Cancer Research Annual Meeting 2010 EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Satterwhite, D. J.
Right arrow Articles by Neufeld, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Satterwhite, D. J.
Right arrow Articles by Neufeld, K. L.
[Cancer Research 60, 6989-6994, December 15, 2000]
© 2000 American Association for Cancer Research

Experimental Therapeutics

Inhibition of Topoisomerase II{alpha} Expression by Transforming Growth Factor-ß1 Is Abrogated by the Papillomavirus E7 Protein1

Daniel J. Satterwhite2, Raymond L. White, Nori Matsunami and Kristi L. Neufeld

Departments of Pediatrics [D. J. S.] and Oncological Sciences [R. L. W., N. M., K. L. N.], University of Utah School of Medicine, Salt Lake City, Utah 84132


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transforming growth factor-ß (TGF-ß) protects normal cells from etoposide-induced cell death, yet the mechanism has remained speculative. Studies have shown that etoposide modifies the activity of the topoisomerase II{alpha} (topo II{alpha}) enzyme, thereby causing DNA damage and inducing cell death. Expression of topo II{alpha} is necessary for etoposide-induced cell death, and peak expression of topo II{alpha} normally occurs during the G2 phase of the cell cycle. We predicted that by arresting growth in the G1 phase, TGF-ß1 would prevent the induction of topo II{alpha} expression that normally occurs subsequent to the G1-S transition, thereby protecting cells from etoposide-induced cell death. Accordingly, we hypothesized that the inhibition of topo II{alpha} expression by TGF-ß1 would be dependent on the ability of TGF-ß1 to arrest cell cycle progression in G1. Using mink lung epithelial cells (Mv1Lu), we found that TGF-ß1 decreases topo II{alpha} mRNA expression, and the decrease occurs as cells begin to accumulate in the G1 phase of the cell cycle. Topo II{alpha} protein expression decreases subsequent to the fall in mRNA expression. In contrast, topo II{alpha} expression is not affected by TGF-ß1 in cells that fail to undergo G1 arrest because of inactivation of the retinoblastoma tumor suppressor protein (pRb) by the papillomavirus type 16 E7 protein. Our studies suggest that inhibition of topo II{alpha} by TGF-ß1 is the principal mechanism that protects mink lung epithelial cells (Mv1Lu) from etoposide-induced toxicity. Furthermore, the inhibition of topo II{alpha} protein expression by TGF-ß1 is dependent on pRb-mediated cell cycle arrest, suggesting that TGF-ß1 will not reduce the sensitivity of pRb-deficient cancers to etoposide.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Topo II{alpha}3 belongs to a family of enzymes that affect conformational changes in DNA during the cell cycle (1 , 2) . Peak topo II{alpha} expression and activity coincide during the G2 phase of the cell cycle, thus topo II{alpha} protein expression is thought to be a sensitive and specific marker for cell proliferation (3, 4, 5, 6, 7) . Cancer cells often have elevated topo II{alpha} expression, and drugs that target topo II{alpha} are used widely for cancer treatment. One such drug, etoposide, stabilizes the "cleavable complex" form of topo II{alpha}, which results in the production of unrepaired double-strand DNA breaks (8, 9, 10) . This DNA damage initiates programmed cell death (apoptosis). Etoposide preferentially targets rapidly proliferating cells that have high topo II{alpha} expression. Thus, bone marrow suppression and gastrointestinal toxicity are dose-limiting side effects of etoposide therapy.

TGF-ß1 family members have emerged as promising candidates in pharmacological strategies aimed at minimizing the cytotoxic effects of chemotherapy on normal tissues. For example, TGF-ß1 protects normal cells from etoposide-induced cell death (11) , yet the mechanism has remained speculative. TGF-ß1 reversibly arrests cell cycle progression in the G1 phase of the cell cycle (12, 13, 14) , and the ability to induce G1 arrest is thought to be necessary for the chemoprotective effects of TGF-ß1 (11) . TGF-ß1-induced G1 arrest is associated with the inhibition of expression of B-myb and c-myb (15, 16, 17) , transcription factors required by cells to exit G1 and begin DNA synthesis (18 , 19) . Recently it was shown that the myb transcription factors are responsible for the cell cycle-specific induction of topo II{alpha} mRNA in the S phase (20) , although diverse mechanisms may contribute to the regulation of topo II{alpha} expression (6 , 21) .

The Mv1Lu cell line is nontransformed and sensitive to TGF-ß1-induced growth arrest, thereby serving as a useful model system for the study of topo II{alpha} gene expression in a setting of nontumorigenic epithelial cell proliferation. On the basis of a putative pathway in Mv1Lu cells that includes B-myb as a key mediator, we predicted that TGF-ß1 would inhibit topo II{alpha} expression. Furthermore, we predicted that the inhibition of topo II{alpha} would be dependent on the ability of TGF-ß1 to induce a G1 cell cycle arrest. Because the presence of topo II{alpha} is required for the cytotoxic effect of etoposide, the inhibition of topo II{alpha} expression by TGF-ß1 would account for the ability of TGF-ß1 to protect cells from etoposide-induced cytotoxicity.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture.
Mv1Lu cells (ATCC CCL-64) were grown in a humidified incubator in 5% CO2 at 37°C. The growth medium consisted of DMEM (Life Technologies, Inc.) and 5% dialyzed fetal bovine serum (Life Technologies, Inc.).

Porcine TGF-ß1 (R&D Systems) was added to a final concentration of 10 ng/ml at the times indicated.

Cell cycle distribution was determined using a standard protocol for FACS analysis after treatment with BrdUrd for 30 min (22) .

Creation of the Mv1Lu-LXSN and Mv1Lu-LXSN-E7 Cell Lines.
LXSN and LXSN-16E7 retroviruses were a gift from Dr. D. A. Galloway at the Fred Hutchinson Cancer Research Center (23) . Mv1Lu cells were incubated in viral supernatant plus 4 µg/ml polybrene (Sigma Chemical Co.) for 24 h. Cells were then cultured in virus-free medium for 2 days and then selected in growth medium containing 400 µg/ml of G418 (Life Technologies, Inc.). Pooled populations of infected cells were generated from samples infected at 20–50% efficiency based on the percentage of cells surviving selection with G418. The concentration of G418 was reduced to 200 µg/ml once 100% of the uninfected control cells had died.

RNA Isolation and Northern Analysis.
Cells were harvested at the times indicated in each figure and polyadenylated RNA was isolated using a standard protocol (Fig. 1Citation ; Ref. 24 ). Whole cell lysates were pooled from two to three flasks for each time point for polyadenylated RNA isolation. RNA was resolved by electrophoresis on an agarose gel and transferred to Hybond membrane. Complete transfer was confirmed by ethidium bromide staining.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. TGF-ß1 inhibits topo II{alpha} mRNA and protein expression in Mv1Lu cells. A, + indicates TGF-ß1 added to asynchronous, rapidly proliferating cells at 0 h. RNA was isolated for Northern blot analysis, and protein was isolated for Western blot analysis from samples harvested simultaneously at the times indicated. Cyclophilin expression was used to control for loading differences for analysis of mRNA expression. Levels of topo II{alpha} protein were determined in 70-µg samples of whole cell lysate by immunoblot analysis. Cell cycle distribution of TGF-ß1-treated and -untreated samples was determined at the times indicated by FACS analysis, demonstrating that TGF-ß1 induces G1 arrest. B, topo II{alpha} expression versus time (h) after addition of TGF-ß1. Percent of Control, expression in TGF-ß1-treated sample/expression in corresponding untreated sample. , topo II{alpha} mRNA signal intensity from Fig. 1Citation A normalized to cyclophilin. ----, topo II{alpha} protein signal intensity from Fig. 1Citation A. Results shown from this single experiment are representative of multiple assays.

 
[32P]dATP and dCTP (Dupont/NEN) -labeled probes were made using a random primer DNA labeling kit (Boehringer Mannheim). Hybridizations were performed at 42°C using 1 x 106 cpm/ml labeled DNA in hybridization buffer containing 50% formamide. Images and quantification of signal intensity were obtained using a phosphorimager (Molecular Dynamics).

The following cDNA templates were used for random primed labeling: (a) the 0.7-kb BamHI/PstI fragment from plasmid SP65 1B15, containing the rat cyclophilin cDNA (25) ; (b) a 0.9-kb fragment of the mink PAI-1 cDNA generated using oligo d(T)40-primed mink cDNA (Superscript II; Life Technologies, Inc.) as a template for PCR (Taq polymerase; Roche Diagnostics, Inc.) using the forward primer ctggttctgcccaagttctc and the reverse primer cagggaacatgacaagcaaa and then nested PCR using the forward primer tcatggacagaccctttcctc and reverse primer caagcacacaaggacaagga; (c) the 1.8-kb EcoRI fragment from pc15 htopoII{alpha} containing the human topo II{alpha} cDNA (26) ; and (d) the 2.8 kb BamHI fragment from SP12 htopoIIß containing the human topo IIß cDNA (27) . The topoisomerase probes did not show any cross hybridization. Using the probe for topo II{alpha}, we detected an {approx}6.5-kb band similar to the 6.2-kb mRNA reported for human topo II{alpha} (26) . The topo II{alpha} band was distinct from the band detected using the probe for topo IIß (not shown). The identity of the PAI-1 fragment was confirmed by sequencing.

Western Analysis and Immunostaining.
Western analysis and immunostaining were performed using standard, published protocols (28) . Using a topo II{alpha}-specific antibody (Calbiochem Ab-1), we detected a Mr 170,000 doublet corresponding to the expected size of human topo II{alpha} (27 , 29) .

Immunostaining of Suspended Cells for Simultaneous Measurement of Protein Expression and Cell Cycle Phase.
Immunostaining of suspended cells for the simultaneous measurement of protein expression and cell cycle phase was performed using a standard immunostaining protocol adapted for cells in suspension. Topo II{alpha} was labeled with FITC as follows. Cells were trypsinized to a single-cell suspension, then pelleted and resuspended in calcium and magnesium-free PBS. The sample size was adjusted to give 2 x 106 cells. Each sample was rinsed in PBS and pelleted. The pellet of cells was resuspended in fixative (2% paraformaldehyde, 0.1% Triton X-100, in PBS) for 15 min on ice. Cells were then pelleted and rinsed twice with cold PBS. The pellet was then resuspended in 1 ml of cold PBS, and 2 ml of cold ethanol were added dropwise while vortexing. The cells were pelleted and resuspended in permeabilization buffer {0.2% Triton X-100 in Tris-buffered saline [10 mM Tris (pH 7.5), 100 mM NaCl, 5 mM KCl} for 5 min at room temperature. Cells were pelleted and resuspended in antibody buffer (0.1% Triton X-100, 1% BSA, 3% normal goat serum, in TBS) for 10 min. At this point each sample was split into two aliquots, one to be incubated with the topo II{alpha}-specific antibody (Calbiochem Ab-1) at a 1:200 dilution and one aliquot to be incubated with an equal concentration of the nonspecific isotype control antibody (Sigma M-5284 mouse IgG1{kappa}). The cells were resuspended and incubated for 30 min with their respective primary antibody in 500 µl of antibody buffer. The cells were pelleted and rinsed in TBS twice for 5 min at room temperature. Each sample was then incubated for 20 min in 500 µl of antibody buffer containing a 1:200 dilution of the secondary antibody [goat antimouse IgG1-FITC (Southern Biotechnology Associates)]. The cells were pelleted and rinsed in TBS twice for 5 min at room temperature.

To determine DNA content, the cells were then pelleted and stained with PI using a standard protocol.4

Green fluorescence (FITC) and red fluorescence (PI) were determined simultaneously in each cell (n = 20,000–50,000 cells/sample) using standard FACS analysis. Multicell aggregates were excluded from subsequent analysis. Average green fluorescence/cell was ascertained in each of the three cell cycle fractions distinguished by PI staining. Fraction 1 contained cells with a G1 DNA content; fraction 2 contained mainly cells with an S DNA content; and fraction 3 contained cells with a G2-M DNA content. The respective values for nonspecific green fluorescence ascertained using the nonspecific isotype control antibody were subtracted from the total green fluorescence ascertained using the topo II{alpha}-specific antibody for each fraction to obtain the value for topo II{alpha} expression in each cell cycle fraction (Fig. 3)Citation .



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Quantitative immunostaining reveals the degree of topo II{alpha} inhibition by TGF-ß1 as a function of cell cycle position. A, topo II{alpha} protein expression versus cell cycle position. Topo II{alpha} protein expression and cell cycle position were determined simultaneously in each cell by quantitative FACS analysis of control and TGF-ß1-treated samples. Topo II{alpha}-specific signal intensity was calculated for each cell cycle fraction and represented graphically as the percentage of control (the topo II{alpha}-specific signal intensity found in the G1 untreated sample; mean ± SD; n = 5 independent experiments; *, P <= 0.05). Mean topo II{alpha} protein expression was significantly lower in the G1 and G2-M fractions after TGF-ß1 treatment. B, change in topo II{alpha} expression versus cell cycle position. The percentage of change in topo II{alpha} expression in response to TGF-ß1 was calculated for each experiment as a function of cell cycle position (mean ± SD; n = 5 independent experiments; *, P <= 0.05). TGF-ß1 treatment resulted in a significant decrease in topo II{alpha} protein expression in the G1 [32.7 ± 26.9% (SD), P = 0.05] and G2-M cycle [68.0 ± 14.2% (SD), P < 0.001] phases of the cell.

 

   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
To determine the effect of TGF-ß1-induced growth arrest on topo II{alpha} expression, we compared topo II{alpha} expression in control (untreated) and TGF-ß1-treated Mv1Lu cells. Samples of cells were harvested simultaneously to determine topo II{alpha} mRNA expression, topo II{alpha} protein expression, and cell cycle distribution at the times indicated after TGF-ß1 treatment (Fig. 1A)Citation . We consistently observed a marked drop in topo II{alpha} mRNA expression between 8 and 12 h after TGF-ß1 treatment (Fig. 1, A and B)Citation . Comparison of mRNA expression with the cell cycle analysis revealed that most of the cells in S + G2-M at 8 h after TGF-ß1 treatment had completed mitosis and arrested in G1 by 12 h (Fig. 1A)Citation . Thus, mRNA expression decreases subsequent to the onset of G1 arrest, which is consistent with our prediction that the inhibition of topo II{alpha} is dependent on the ability of TGF-ß1 to arrest growth in the G1 phase.

Topo II{alpha} protein expression consistently decreased beginning 2–3 h after the decrease in mRNA expression, suggesting that the inhibition of mRNA expression mediates the inhibition of protein expression (Fig. 1B)Citation . Comparison with the cell cycle distribution indicated that the inhibition of topo II{alpha} protein expression did not occur until after most of the cells had completed S and G2-M and accumulated in G1. Between 12 and 24 h after TGF-ß1 treatment, the cell cycle distribution of the TGF-ß1-treated cells showed minimal change, yet most of the inhibition in topo II{alpha} protein expression occurred during this 12–24-h interval. Therefore, in Mv1Lu cells, the TGF-ß1-induced G1 arrest occurred before any appreciable decrease in topo II{alpha} protein expression, indicating that most of the decrease occurred while the majority of the cells were in the G1 phase of the cell cycle. This is consistent with the observation that TGF-ß1 treatment in S or G2-M does not affect cell cycle progression until cells reenter the G1 phase (12, 13, 14) . On the basis of reports that there is minimal synthesis of topo II{alpha} protein during G1 (3, 4, 5, 6, 7) , it appears that much of the topo II{alpha} protein present during G1 in rapidly proliferating Mv1Lu cells is residual protein which was synthesized during the previous cell cycle.

To corroborate the observations made by Western analysis, we performed immunostaining of control and TGF-ß1-treated Mv1Lu cells (Fig. 2)Citation . In untreated, rapidly proliferating cells we found that the topo II{alpha} signal varied in intensity from cell to cell and was restricted to the nucleus, as reported previously (7) . In cells treated with TGF-ß1 for 24 h, we found a marked inhibition in topo II{alpha}-specific nuclear staining. Indeed, the cells treated with TGF-ß1 for 24 h ({approx}95% in G1) appeared to have much less topo II{alpha} protein than the control cells ({approx}65% in G1; see comparison of cell cycle distribution at 24 h in Fig. 1Citation ). This suggested that the average topo II{alpha} protein level during G1 in TGF-ß1-treated cells was less than the average level during G1 in control cells. This observation is consistent with data in Fig. 1Citation , which suggested that much of the topo II{alpha} protein present during G1 is residual protein that was synthesized during the previous cell cycle. Therefore, a prolongation of the G1 interval by TGF-ß1-induced arrest would be expected to eventually result in the elimination of topo II{alpha} protein, just as we found in Fig. 1Citation . By extending the interval from the point at which the cells last produced topo II{alpha} protein, TGF-ß1 seems to allow sufficient time to achieve nearly complete degradation of topo II{alpha} protein.



View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. TGF-ß1 inhibits topo II{alpha} immunostaining in Mv1Lu cells. TGF-ß1 was added to asynchronous, rapidly proliferating cells at 0 h, and cells were fixed at 24 h. Comparison of the topo II{alpha} immunostaining pattern with the 4',6-diamidino-2-phenylindole counterstain indicated that the topo II{alpha} immunostaining was restricted to the nucleus (Bar = 25 µ).

 
A second feature of the immunostaining was surprising. In the TGF-ß1-treated samples we did not see any cells with high topo II{alpha} expression despite the fact that about 5% of the cells continued to progress through the S and G2-M phases of the cell cycle. This qualitative observation suggested that the subpopulation of cells that continued to cycle in the presence of TGF-ß1 had significantly lower topo II{alpha} expression during the later stages of the cell cycle.

To verify these observations, we developed a novel method for quantitative analysis of protein expression as a function of cell cycle position using immunostaining and FACS analysis. We simultaneously determined topo II{alpha} protein expression and cell cycle position for each cell in samples of 2–5 x 105 cells. As with standard immunostaining, we compared topo II{alpha} expression in untreated (control) cells with that in cells treated with TGF-ß1 for 24 h (Fig. 3)Citation . In untreated, rapidly proliferating Mv1Lu cells, topo II{alpha} expression increased as cells progressed through the cell cycle. Compared with the level of topo II{alpha} expression during G1, expression increased 3-fold in the S-phase fraction, and 7-fold in the G2-M-phase fraction (Fig. 3A)Citation consistent with previous reports regarding the cell cycle-specific expression of topo II{alpha} (3, 4, 5, 6) . TGF-ß1 significantly inhibited topo II{alpha} expression in the G1 and G2-M fractions (Fig. 3, A and B)Citation .

Thus, the quantitative immunostaining confirmed our unexpected observation that the subpopulation of cells that continued to progress through the G2-M phases of the cell cycle despite the presence of TGF-ß1 had markedly decreased topo II{alpha} expression. Close examination of the FACS data suggested two possibilities. The first is that this subpopulation of Mv1Lu cells is unable to respond to TGF-ß1-induced G1 arrest, and inexplicably always has lower-than-normal topo II{alpha} expression during G2-M, regardless of exposure to TGF-ß1. If this were the case, TGF-ß1 treatment would simply unmask the presence of this subpopulation by eliminating the TGF-ß1-responsive cells through G1 arrest. The second possibility is that this subpopulation fails to respond to TGF-ß1-induced G1 growth arrest, yet retains the ability to respond to TGF-ß1 by decreasing topo II{alpha} expression. In other words, the data suggest that in some Mv1Lu cells, the inhibition of topo II{alpha} expression by TGF-ß1 might occur independent of cell cycle arrest.

To pursue whether TGF-ß1 might inhibit topo II{alpha} expression independent of cell cycle arrest, we determined the effect of TGF-ß1 on topo II{alpha} expression in Mv1Lu cells that fail to undergo G1 arrest (Fig. 4A)Citation . It has been shown that inactivation of pRb by viral oncoproteins results in cells that are unable to undergo growth arrest in response to TGF-ß1, yet in such cells the effects of TGF-ß1 on gene expression that do not require pRb are preserved (30) . We established a pooled population of Mv1Lu cells that express the papillomavirus type 16 E7 oncoprotein from a retrovirus-introduced transgene (Mv1Lu-LXSN-E7). We found that Mv1Lu-LXSN-E7 cells did not undergo G1 arrest in response to TGF-ß1, whereas control cells (Mv1Lu-LXSN) responded normally (Fig. 4A)Citation . We have found that TGF-ß1-treatment continues to alter the expression of a number of TGF-ß1-responsive genes in Mv1Lu-LXSN-E7 cells, including PAI-1 (Fig. 4)Citation , topo IIß (see below), and others (data not shown), indicating that many TGF-ß1-mediated effects on gene expression are retained in Mv1Lu-LXSN-E7 cells.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. Topo II{alpha} expression in Mv1Lu cells is affected by inactivation of pRb by the papillomavirus type 16 E7 oncoprotein. A, Mv1Lu cells infected with empty vector (Mv1Lu-LXSN) respond normally to TGF-ß1-induced G1 arrest, however Mv1Lu cells in which pRb has been inactivated by E7 expression (Mv1Lu-LXSN-E7) show no change in cell cycle distribution in response to TGF-ß1 (mean ± SD; n = 3 independent experiments; *, P <= 0.05). B, + indicates TGF-ß1 added to asynchronous, rapidly proliferating cells at 0 h. RNA was isolated for Northern blot analysis, and protein was isolated for Western blot analysis from samples harvested 24 h after TGF-ß1-treatment. mRNA signal intensity was normalized to cyclophilin expression, and protein expression was normalized by loading an equal amount of total protein in each lane (70 µg). A single representative experiment is shown; however, three independent assays were used for statistical analyses. C, TGF-ß1 inhibited topo II{alpha} mRNA expression 95.5 ± 3.0% (SD; P < 0.001) in LXSN control cells, but did not significantly affect topo II{alpha} mRNA expression in LXSN-E7 cells. Thus, the ability of TGF-ß1 to inhibit topo II{alpha} mRNA expression is blocked by inactivation of pRb by E7. D, TGF-ß1 did not significantly affect topo II{alpha} protein expression in Mv1Lu-LXSN-E7 cells. Thus, the ability of TGF-ß1 to inhibit topo II{alpha} protein expression is also blocked by the inactivation of pRb by E7. E, although basal expression of PAI-1 mRNA was {approx}3-fold higher in Mv1Lu-LXSN-E7 cells, PAI-1 mRNA expression was induced to a similar degree by TGF-ß1 in both Mv1Lu-LXSN and Mv1Lu-LXSN-E7 cells, indicating that the TGF-ß1 signaling pathway remains partially intact in the E7-expressing cells.

 
Interestingly, Mv1Lu-LXSN-E7 cells had significantly higher topo II{alpha} mRNA levels than Mv1Lu-LXSN [120.2 ± 16.5% (SD) of control (Mv1Lu-LXSN), P = 0.05]. Thus, inactivation of pRb resulted in an increase in topo II{alpha} mRNA expression. The increase in topo II{alpha} mRNA expression in Mv1Lu-LXSN-E7 cells was not attributable to a greater fraction of cells in the S and G2-M phases of the cell cycle because the cell cycle distribution was the same for Mv1Lu-LXSN and Mv1Lu-LXSN-E7 cells (data not shown). Rather, this result is consistent with the idea that pRb normally functions in a pathway to inhibit topo II{alpha} synthesis primarily during the G1 phase of the cell cycle. Thus, inactivation of pRb by E7 would increase topo II{alpha} synthesis primarily during G1, accounting for the relatively modest increase. In contrast to topo II{alpha}, topo IIß mRNA expression was not significantly affected by E7 (data not shown).

To determine whether the inhibition of topo II{alpha} expression by TGF-ß1 is dependent on pRb-mediated cell cycle arrest, we determined the response of topo II{alpha} to TGF-ß1 in Mv1Lu-LXSN and Mv1Lu-LXSN-E7 cells. TGF-ß1 treatment inhibited topo II{alpha} mRNA expression by 95% in Mv1Lu-LXSN cells, but TGF-ß1 did not significantly affect topo II{alpha} mRNA expression in Mv1Lu-LXSN-E7 cells (Fig. 4, B and C)Citation . Similarly, topo II{alpha} protein expression was virtually eliminated after TGF-ß1 treatment of Mv1Lu-LXSN cells, but TGF-ß1 did not significantly affect topo II{alpha} protein expression in Mv1Lu-LXSN-E7 cells (Fig. 4, B and D)Citation . These results indicated that pRb is required for the inhibition of topo II{alpha} expression by TGF-ß1, and the inhibition is associated with pRb-mediated cell cycle arrest.

Of interest, the response of topo IIß again differed from that of topo II{alpha}. We found that TGF-ß1 treatment significantly increased topo IIß mRNA expression in both Mv1Lu-LXSN and Mv1Lu-LXSN-E7 cells, indicating that the induction of topo IIß mRNA expression by TGF-ß1 does not depend on pRb status [139.6 ± 12.5% (SD) of control (P < 0.01) versus 134.9 ± 19.8% (SD) of control (P < 0.05)].


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The TGF-ß family members have emerged as promising candidates in pharmacological strategies aimed at minimizing the cytotoxic effects of chemotherapy on normal tissues while leaving cancer cells unaffected. The rational for the experimental use of TGF-ß1 has been the observation that normal cells are responsive to the growth inhibitory effects of TGF-ß1, whereas cancer cells typically have lost the ability to respond to the TGF-ß1 growth inhibitory signal. A great deal of optimism has been generated for the clinical feasibility of this approach on the basis of cell culture and animal studies showing that TGF-ß1 protects rapidly dividing stem cell pools in the bone marrow and gastrointestinal tract from cell cycle-acting chemotherapy in vitro and in vivo (11 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40) . If this experimental approach can be successfully translated to bedside practice, TGF-ß1 treatment would transiently arrest normal cells in G1, but the TGF-ß1-resistant tumor cells would continue to progress through the cell cycle, and therefore would remain susceptible to cell cycle-acting chemotherapy. Thus, pretreatment of the cancer patient with TGF-ß1 might allow the use of higher (more tumoricidal) doses of chemotherapy, because the side effects caused by chemotherapy-induced damage to normal tissues would be reduced or prevented.

Our results support the idea that, in the proper setting, TGF-ß1 might be a useful adjuvant to protect normal cells from cancer chemotherapy. Our report focuses on the regulation of expression of topo II{alpha}, the target of the chemotherapeutic agent etoposide. Etoposide preferentially kills rapidly proliferating cells that have high topo II{alpha} expression. Thus, bone marrow suppression and gastrointestinal toxicity are dose-limiting side effects of etoposide therapy. In addition, secondary leukemias with translocations between chromosomes 11 and 9 appear to occur as a result of treatment with etoposide-like drugs (8 , 41 , 42) . TGF-ß treatment protects Mv1Lu cells from cell death induced by treatment with drugs that target topo II{alpha}, including etoposide (11 , 37) . Our preliminary data indicate that as much as a 10-fold-higher dose of etoposide is needed to kill 90% of Mv1Lu cells if they have been pretreated for 24 h with physiological doses of TGF-ß1 (1 ng/ml; data not shown). Because topo II{alpha} expression is required for etoposide-induced cell death, and peak expression of topo II{alpha} normally occurs during the G2 phase of the cell cycle, we predicted that TGF-ß1 would inhibit topo II{alpha} enzyme expression, thereby protecting cells from etoposide.

We found that TGF-ß1 inhibits topo II{alpha} protein expression by a mechanism involving inhibition of topo II{alpha} mRNA expression. Previous work suggests that topo II{alpha} mRNA synthesis is inhibited by TGF-ß1 through a pathway mediated by the inhibition of B-myb expression in Mv1Lu cells (15 , 20) . In addition, the possibility that TGF-ß1-induced G1 arrest might indirectly affect mRNA stability is suggested by the report that in HeLa cells the half-life of the topo II{alpha} mRNA is shortest during G1 (6) .

In general, reports indicate that there is a tight correlation between the level of topo II{alpha} mRNA expression and protein expression; however topo II{alpha} protein stability has been found to vary during the cell cycle as well. The half-life of topo II{alpha} protein in normal chicken embryo fibroblasts was shortest (1.3 h) during early G1 (21) . Our observations regarding the drop in topo II{alpha} protein expression as Mv1Lu cells arrest in G1 suggest that the half-life is similarly short in Mv1Lu cells.

Because TGF-ß1 did not decrease expression of the topo IIß isoform, our finding that TGF-ß1 decreases expression of topo II{alpha} and decreases etoposide-induced cytotoxicity suggests that topo II{alpha} is the primary target of etoposide in proliferating Mv1Lu cells. It has been demonstrated that decreased topo II{alpha} expression commonly allows cells to escape death caused by etoposide (10 , 43) , and the degree of inhibition seen in Mv1Lu cells after TGF-ß1 would seem to fully account for the ability of TGF-ß1 to protect Mv1Lu cells from etoposide. However, our results do not exclude the possibility that TGF-ß1 might also inhibit cellular uptake of etoposide, or induce a posttranslational modification in topo II{alpha} that alters the ability of etoposide to cause DNA damage.

By determining the level of topo II{alpha} protein expression and cell cycle position simultaneously, we were able to gain a novel perspective of the heterogeneity in response of individual cells to TGF-ß1. Specifically, in a population of Mv1Lu cells, there is always a small fraction that fail to undergo G1 arrest, yet features that might distinguish this group of cells to allow them to be studied have been inaccessible previously. We have shown that conclusions that could only be inferred from Western blotting and immunostaining can be demonstrated quantitatively using FACS analysis of individual cells. We found unexpectedly that the subpopulation of cells that continued cycling (failed to undergo G1 arrest) in the presence of TGF-ß1 had decreased topo II{alpha} expression. This observation is consistent with two possibilities. The first is that this sub-population of cells has much lower-than-normal levels of topo II{alpha} expression without TGF-ß1 treatment, and that the cells neither arrest growth nor decrease topo II{alpha} in response to TGF-ß1. The second possibility is that this subpopulation of cells is able to respond to TGF-ß1 by decreasing topo II{alpha} expression, but is able to escape TGF-ß1-induced growth arrest, indicating that inhibition of topo II{alpha} expression can occur independent of G1 cell cycle arrest. The latter possibility regarding this subpopulation would suggest that TGF-ß1 might mediate resistance to etoposide in tumor cells that have lost the ability to undergo G1 arrest but otherwise have the TGF-ß1 signaling pathway intact.

This subpopulation of Mv1Lu cells that fails to respond to TGF-ß1 growth arrest and has decreased topo II{alpha} expression may prove to be a useful model for some types of etoposide-resistant cancer cells that share these two features. If some types of cancer are able to respond to TGF-ß1 by decreasing topo II{alpha} expression without undergoing G1 arrest, then it seems likely that these cancers might respond better to etoposide if TGF-ß1 signaling is blocked. Interestingly, a similar conclusion was reached from studies that showed that neutralizing TGF-ß could reverse the resistance of mouse mammary carcinoma cells to the alkylating agents cyclophosphamide and cisplatin in vivo (44, 45, 46) . Thus, for some types of cancer, rather than increasing TGF-ß1 to protect normal tissues, it may be more beneficial to reduce TGF-ß1 signaling in the tumor to augment sensitivity of the tumor cells to chemotherapy. Of interest, several strategies have proven to effectively reduce TGF-ß1 signaling in vivo (44 , 45 , 47, 48, 49, 50) .

In summary, we found that the ability of TGF-ß1 to inhibit topo II{alpha} expression correlated generally with the ability of TGF-ß1 to induce a G1 cell cycle arrest in Mv1Lu cells. Inactivation of pRb by expression of the papillomavirus type 16 E7 protein effectively abrogated the ability of TGF-ß1 to both arrest growth and inhibit topo II{alpha} expression. However, using quantitative immunohistochemistry, we identified a subpopulation of Mv1Lu cells that failed to undergo G1 arrest in response to TGF-ß1 yet unexpectedly had low levels of topo II{alpha} during G2-M. The latter observation suggested that topo II{alpha} expression might be dissociable from cell cycle position under rare circumstances.

