005; 146(11): 4951 - 4960. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Qiu, Z. J. Wang, and K. J. R. Liu Ensemble dependence model for classification and prediction of cancer and normal gene expression data Bioinformatics, July 15, 2005; 21(14): 3114 - 3121. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Santin, S. Cane, S. Bellone, M. Palmieri, E. R. Siegel, M. Thomas, J. J. Roman, A. Burnett, M. J. Cannon, and S. Pecorelli Treatment of Chemotherapy-Resistant Human Ovarian Cancer Xenografts in C.B-17/SCID Mice by Intraperitoneal Administration of Clostridium perfringens Enterotoxin Cancer Res., May 15, 2005; 65(10): 4334 - 4342. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hibbs, K. M. Skubitz, S. E. Pambuccian, R. C. Casey, K. M. Burleson, T. R. Oegema Jr, J. J. Thiele, S. M. Grindle, R. L. Bliss, and A. P.N. Skubitz Differential Gene Expression in Ovarian Carcinoma: Identification of Potential Biomarkers Am. J. Pathol., August 1, 2004; 165(2): 397 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Heinzelmann-Schwarz, M. Gardiner-Garden, S. M. Henshall, J. Scurry, R. A. Scolyer, M. J. Davies, M. Heinzelmann, L. H. Kalish, A. Bali, J. G. Kench, et al. Overexpression of the Cell Adhesion Molecules DDR1, Claudin 3, and Ep-CAM in Metaplastic Ovarian Epithelium and Ovarian Cancer Clin. Cancer Res., July 1, 2004; 10(13): 4427 - 4436. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shao, S. Bao, X. Bai, C. Blanchette, R. M. Anderson, T. Dang, M. L. Gishizky, J. R. Marks, and X.-F. Wang Acquired Expression of Periostin by Human Breast Cancers Promotes Tumor Angiogenesis through Up-Regulation of Vascular Endothelial Growth Factor Receptor 2 Expression Mol. Cell. Biol., May 1, 2004; 24(9): 3992 - 4003. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Matei, D. D. Chang, and M.-H. Jeng Imatinib Mesylate (Gleevec) Inhibits Ovarian Cancer Cell Growth through a Mechanism Dependent on Platelet-Derived Growth Factor Receptor {alpha} and Akt Inactivation Clin. Cancer Res., January 15, 2004; 10(2): 681 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Stronach, G. C. Sellar, C. Blenkiron, G. J. Rabiasz, K. J. Taylor, E. P. Miller, C. E. Massie, A. Al-Nafussi, J. F. Smyth, D. J. Porteous, et al. Identification of Clinically Relevant Genes on Chromosome 11 in a Functional Model of Ovarian Cancer Tumor Suppression Cancer Res., December 15, 2003; 63(24): 8648 - 8655. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Zorn, A. A. Jazaeri, C. S. Awtrey, G. J. Gardner, S. C. Mok, J. Boyd, and M. J. Birrer Choice of Normal Ovarian Control Influences Determination of Differentially Expressed Genes in Ovarian Cancer Expression Profiling Studies Clin. Cancer Res., October 15, 2003; 9(13): 4811 - 4818. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hellstrom, J. Raycraft, M. Hayden-Ledbetter, J. A. Ledbetter, M. Schummer, M. McIntosh, C. Drescher, N. Urban, and K. E. Hellstrom The HE4 (WFDC2) Protein Is a Biomarker for Ovarian Carcinoma Cancer Res., July 1, 2003; 63(13): 3695 - 3700. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. A. Rangel, R. Agarwal, T. D'Souza, E. S. Pizer, P. L. Alo, W. D. Lancaster, L. Gregoire, D. R. Schwartz, K. R. Cho, and P. J. Morin Tight Junction Proteins Claudin-3 and Claudin-4 Are Frequently Overexpressed in Ovarian Cancer but Not in Ovarian Cystadenomas Clin. Cancer Res., July 1, 2003; 9(7): 2567 - 2575. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Dennis, J. K. Vass, E. C. Wit, W. N. Keith, and K. A. Oien Identification from Public Data of Molecular Markers of Adenocarcinoma Characteristic of the Site of Origin Cancer Res., November 1, 2002; 62(21): 5999 - 6005. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gillan, D. Matei, D. A. Fishman, C. S. Gerbin, B. Y. Karlan, and D. D. Chang Periostin Secreted by Epithelial Ovarian Carcinoma Is a Ligand for {alpha}V{beta}3 and {alpha}V{beta}5 Integrins and Promotes Cell Motility Cancer Res., September 15, 2002; 62(18): 5358 - 5364. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Macgregor and J. A. Squire Application of Microarrays to the Analysis of Gene Expression in Cancer Clin. Chem., August 1, 2002; 48(8): 1170 - 1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Welcsh, M. K. Lee, R. M. Gonzalez-Hernandez, D. J. Black, M. Mahadevappa, E. M. Swisher, J. A. Warrington, and M.-C. King BRCA1 transcriptionally regulates genes involved in breast tumorigenesis PNAS, May 28, 2002; 99(11): 7560 - 7565. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Mills, R. C. Bast Jr., and S. Srivastava Future for Ovarian Cancer Screening: Novel Markers From Emerging Technologies of Transcriptional Profiling and Proteomics J Natl Cancer Inst, October 3, 2001; 93(19): 1437 - 1439. [Full Text] [PDF] |
||||
![]() |
W. Zhang, P. M. Laborde, K. R. Coombes, D. A. Berry, and S. R. Hamilton Cancer Genomics: Promises and Complexities Clin. Cancer Res., August 1, 2001; 7(8): 2159 - 2167. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |