Cancer Research Prevention Award  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ismail, R. S.
Right arrow Articles by Chang, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ismail, R. S.
Right arrow Articles by Chang, D. D.
[Cancer Research 60, 6744-6749, December 1, 2000]
© 2000 American Association for Cancer Research


Tumor Biology

Differential Gene Expression between Normal and Tumor-derived Ovarian Epithelial Cells1

Rubina S. Ismail, Rae Lynn Baldwin, Junguo Fang, Damaris Browning, Beth Y. Karlan, Judith C. Gasson and David D. Chang2

Division of Hematology-Oncology, Department of Medicine, and Jonsson Comprehensive Cancer Center [R. S. I., J. F., B. Y. K., J. C. G., D. D. C.], and Departments of Biological Chemistry [D. B., J. C. G.], Obstetrics and Gynecology [B. Y. K.], and Microbiology, Immunology and Molecular Genetics [D. D. C.], University of California–Los Angeles School of Medicine, Los Angeles, California 90095, and Division of Gynecologic Oncology, Cedars-Sinai Medical Center, Los Angeles, California 90048 [R. L. B., B. Y. K.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The majority of ovarian tumors arise from the transformation of the ovarian surface epithelial cells, a single layer of cells surrounding the ovary. To identify genes that may contribute to the malignant phenotype of ovarian cancers, cDNA representational difference analysis was used to compare expressed genes in primary cultures of normal human ovarian surface epithelium (HOSE) and ovarian tumor-derived epithelial cells from the Cedars-Sinai Ovarian Cancer (CSOC) repository. A total of 255 differentially expressed genes were identified, of which 160 and 95 were specifically expressed in HOSE and CSOC cells, respectively. Using cDNA array hybridization, the expression profiles of the genes identified by cDNA-representational difference analysis were examined in an additional 5 HOSE and 10 CSOC lines. The comparison of average signal of each gene revealed 44 HOSE-specific and 16 CSOC-specific genes that exhibited at least a 2.5-fold difference in expression. A large number of genes identified in this study encode membrane-associated or secreted proteins and, hence, may be useful as targets in the development of serum-based diagnostic markers for ovarian cancer. Very few genes associated with protein synthesis or metabolism were identified in this study, reflecting the lack of observable differences in phenotypic or growth characteristics between HOSE and CSOC cells. Northern blot analysis on a subset of these genes demonstrated comparable levels of gene expression as observed in the cDNA array hybridization.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ovarian cancer is the fourth leading cause of cancer-related deaths in the United States (1) . Each year, ~23,000 women will be diagnosed with this disease and close to 14,000 will die from it. A significant factor contributing to the high mortality rate of ovarian cancer is the relatively asymptomatic progression of this disease. As a consequence, most patients are diagnosed with advanced (stage III/IV) disease when widespread i.p. metastases are already present (2) . Greater than 90% of ovarian malignancies arise from the transformation of the ovarian surface epithelium, a single continuous layer of epithelial cells surrounding the ovary.

There are estimated to be 20,000 genes expressed in a typical cell, and ~1% of those is differentially expressed in cancerous versus normal cells (3) . A limited number of genes has been found to have elevated or depressed levels of expression in ovarian cancers when compared with normal tissue (4, 5, 6, 7, 8) . As in other neoplasm, it is generally accepted that both activation of oncogenes and inactivation of tumor suppressor genes are involved in the etiology of ovarian carcinomas. Brca1, Brca2, and p53 mutations are associated with the development and progression of ovarian cancer (9, 10, 11) . Because these proteins are involved in the maintenance of genomic integrity, loss of their functions is thought to result in the accumulation of genetic mutations, leading to extensive changes in gene expression (12, 13, 14, 15) . Comparison between gene expression profiles of normal ovarian epithelial cells and ovarian tumors could identify candidate genes for biological markers of cellular transformation, possibly leading to earlier detection and new therapy.

Because ovarian epithelial cells represent a small proportion of the total cells found in the normal ovary, it is difficult to obtain primary material that is free of contaminating ovarian stromal cells in large enough quantities to conduct comparative gene expression studies. However, ovarian epithelial cells can be isolated and expanded in culture for ~15 passages (16 , 17) . The ability to culture human ovarian epithelial cells from both normal ovaries and ovarian carcinomas provides an opportunity to study differential gene expression between relatively pure populations of normal versus tumor-derived epithelial cells. This type of comparison minimizes gene expression differences that reflect the presence of nonepithelial cells, such as stromal or germ cells of normal ovaries and host-derived immune cells in ovarian tumors.

We used cDNA-RDA3 to identify a set of genes that are differentially expressed between primary cultures of normal and tumor-derived ovarian epithelial cells. cDNA-RDA was subsequently combined with cDNA filter array hybridization to identify a subset of genes that are aberrantly expressed in a large number of malignant ovarian epithelial cells. Direct gene expression profiles were obtained by Northern blot analysis on four differentially expressed genes to confirm the cDNA array analysis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Primary Ovarian Epithelial Cell Cultures.
The conditions for growing normal HOSE cells in vitro were modifications of the method described by Auersperg et al. (18) . Briefly, normal ovarian tissue was obtained from the operating room from consenting donors and placed in 199:MCDB 105 (1:1) medium (Sigma Chemical Co., St. Louis, MO) containing 10% FCS, 200 u/ml penicillin, and 200 µg/ml streptomycin. Epithelial cells were microdissected or scraped from the ovarian surface. The epithelial explants were placed in culture medium and allowed to attach and proliferate. Once the epithelial cells reached confluency, the explants were removed and the cells were subcultured. CSOC cultures were established from ovarian carcinomas in a similar manner. Fresh tumor tissue was finely minced with scissors and allowed to attach to culture dishes in McCoy’s 5A medium (Life Technologies, Inc., Grand Island, NY) supplemented with 10% FCS and penicillin/streptomycin. The epithelial nature of HOSE and CSOC cultures was verified by immunohistochemical analysis with antibodies against cytokeratin (AE1/AE3; Roche, Indianapolis, IN), vimentin (clone v9; Roche), and factor VIII (Factor VIIIC; Calbiochem), as described previously (19) . p53 status of cultures was determined by immunostaining with Ab-6 antibody (Roche).

Cell Lines.
TfxH, an SV40 Large T antigen-immortalized HOSE cell line, was grown in 199:MCDB 105 (1:1) medium containing 10% FCS (17) . Ovarian carcinoma-derived cell lines, Caov-3 and Sk-OV-3 (American Type Culture Collection, Manassas, VA), were grown in the presence of 10% FCS in DMEM or McCoy’s 5A medium, respectively.

Cloning of Differentially Expressed Genes Using cDNA-RDA.
cDNA-RDA was used to compare gene expression between two HOSE and two CSOC cultures (20) . Total RNA was prepared from each culture, using RNA STAT-60 reagent (Tel-Test, Inc., Friendswood, TX). mRNA was purified from 120 µg of total RNA using Oligotex mRNA columns (Qiagen, Inc., Chatsworth, CA) and used for cDNA synthesis. cDNA from HOSE and CSOC samples was digested with Dpn II and PCR-amplified following the addition of RDA adapters. Subtractive hybridization was performed in 2.5 µl of 3x EEP buffer [10 mM EPPS[N-(2-hydroxyethyl) piperazine-N'-3-propanesulfonic acid], 1 mM EDTA, 1 M NaCl, and 10% polyethylene glycol] for 21 h at 67°C. Two rounds of subtraction were performed in both directions, using tester to driver ratios of 1:100 and 1:500 for the first and second rounds, respectively. Finally, the cDNA-RDA products were digested with Dpn II and cloned into the BamHI site of pBluescript KS+ (Stratagene, La Jolla, CA).

Amplification of Individual cDNAs.
Individual bacterial transformants were isolated into 96-well microtiter plates containing 100 µl of LB-ampicillin (100 µg/ml) and incubated overnight at 37°C. Using a 96-well replicating tool (V&P Scientific, San Diego, CA), bacterial culture was transferred into 96-well thermowell plates (Costar, Cambridge, MA) to inoculate 50-µl PCR reactions containing 250 µM dNTPs, 1 ng/µl SK (GGCCGCTCTAGAACTAGTGGATC) and KS (TGATATCGAATTCCTGCAGCCCG) primer each, and 0.03 u/µl Taq polymerase (Qiagen, Inc.). Amplification was carried out for 35 cycles (94°C for 45 s, 68°C for 45 s, 72°C for 1 min), with a final 10-min extension at 72°C. The average size of the PCR-amplified fragments was ~500 bp.

Identification of Nonredundant Clones.
The PCR-amplified inserts were spotted onto 7.8 x 12.3-cm Hybond N+ membrane (Amersham Corp., Arlington Heights, IL), using a 96-well replicating tool. Redundant clones were eliminated by back hybridization, as described previously (21) . The DNA sequences of nonredundant clones were determined using a commercially available sequencing kit (ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit; Perkin-Elmer Corp., Foster City, CA). The nucleotide sequences were analyzed using the BLASTN program and the GenBank database.

cDNA Filter Hybridization of Arrayed Nonredundant Clones.
Nonredundant cDNA-RDA fragments were organized into 96-well plates and subsequently arrayed in duplicate on nylon membranes. cDNA array hybridization was carried out as described previously (21) . To generate probes, ~50 µg of total RNA from each of 5 HOSE and 10 CSOC cultures were poly(A) selected and used to synthesize cDNA. One-fifth of the total cDNA obtained was labeled with [32P]-{alpha}-dCTP, using a random primer labeling kit (Prime-it II; Stratagene). The hybridization signal was quantified on a phosphorimager (Molecular Dynamics), using the ImageQuaNT software package.

Standardization of Quantitative Data.
The signal intensity per pixel within each square of the grid was calculated and corrected for the background. Each filter was also spotted with actin, tubulin, glyceraldehyde-3-phosphate dehyrdrogenase and EF-Tu cDNAs. These genes function in housekeeping activities in the cell and display little variability in expression between normal and transformed cells (22) . EF-Tu, which showed the least variability in mRNA expression between all of the samples, was used as the internal standard in this study. The signal of each background-corrected spot was determined relative to average background-corrected signal for EF-Tu within a given filter, and averages of HOSE and CSOC standardized signal were compared for each of the 864 dots on the filter. In this study, only those with differences >2.5-fold were considered to be differentially expressed.

Northern Blot Analysis.
Total RNA (5 µg) was separated on 0.9% agarose formaldehyde gels and transferred to Hybond-N+ nylon membranes. Filters were hybridized with 32P-cDNA probes corresponding to the differentially expressed genes, as described previously (21) . The filters were then stripped and rehybridized with 32P-labeled EF-Tu cDNA to control for mRNA loading.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ovarian Epithelial Cells Can Be Expanded in Vitro.
Ovarian epithelial cells tend to assume atypical fibroblast-like morphology and a dual epithelio-mesenchymal phenotype that is characterized by the expression of both keratin (an epithelial marker) and vimentin (a mesenchymal marker) in culture (16) . Cultures containing endothelial cells, identified by Factor VIII staining, and ovarian stromal cells, characterized by the lack of cytokeratin staining and low levels of vimentin staining, were excluded in this study. The staining patterns for HOSE and CSOC cells used in the cDNA-RDA and cDNA filter array hybridization are presented in Table 1Citation .


View this table:
[in this window]
[in a new window]

 
Table 1 Characteristics of ovarian epithelial cells used for comparative gene expression studies

Pathological diagnosis of the primary cultures used for cDNA-RDA or cDNA filter array hybridization experiments are shown. Immunohistochemical analysis was performed to ensure that cells had homogeneous cytokeratin and vimentin staining with no factor VIII staining. p53 immunostaining results are also presented. Increasing intensities of staining are indicated from "+" to "+++".

 
There are no established molecular criteria to distinguish HOSE from CSOC cells. Therefore, we relied on cytogenetic studies to confirm that HOSE and CSOC cultures represent normal and malignant ovarian epithelial cells, respectively. Both HOSE cultures used in the cDNA-RDA contained normal female diploid cells; however, the cells from both CSOC cultures displayed an abnormal karyotype (Table 1)Citation . Sixty percent of CSOC 817 cells exhibited a loss of the X chromosome, which is commonly associated with ovarian carcinomas (23, 24, 25) . Rearrangements in chromosomes 12 and 18 were also seen in CSOC 817 cells. Ten percent of CSOC 826 cells contained a small chromosome that may be isochromosome 21. A gain in small regions of chromosome 2 was also observed in CSOC 826 cells, which is consistent with a previous study showing frequent gains in discrete regions of chromosome 2 in some ovarian cancer cells (26) . These abnormal karyotype profiles of CSOC 817 and CSOC 826 are consistent with the malignant origins of these cultures.

cDNA-RDA Was Used to Identify Differentially Expressed Genes in Ovarian Cancer Cells.
A total of 255 nonredundant genes were identified after two rounds of subtractive hybridization. Of these, 95 were preferentially expressed in CSOC cells and 160 in HOSE cells. We then used cDNA array hybridization to identify a subset of genes that were differentially expressed in a larger cohort of HOSE and CSOC cultures. Duplicate filters were spotted with genes identified by cDNA-RDA and hybridized with 32P-labeled cDNA probes derived from additional 5 HOSE and 10 CSOC cultures. Forty-four HOSE-specific and 16 CSOC-specific genes displayed a >2.5-fold difference in expression (Tables 2Citation and 3)Citation . An example of cDNA filter arrays probed with 32P-labeled cDNAs from HOSE 224 or CSOC 869 cells are shown in Fig. 1Citation . cDNA array hybridization easily identified Cx43 and OSF-2 as HOSE- and CSOC-specific genes, respectively. The hybridization signal intensity of Doc-1, which was cloned as a HOSE-specific gene in cDNA-RDA, on the other hand, did not vary significantly between these two HOSE and CSOC cultures. The expression levels of EF-Tu, a housekeeping gene shown to be expressed at a constant level in normal and cancer cells (22) , remained unchanged in HOSE 224 and CSOC 869 cells.


View this table:
[in this window]
[in a new window]

 
Table 2 Identification of genes preferentially expressed in HOSE cells

Genes preferentially expressed in HOSE cells with the GenBank matches are listed. Bold lettering indicates genes encoding proteins that are expressed on the cell membrane or that are secreted. Clones that failed to match any entry in the GenBank database (as of November 15, 1999) in the BLASTN searches are considered novel.

 

View this table:
[in this window]
[in a new window]

 
Table 3 Identification of genes preferentially expressed in CSOC cells

Genes preferentially expressed in CSOC cells with the GenBank matches are listed. Bold lettering indicates genes encoding proteins that are expressed on the cell membrane or that are secreted. Clones that failed to match any entry in the GenBank database (as of November 15, 1999) in the BLASTN searches are considered novel.

 


View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Analysis of cloned cDNA-RDA fragments by cDNA filter array hybridization. cDNA filter array hybridization was used to screen 255 differentially expressed gene fragments obtained after two rounds of cDNA-RDA. PCR-amplified fragments were spotted in a 96-well format onto nylon filter membranes. Duplicate filters were hybridized with random primed 32P-labeled cDNA probes derived from HOSE culture H224 (A) and CSOC culture C869 (B). The positions of Cx43 (1) , Doc-1 (2) , OSF-2 (3) , and EF-Tu (4) are boxed. The differences in the signal intensities of Cx43 and OSF-2 in H224 and C869 can be visually appreciated. In contrast, the signal intensities of Doc-1 in these two samples were not significantly different. The expression levels of EF-Tu, which remained relatively constant in H224 and C869, were used to standardize the hybridization signal.

 
To assess the predictive value of cDNA array hybridization analysis, four differentially expressed genes were chosen at random and evaluated by Northern blot analysis. OSF-2 was cloned as a CSOC-specific gene by cDNA-RDA, whereas the other three (KRT19, Cx43, and STC) had been identified as HOSE-specific genes. The expression levels of OSF-2 were greatly elevated in the 2 CSOC samples used for cDNA-RDA, as well as in 6 of the 9 CSOC samples used in array hybridization (Fig. 2)Citation . On the other hand, all three HOSE-specific genes were expressed at lower levels in CSOC cells (Fig. 2)Citation . For example, there was an overall decrease in Cx43 mRNA expression in CSOC samples compared with HOSE samples. STC and KRT19 were down-regulated in all but two CSOC samples. Interestingly, there was very little correlation in the expression of these genes in established ovarian cell lines. Specifically, OSF-2 was not overexpressed in either of the two established ovarian cancer cell lines Sk-Ov-3 and Caov-3. In addition, Cx43, which was expressed at varying levels in both HOSE and CSOC cultures, was not detected in either ovarian cancer cell lines or an SV40 Large T-antigen immortalized TfxH cell line.



View larger version (62K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Northern blot analysis of genes that were differentially expressed by >2.5-fold. RNA prepared from 7 HOSE and 11 CSOC cells used in cDNA-RDA and cDNA array analysis was hybridized with 32P-labeled probes of four randomly chosen genes that were differentially expressed by >2.5-fold in cDNA array analysis. OSF-2 was cloned as a CSOC-specific gene (A), whereas STC, Cx43, and KRT19 were cloned as HOSE-specific genes (B). In cDNA array analysis, the average signal intensity of OSF-2 was 65-fold greater in CSOC cells, compared with HOSE cells. STC, Cx43, and KRT19 were preferentially expressed in HOSE cells by 7-fold, 2.6-fold, and 7-fold, respectively. The filters were stripped and reprobed with EF-Tu to ensure integrity of RNA and to determine RNA loading differences.

 
The majority of genes identified by cDNA-RDA was found to be differentially expressed by <2.5-fold in cDNA array hybridization and eliminated from further consideration. To ensure that this arbitrary cutoff level did not eliminate any genes of interest, we performed Northern analysis on two cDNA clones displaying an expression level difference of <2.5-fold (Fig. 3)Citation . Northern analysis demonstrated that Doc-1, which was identified as a HOSE-specific gene in our study, as well as in a previous study (4) , was expressed at higher levels in HOSE samples. However, its expression was variable, accounting for the <2.5-fold difference in cDNA array hybridization, which used average signal intensity in data analysis. GDN, a CSOC-specific gene, was up-regulated in both the CSOC 826 and CSOC 817 cells used in the initial cDNA-RDA analysis. In the additional HOSE and CSOC samples, however, GDN was expressed at a variable level in both normal and tumor-derived epithelial cells.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Northern blot analysis of genes that were differentially expressed by <2.5-fold. RNA prepared from 7 HOSE and 11 CSOC cells used in cDNA-RDA and cDNA array analysis were hybridized with Doc-1 or GDN probes. Doc-1 and GDN were cloned as HOSE- and CSOC-specific genes, respectively. In cDNA array analysis, the average signal intensities of the Doc-1 were 1.6-fold greater in HOSE cells, whereas the signal for GDN was almost even in CSOC and HOSE cells. The same filter membrane was stripped and reprobed with EF-Tu to ensure integrity of RNA and to determine RNA loading differences.

 
OSF-2 Is Overexpressed in Both Ovarian Tumors and in Vitro Expanded CSOC Cells.
We next studied the expression of OSF-2 in ovarian tumor samples from which the CSOC cells used in this study were derived. Total RNA was isolated from the quick frozen tumor samples corresponding to 6 of the 12 CSOC cultures used in this study. Northern analysis revealed expression of OSF-2 in all but one tumor sample (T949; Fig. 4Citation ). The OSF-2 expression was low in the CSOC culture (C824), derived from the same tumor (see Fig. 2ACitation ). In T1040, the level of OSF-2 expression was lower than the level observed in the corresponding C871, but was easily detectable. Overall, there was a high degree of concordance in the OSF-2 expression in tumors and the corresponding CSOC cultures, indicating that the observed overexpression of OSF-2 in CSOC cultures is not a consequence of in vitro expansion of tumor-derived epithelial cells.



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. OSF-2 expression in ovarian tumors. RNA prepared from ovarian tumors was hybridized for OSF-2. The six tumors used in this analysis represent original ovarian tumors from which 6 of the 10 CSOC cultures used in cDNA array analysis were derived. Ethidium bromide staining of rRNA is provided below to control for the integrity and amount of total RNA (5 µg) loaded in each Lane.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identifying genes that are differentially expressed in ovarian tumors when compared with their normal counterpart is a challenging issue because of the scarcity of the normal ovarian epithelial cells. Ovarian surface epithelia from which ovarian cancers originate represent a minute cellular component of the ovary, compared with the more abundantly present stromal cells and germ cells. We used in vitro expanded ovarian epithelial cells derived from either normal ovaries or ovarian tumors to identify 60 genes that are either up- or down-regulated in ovarian cancer cells. In this study, only the cancer cells derived from papillary serous histology tumors, which is considered to be the most common histological type of ovarian cancer, were included to limit the complexity of gene expression analysis.

Because of the variability in signal intensities in array hybridization analysis, we focused our attention on genes displaying a >2.5 fold difference in the expression level. Whereas the reliance on cDNA array hybridization with this arbitrary cutoff may have eliminated some differentially expressed genes from our analysis, it was highly effective in identifying genes that display a consistent pattern of expression differences in a large number of CSOC samples. Among the subset of genes displaying an expression level difference of >2.5-fold there was strong qualitative correlation between cDNA array hybridization data and Northern analysis. Northern analysis confirmed KRT19, Cx43, and STC as HOSE-specific genes and OSF-2 as a CSOC-specific gene. Two genes, Doc-1 and GDN, with expression level differences of <2.5-fold in cDNA array hybridization, on the other hand, displayed only a moderate difference (e.g., GDN) or a high sample-to-sample variability (e.g., Doc-1) in Northern analyses.

The gene expression patterns seen in HOSE and CSOC cells were not consistent with those seen with TfxH cells, an immortalized HOSE cell line, or Caov-3 and Sk-OV-3, two ovarian carcinoma-derived cell lines. Because these cell lines were originally derived from normal epithelial or tumor-derived epithelial cells, similar to HOSE and CSOC cells (27) , our results illustrate the divergence of gene expression that can occur as the result of long-term in vitro manipulation of these cells. Although cell lines provide a relatively simple model to examine gene expression in ovarian cancer-derived cells, our findings emphasize that the use of HOSE and CSOC cultures represents a better model system of normal and cancerous ovarian tissues in comparative gene expression analysis.

The use of cultured ovarian epithelial cells is not without concerns. Ovarian tumors frequently are histologically inhomogeneous (2) . There are reports in the literature of loss of tumor markers associated with continuous tissue culture of some xenograft lines (28, 29, 30, 31) . Despite the primary tumors containing areas of differentiated cells, in each instance, a selection of a poorly differentiated subpopulation had occurred during the propagation of these lines. Although we have used primary cultures to avoid a selection bias inherent in any long-term cultures, we cannot formally exclude the possibility that our cultured CSOC cells represent a subpopulation of cancer cells present in the original tumor, or in vitro expansion conditions may have modified gene expression. In the case of OSF-2, there was a high degree of concordance in its expression in tumors and their corresponding CSOC cells, indicating that despite the in vitro expansion process, the expression of this particular gene is preserved in the cultured cells.

The extent of gene expression differences between HOSE and CSOC cultures is not known. Numerous genes identified in this study, including Doc-1, have previously been shown to be differentially expressed in ovarian carcinomas (4, 5, 6, 7, 8) . Comparing our data to previous studies on ovarian cancer-related genes revealed only a minor degree of overlap, indicating that the extent of gene expression differences far exceeds the number of genes identified in this or other previous studies. Genes associated with protein synthesis or mitochondrial metabolism are frequently identified in differential gene expression analysis of tumor tissues when compared with the normal tissue, and have been attributed to differences in proliferative and metabolic rates (8 , 32) . The absence of such genes in our analysis probably reflects the use of HOSE and CSOC cells, which are morphologically indistinguishable and display similar growth characteristics. This finding further emphasizes the use of HOSE cells as well-matched controls in comparative gene analysis to identify aberrant gene expression in CSOC cells.

Several of the genes identified in this study are noteworthy. OSF-2 was originally reported as a transforming growth factor ß-inducible protein secreted in the extracellular matrix of the periosteum (33) . The potential significance of OSF-2 in ovarian cancer is illustrated by the high degree of OSF-2 overexpression observed in both ovarian tumors and cultured CSOC cells. OSF-2 overexpression in CSOC cells may be a consequence of inappropriate transforming growth factor ß signaling that can be seen in some CSOC cells (19 , 34) . Although the function of OSF-2 is not known, OSF-2 or a related protein, ßig-H3, is believed to function as a matrix protein that promotes cell attachment (33 , 35) . One possibility is that OSF-2 expression may facilitate i.p. spread of cancer cells, which leads to a significant morbidity and mortality in women with ovarian cancer. STC is expressed at high levels in organs derived from the müllerian duct (36) , and, therefore, the loss of STC expression in CSOC cells may reflect cellular de-differentiation. Cx43 and Cx40, which encode gap junction proteins, were cloned as HOSE-specific genes. Decreased gap junction communication and loss of Cx43 expression have been reported in ovarian cancer (37) and may be related to the loss of epithelial cell features in cancer cells, as well as decreased cellular communication that is seen in many types of cancers.

In conclusion, the availability of primary epithelial cultures from both normal and malignant ovaries has enabled the identification of 60 differentially expressed genes, using a combination of subtractive hybridization and cDNA array expression studies. Despite the lack of observable phenotypic or growth differences between HOSE and CSOC cells, reciprocal expression of OSF-2 with STC, KRT19, and Cx43 was seen, reflecting differences in these cells at the molecular level. A large number of genes identified in this study encode transmembrane or secreted proteins (see Tables 2Citation and 3Citation ) that may be present in serum and could be used as marker for ovarian cancer. In addition, the genes identified in this study may provide clues to the cellular changes responsible for metastatic progression of ovarian cancer.


    ACKNOWLEDGMENTS
 
We thank H. Tran for technical assistance with cell cultures; Drs. A. Carlson, C. Denny, T. Lane, and J. McAdera for critical review of the manuscript; and W. Aft for assistance with preparation of the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a grant from the United States Army Medical Research and Materiel Command (DAMD17919503). Back

2 To whom requests for reprints should be addressed, at Division of Hematology-Oncology, University of California–Los Angeles School of Medicine, Factor 10-240L, 10833 Le Conte Avenue, Los Angeles, CA 90095. Back

3 The abbreviations used are: cDNA-RDA, cDNA representational differences analysis; HOSE, human ovarian surface epithelial; CSOC, Cedars-Sinai Ovarian Cancer; EF-Tu, translation elongation factor; Cx43, connexin 43; OSF-2, osteoblast-specific factor 2; KRT19, keratin 19; STC, stanniocalcin; GDN, glia-derived nexin. Back

Received 2/29/00. Accepted 9/22/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Landis S. H., Murray T., Bolden S., Wingo P. A. Cancer statistics, 1998. CA Cancer J. Clin., 48: 6-29, 1998.[Abstract]
  2. Cannistra S. A. Cancer of the ovary. N. Engl. J. Med., 329: 1550-1559, 1993.[Free Full Text]
  3. Zhang L., Zhou W., Velculescu V. E., Kern S. E., Hruban R. H., Hamilton S. R., Vogelstein B., Kinzler K. W. Gene expression profiles in normal and cancer cells. Science (Washington DC), 276: 1268-1272, 1997.[Abstract/Free Full Text]
  4. Mok S. C., Wong K. K., Chan R. K., Lau C. C., Tsao S. W., Knapp R. C., Berkowitz R. S. Molecular cloning of differentially expressed genes in human epithelial ovarian cancer. Gynecol. Oncol., 52: 247-252, 1994.[Medline]
  5. Mok S. C., Chan W. Y., Wong K. K., Cheung K. K., Lau C. C., Ng S. W., Baldini A., Colitti C. V., Rock C. O., Berkowitz R. S. DOC-2, a candidate tumor suppressor gene in human epithelial ovarian cancer. Oncogene, 16: 2381-2387, 1998.[Medline]
  6. Schummer M., Ng W. V., Bumgarner R. E., Nelson P. S., Schummer B., Bednarski D. W., Hassell L., Baldwin R. L., Karlan B. Y., Hood L. Comparative hybridization of an array of 21,500 ovarian cDNAs for the discovery of genes overexpressed in ovarian carcinomas. Gene, 238: 375-385, 1999.[Medline]
  7. Shayesteh L., Lu Y., Kuo W-L., Baldocchi R., Godfrey T., Collins C., Pinkel D., Powell B., Mills G. B., Gray J. W. PIK3CA is implicated as an oncogene in ovarian cancer. Nat. Genet., 21: 99-102, 1999.[Medline]
  8. Wang K., Gan L., Jeffery E., Gayle M., Gown A. M., Skelly M., Nelson P. S., Ng W. V., Schummer M., Hood L., Mulligan J. Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray. Gene, 229: 101-108, 1999.[Medline]
  9. Ingvarsson S. The Brca1 and Brca2 proteins and tumor pathogenesis. Anticancer Res., 19: 2853-2861, 1999.[Medline]
  10. Marks J. R., Davidoff A. M., Kerns B. J., Humphrey P. A., Pence J. C., Dodge R. K., Clarke-Pearson D. L., Iglehart J. D., Bast R. C., Jr., Berchuck A. Overexpression and mutation of p53 in epithelial ovarian cancer. Cancer Res., 51: 2979-3029, 1991.[Abstract/Free Full Text]
  11. Randall T. C., Bell K. A., Rebane B. A., Rubin S. C., Boyd J. Germline mutations of the BRCA1 and BRCA2 genes in a breast and ovarian cancer patient. Gynecol. Oncol., 70: 432-434, 1998.[Medline]
  12. Levine A. J. p53, the cellular gatekeeper for growth and division. Cell, 88: w323-w331, 1997.
  13. Scully R., Chen J., Plug A., Xiao Y., Weaver D., Feunteun J., Ashley T., Livingston D. M. Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell, 88: 265-275, 1997.[Medline]
  14. Sharan S. K., Morimatsu M., Albrecht U., Lim D. S., Regel E., Dinh C., Sands A., Eichele G., Hasty P., Bradley A. Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature (Lond.), 386: 804-810, 1997.[Medline]
  15. Zhang H., Somasundaram K., Peng Y., Tian H., Zhang H., Bi D., Weber B. L., El-Deiry W. S. BRCA1 physically associates with p53 and stimulates its transcriptional activity. Oncogene, 16: 1713-1721, 1998.[Medline]
  16. Auersperg N., Maines-Bandiera S. L., Dyck H. G., Kruk P. A. Characterization of cultured human ovarian surface epithelial cells: phenotypic plasticity and premalignant changes. Lab. Invest., 71: 510-518, 1994.[Medline]
  17. Baldwin R. L., Yamada S. D., Bristow R. E., Chen L., Karlan B. Y. Ovarian epithelial growth regulation Sharp F. Blackett T. Berek J. Bast R. eds. . Ovarian Cancer 5, : 99-107, ISPS Medica Media Oxford, England 1998.
  18. Auersperg N., Siemens C. H., Myrdal S. E. Human ovarian surface epithelium in primary cultures. In Vitro (Rockville), 20: 743-755, 1984.[Medline]
  19. Yamada S. D., Baldwin R. L., Karlan B. Y. Ovarian carcinoma cell cultures are resistant to TGF-ß1 mediated growth inhibition despite expression of functional receptors. Gynecol. Oncol., 75: 72-77, 1999.[Medline]
  20. Chang D. D., Denny C. Isolating differentially expressed genes by representational difference analysis Seibert P. D. eds. . RT-PCR Methods for Gene Cloning and Analysis, : 193-202, Eaton Publishing Natick, MA 1998.
  21. Chang D. D., Park N-H., Denny C., Nelson S., Pe M. Characterization of transformation related genes in oral cancer cell lines by parallel analysis of differentially expressed gene fragments using arrayed filters. Oncogene, 16: 1921-1930, 1998.[Medline]
  22. DeRisi J., Penland L., Brown P. O., Bittner M. L., Meltzer P. S., Ray M., Chen Y., Su Y. A., Trent J. M. Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat. Genet., 14: 457-460, 1996.[Medline]
  23. Kiechle-Schwarz M., Bauknecht T., Schmidt J., Walz L., Pfleiderer A. Recurrent cytogenetic aberrations in human ovarian carcinomas. Cancer Detect. Prev., 19: 234-243, 1995.[Medline]