By further elucidating mechanisms that regulate topo II{alpha} expression, this work may aid in the search for drugs that protect normal cells by specifically inhibiting topo II{alpha} expression in vivo during chemotherapy with agents that target topo II{alpha}. Additionally, the available evidence strongly supports the need for additional investigation to determine whether there is a safe and effective means to transiently modulate TGF-ß1 activity to achieve the most successful response in cancer patients undergoing cell cycle-acting cancer chemotherapy. The question of whether increasing or decreasing TGF-ß1 might be most beneficial in a particular patient needs to be considered when developing techniques like microarray analysis to reveal the unique features of an individual tumor. Our results offer the suggestion that TGF-ß1 will not reduce the sensitivity of pRb-deficient tumors to etoposide, therefore the status of pRb in a tumor might help indicate whether a patient would benefit from pretreatment with a TGF-ß1-like agent.


   ACKNOWLEDGMENTS
 
We thank Joe Holden, David Jones, and Bill Carroll for their critical review and helpful comments on the manuscript. We thank Joe Holden for providing the topoisomerase II{alpha} and IIß cDNAs, as well as the topoisomerase II{alpha}-specific antibody. We are grateful to Pauline Cordray for expert technical assistance.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was funded by the Huntsman Cancer Institute. Back

2 To whom requests for reprints should be addressed, at Department of Pediatrics, University of Utah School of Medicine, 50 North Medical Drive, Salt Lake City, UT 84132. Phone: (801) 581-5021; Fax: (801) 585-7395; E-mail: dan.satterwhite{at}hsc.utah.edu Back

3 Abbreviations: topo II{alpha}, topoisomerase II{alpha}; topo IIß, topoisomerase IIß; TGF-ß1, transforming growth factor-ß1; FACS, fluorescence-activated cell-sorter; TBS, Tris-buffered saline; pRb, retinoblastoma tumor suppressor protein; cdk, cyclin dependent kinase; Mv1Lu, mink lung epithelial cell line; PAI-1, plasminogen activator inhibitor-1; PI, with propidium iodide. Back

4 Harley, A. Preparation of alcohol-fixed whole cells from suspension for DNA analysis. At: http://www.bdfacs.com/source book/html/23 1838.shtml, Becton Dickinson, 1997–1999. Back