  24. Thompson F. H., Emerson J., Alberts D., Liu Y., Guan X. Y., Burgess A., Fox S., Taetle R., Weinstein R., Makar R., Powell D., Trent J. Clonal chromosome abnormalities in 54 cases of ovarian carcinoma. Cancer Genet. Cytogenet., 73: 33-45, 1994.[Medline]
  25. Yang-Feng T. L., Li S., Han H., Schwartz P. E. Frequent loss of heterozygosity on chromosomes Xp and 13q in human ovarian cancer. Int. J. Cancer, 52: 575-580, 1992.[Medline]
  26. Tapper J., Sarantaus L., Vahteristo P., Nevanlinna H., Hemmer S., Seppala M., Knuutila S., Butzow R. Genetic changes in inherited and sporadic ovarian carcinomas by comparative genomic hybridization: extensive similarity except for a difference at chromosome 2q24–q32. Cancer Res., 58: 2715-2719, 1998.[Abstract/Free Full Text]
  27. Wilson A. P. Characterization of a cell line derived from the ascites of a patient with papillary serous cystadenocarcinoma of the ovary. J. Natl. Cancer Inst., 72: 513-521, 1984.
  28. Watson R. H., Neville P. J., Roy W. J., Jr., Hitchcock A., Campbell I. G. Loss of heterozygosity on chromosomes 7p, 7q, 9p and 11q is an early event in ovarian tumorigenesis. Oncogene, 17: 207-212, 1998.[Medline]
  29. Fogh J., Trempe G. Fogh J. eds. . Human Tumor Cells in Vitro, : 115-154, Plenum Press New York 1975.
  30. van Haaften-Day C., Russell P., Rugg C., Wills E. J., Tattersall M. H. Flow cytometric and morphological studies of ovarian carcinoma cell lines and xenografts. Cancer Res., 43: 3725-3731, 1983.[Abstract/Free Full Text]
  31. Ward B. G., Wallace K. Localization of the monoclonal antibody HMFG2 after intravenous and intraperitoneal injection into nude mice bearing subcutaneous and intraperitoneal human ovarian cancer xenografts. Cancer Res., 47: 4714-4718, 1987.[Abstract/Free Full Text]
  32. Velculescu V. E., Zhang L., Vogelstein B., Kinzler K. W. Serial analysis of gene expression. Science (Washington DC), 270: 484-487, 1995.[Abstract/Free Full Text]
  33. Horuchi K., Amizuka N., Takeshita S., Takamatsu H., Katsuura M., Ozawa H., Toyama Y., Bonewald L. F., Kudo A. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and peridontal ligament and increased expression by transforming growth factor ß. J. Bone Miner. Res., 14: 1239-1249, 1999.[Medline]
  34. Godwin A. K., Testa J. R., Hamilton T. C. The biology of ovarian cancer development. Cancer (Phila.), 71: 530-536, 1993.[Medline]
  35. RDG-CAP (ßig-h3) enhances the spreading of chondrocytes and fibroblasts via integrin {alpha}1ß1. Biochim. Biophys. Acta, 1451: 196–205, 1999.
  36. Olsen H. S., Cepeda M. A., Zhang Q. Q., Rosen C. A., Vozzolo B. L. Human stanniocalcin: a possible hormonal regulator of mineral metabolism. Proc. Natl. Acad. Sci. USA, 93: 1792-1796, 1996.[Abstract/Free Full Text]
  37. Hanna E. A., Umhauer S., Roshong S. L., Piechocki M. P., Fernstrom M. J., Fanning J. D., Ruch R. J. Gap junctional intercellular communication and connexin 43 expression in human ovarian surface epithelial cells and ovarian carcinomas in vivo and in vitro. Carcinogenesis (Lond.), 20: 1369-1373, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
B. Quaresima, F. Romeo, M. C. Faniello, M. Di Sanzo, C.-G. Liu, A. Lavecchia, C. Taccioli, E. Gaudio, F. Baudi, F. Trapasso, et al.
BRCA1 5083del19 Mutant Allele Selectively Up-Regulates Periostin Expression In vitro and In vivo
Clin. Cancer Res., November 1, 2008; 14(21): 6797 - 6803.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
A. B. Tchagang, A. H. Tewfik, M. S. DeRycke, K. M. Skubitz, and A. P.N. Skubitz
Early detection of ovarian cancer using group biomarkers
Mol. Cancer Ther., January 1, 2008; 7(1): 27 - 37.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
V. Castronovo, D. Waltregny, P. Kischel, C. Roesli, G. Elia, J.-N. Rybak, and D. Neri
A Chemical Proteomics Approach for the Identification of Accessible Antigens Expressed in Human Kidney Cancer
Mol. Cell. Proteomics, November 1, 2006; 5(11): 2083 - 2091.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Y. Yeung, K. P. Lai, H. Y. Chan, N. K. Mak, G. F. Wagner, and C. K. C. Wong
Hypoxia-Inducible Factor-1-Mediated Activation of Stanniocalcin-1 in Human Cancer Cells
Endocrinology, November 1, 2005; 146(11): 4951 - 4960.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
P. Qiu, Z. J. Wang, and K. J. R. Liu
Ensemble dependence model for classification and prediction of cancer and normal gene expression data
Bioinformatics, July 15, 2005; 21(14): 3114 - 3121.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. D. Santin, S. Cane, S. Bellone, M. Palmieri, E. R. Siegel, M. Thomas, J. J. Roman, A. Burnett, M. J. Cannon, and S. Pecorelli
Treatment of Chemotherapy-Resistant Human Ovarian Cancer Xenografts in C.B-17/SCID Mice by Intraperitoneal Administration of Clostridium perfringens Enterotoxin
Cancer Res., May 15, 2005; 65(10): 4334 - 4342.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Hibbs, K. M. Skubitz, S. E. Pambuccian, R. C. Casey, K. M. Burleson, T. R. Oegema Jr, J. J. Thiele, S. M. Grindle, R. L. Bliss, and A. P.N. Skubitz
Differential Gene Expression in Ovarian Carcinoma: Identification of Potential Biomarkers
Am. J. Pathol., August 1, 2004; 165(2): 397 - 414.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. A. Heinzelmann-Schwarz, M. Gardiner-Garden, S. M. Henshall, J. Scurry, R. A. Scolyer, M. J. Davies, M. Heinzelmann, L. H. Kalish, A. Bali, J. G. Kench, et al.
Overexpression of the Cell Adhesion Molecules DDR1, Claudin 3, and Ep-CAM in Metaplastic Ovarian Epithelium and Ovarian Cancer
Clin. Cancer Res., July 1, 2004; 10(13): 4427 - 4436.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Shao, S. Bao, X. Bai, C. Blanchette, R. M. Anderson, T. Dang, M. L. Gishizky, J. R. Marks, and X.-F. Wang
Acquired Expression of Periostin by Human Breast Cancers Promotes Tumor Angiogenesis through Up-Regulation of Vascular Endothelial Growth Factor Receptor 2 Expression
Mol. Cell. Biol., May 1, 2004; 24(9): 3992 - 4003.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Matei, D. D. Chang, and M.-H. Jeng
Imatinib Mesylate (Gleevec) Inhibits Ovarian Cancer Cell Growth through a Mechanism Dependent on Platelet-Derived Growth Factor Receptor {alpha} and Akt Inactivation
Clin. Cancer Res., January 15, 2004; 10(2): 681 - 690.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. A. Stronach, G. C. Sellar, C. Blenkiron, G. J. Rabiasz, K. J. Taylor, E. P. Miller, C. E. Massie, A. Al-Nafussi, J. F. Smyth, D. J. Porteous, et al.
Identification of Clinically Relevant Genes on Chromosome 11 in a Functional Model of Ovarian Cancer Tumor Suppression
Cancer Res., December 15, 2003; 63(24): 8648 - 8655.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. K. Zorn, A. A. Jazaeri, C. S. Awtrey, G. J. Gardner, S. C. Mok, J. Boyd, and M. J. Birrer
Choice of Normal Ovarian Control Influences Determination of Differentially Expressed Genes in Ovarian Cancer Expression Profiling Studies
Clin. Cancer Res., October 15, 2003; 9(13): 4811 - 4818.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Hellstrom, J. Raycraft, M. Hayden-Ledbetter, J. A. Ledbetter, M. Schummer, M. McIntosh, C. Drescher, N. Urban, and K. E. Hellstrom
The HE4 (WFDC2) Protein Is a Biomarker for Ovarian Carcinoma
Cancer Res., July 1, 2003; 63(13): 3695 - 3700.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. B. A. Rangel, R. Agarwal, T. D'Souza, E. S. Pizer, P. L. Alo, W. D. Lancaster, L. Gregoire, D. R. Schwartz, K. R. Cho, and P. J. Morin
Tight Junction Proteins Claudin-3 and Claudin-4 Are Frequently Overexpressed in Ovarian Cancer but Not in Ovarian Cystadenomas
Clin. Cancer Res., July 1, 2003; 9(7): 2567 - 2575.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. L. Dennis, J. K. Vass, E. C. Wit, W. N. Keith, and K. A. Oien
Identification from Public Data of Molecular Markers of Adenocarcinoma Characteristic of the Site of Origin
Cancer Res., November 1, 2002; 62(21): 5999 - 6005.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Gillan, D. Matei, D. A. Fishman, C. S. Gerbin, B. Y. Karlan, and D. D. Chang
Periostin Secreted by Epithelial Ovarian Carcinoma Is a Ligand for {alpha}V{beta}3 and {alpha}V{beta}5 Integrins and Promotes Cell Motility
Cancer Res., September 15, 2002; 62(18): 5358 - 5364.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
P. F. Macgregor and J. A. Squire
Application of Microarrays to the Analysis of Gene Expression in Cancer
Clin. Chem., August 1, 2002; 48(8): 1170 - 1177.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. L. Welcsh, M. K. Lee, R. M. Gonzalez-Hernandez, D. J. Black, M. Mahadevappa, E. M. Swisher, J. A. Warrington, and M.-C. King
BRCA1 transcriptionally regulates genes involved in breast tumorigenesis
PNAS, May 28, 2002; 99(11): 7560 - 7565.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
G. B. Mills, R. C. Bast Jr., and S. Srivastava
Future for Ovarian Cancer Screening: Novel Markers From Emerging Technologies of Transcriptional Profiling and Proteomics
J Natl Cancer Inst, October 3, 2001; 93(19): 1437 - 1439.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. Zhang, P. M. Laborde, K. R. Coombes, D. A. Berry, and S. R. Hamilton
Cancer Genomics: Promises and Complexities
Clin. Cancer Res., August 1, 2001; 7(8): 2159 - 2167.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ismail, R. S.
Right arrow Articles by Chang, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ismail, R. S.
Right arrow Articles by Chang, D. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online