Received 6/12/00. Accepted 10/18/00.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wang, J. C. DNA topoisomerases, Annu. Rev. Biochem. 65: 635–692, 1996.
  2. Hammonds T. R., Maxwell A. The DNA dependence of the ATPase activity of human DNA topoisomerase II{alpha}. J. Biol. Chem., 272: 32696-32703, 1997.[Abstract/Free Full Text]
  3. Lynch B. J., Guinee D. G., Jr., Holden J. A. Human DNA topoisomerase II-{alpha}: a new marker of cell proliferation in invasive breast cancer. Hum. Pathol., 28: 1180-1188, 1997.[Medline]
  4. Heck M. M., Earnshaw W. C. Topoisomerase II: a specific marker for cell proliferation. J. Cell Biol., 103: 2569-2581, 1986.[Abstract/Free Full Text]
  5. Ramachandran C., Mead D., Wellham L. L., Sauerteig A., Krishan A. Expression of drug resistance-associated mdr-1. GST {pi}, and topoisomerase II genes during cell cycle traverse. Biochem. Pharmacol., 49: 545-552, 1995.[Medline]
  6. Goswami P. C., Roti Roti J. L., Hunt C. R. The cell cycle-coupled expression of topoisomerase II{alpha} during S phase is regulated by mRNA stability and is disrupted by heat shock or ionizing radiation. Mol. Cell. Biol., 16: 1500-1508, 1996.[Abstract]
  7. Woessner R. D., Mattern M. R., Mirabelli C. K., Johnson R. K., Drake F. H. Proliferation- and cell cycle-dependent differences in expression of the 170 kilodalton and 180 kilodalton forms of topoisomerase II in NIH-3T3 cells. Cell Growth Differ., 2: 209-214, 1991.[Abstract]
  8. Hande K. R. Etoposide: four decades of development of a topoisomerase II inhibitor. Eur. J. Cancer, 34: 1514-1521, 1998.
  9. Kaufmann S. H. Cell death induced by topoisomerase-targeted drugs: more questions than answers. Biochim. Biophys. Acta., 1400: 195-211, 1998.[Medline]
  10. Malonne H., Atassi G. DNA topoisomerase targeting drugs: mechanisms of action and perspectives. Anticancer Drugs., 8: 811-822, 1997.[Medline]
  11. McCormack E. S., Borzillo G. V., Ambrosino C., Mak G., Hamablet L., Qu G. Y., Haley J. D. Transforming growth factor-ß3 protection of epithelial cells from cycle-selective chemotherapy in vitro. Biochem. Pharmacol., 53: 1149-1159, 1997.[Medline]
  12. Pietenpol J. A., Stein R. W., Moran E., Yaciuk P., Schlegel R., Lyons R. M., Pittelkow M. R., Munger K., Howley P. M., Moses H. L. TGF-ß1 inhibition of c-myc transcription and growth in keratinocytes is abrogated by viral transforming proteins with pRB binding domains. Cell., 61: 777-785, 1990.[Medline]
  13. Howe P. H., Draetta G., Leof E. B. Transforming growth factor ß 1 inhibition of p34cdc2 phosphorylation and histone H1 kinase activity is associated with G1/S-phase growth arrest. Mol. Cell. Biol., 11: 1185-1194, 1991.[Abstract/Free Full Text]
  14. Laiho M., DeCaprio J. A., Ludlow J. W., Livingston D. M., Massague J. Growth inhibition by TGF-ß linked to suppression of retinoblastoma protein phosphorylation. Cell, 62: 175-185, 1990.[Medline]
  15. Satterwhite D. J., Aakre M. E., Gorska A. E., Moses H. L. Inhibition of cell growth by TGF ß 1 is associated with inhibition of B-myb and cyclin A in both BALB/MK and Mv1Lu cells. Cell Growth Differ., 5: 789-799, 1994.[Abstract]
  16. Murohashi I., Endho K., Nishida S., Yoshida S., Jinnai I., Bessho M., Hirashima K. Differential effects of TGF-ß 1 on normal and leukemic human hematopoietic cell proliferation. Exp. Hematol., 23: 970-977, 1995.[Medline]
  17. Golay J., Cusmano G., Introna M. Independent regulation of c-myc, B-myb, and c-myb gene expression by inducers and inhibitors of proliferation in human B lymphocytes. J. Immunol., 149: 300-308, 1992.[Abstract]
  18. Arsura M., Introna M., Passerini F., Mantovani A., Golay J. B-myb antisense oligonucleotides inhibit proliferation of human hematopoietic cell lines. Blood, 79: 2708-2716, 1992.[Abstract/Free Full Text]
  19. Sala A., Calabretta B. Regulation of BALB/c 3T3 fibroblast proliferation by B-myb is accompanied by selective activation of cdc2 and cyclin D1 expression. Proc. Natl. Acad. Sci. USA, 89: 10415-10419, 1992.[Abstract/Free Full Text]
  20. Brandt T. L., Fraser D. J., Leal S., Halandras P. M., Kroll A. R., Kroll D. J. c-Myb trans-activates the human DNA topoisomerase II{alpha} gene promoter. J. Biol. Chem., 272: 6278-6284, 1997.[Abstract/Free Full Text]
  21. Heck M. M., Hittelman W. N., Earnshaw W. C. Differential expression of DNA topoisomerases I and II during the eukaryotic cell cycle. Proc. Natl. Acad. Sci. USA, 85: 1086-1090, 1988.[Abstract/Free Full Text]
  22. Tlsty T., Briot A., Poulose B. Analysis of cell cycle checkpoint status in mammalian cells. Methods Enzymol., 254: 125-133, 1995.[Medline]
  23. Halbert C. L., Demers G. W., Galloway D. A. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol., 65: 473-478, 1991.[Abstract/Free Full Text]
  24. Johnson M. D., Gold L. I., Moses H. L. Evidence for transforming growth factor-ß expression in human leptomeningeal cells and transforming growth factor-ß-like activity in human cerebrospinal fluid. Lab. Investig., 67: 360-368, 1992.[Medline]
  25. Danielson P. E., Fross-Petter S., Brow A., Calavetta L., Douglass J., Milner R. J., Sutcliffe J. G. p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA, 7: 261-267, 1988.[Medline]
  26. Tsai-Pflugfelder M., Liu L. F., Liu A. A., Tewey K. M., Whang-Peng J., Knutsen T., Huebner K., Croce C. M., Wang J. C. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21–22. Proc. Natl. Acad. Sci. USA, 85: 7177-7181, 1988.[Abstract/Free Full Text]
  27. Chung T. D., Drake F. H., Tan K. B., Per S. R., Crooke S. T., Mirabelli C. K. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes. Proc. Natl. Acad. Sci. USA, 86: 9431-9435, 1989.[Abstract/Free Full Text]
  28. Neufeld K. L., White R. L. Nuclear and cytoplasmic localizations of the adenomatous polyposis coli protein. Proc. Natl. Acad. Sci. USA, 94: 3034-3039, 1997.[Abstract/Free Full Text]
  29. Robinson R. G., Rapp L., Bowdish K. J., Graham M. A., Huff A. C., Coughlin S. A. Isolation and characterization of monoclonal antibodies to a recombinant human topoisomerase II polypeptide. Hybridoma, 12: 407-415, 1993.[Medline]
  30. Laiho M., Ronnstrand L., Heino J., DeCaprio J. A., Ludlow J. W., Livingston D. M., Massague J. Control of junB and extracellular matrix protein expression by transforming growth factor-ß 1 is independent of simian virus 40 T antigen-sensitive growth-sensitive growth-inhibitory events. Mol. Cell. Biol., 11: 972-978, 1991.[Abstract/Free Full Text]
  31. Potten C. S., Booth D., Haley J. D. Pretreatment with transforming growth factor ß-3 protects small intestinal stem cells against radiation damage in vivo. Br. J. Cancer, 75: 1454-1459, 1997.[Medline]
  32. Jansen R., Damia G., Usui N., Keller J., Futami H., Goey H., Back T. T., Longo D. L., Ruscetti F. W., Wiltrout R. H. Effects of recombinant transforming growth factor-ß 1 on hematologic recovery after treatment of mice with 5-fluorouracil. J. Immunol., 147: 3342-3347, 1991.[Abstract]
  33. Goey H., Keller J. R., Back T., Longo D. L., Ruscetti F. W., Wiltrout R. H. Inhibition of early murine hemopoietic progenitor cell proliferation after in vivo locoregional administration of transforming growth factor-ß 1. J. Immunol., 143: 877-880, 1989.[Abstract]
  34. Grzegorzewski K., Ruscetti F. W., Usui N., Damia G., Longo D. L., Carlino J. A., Keller J. R., Wiltrout R. H. Recombinant transforming growth factor ß 1 and ß 2 protect mice from acutely lethal doses of 5-fluorouracil and doxorubicin. J. Exp. Med., 180: 1047-1057, 1994.[Abstract/Free Full Text]
  35. Lemoli R. M., Strife A., Clarkson B. D., Haley J. D., Gulati S. C. TGF-ß 3 protects normal human hematopoietic progenitor cells treated with 4-hydroperoxycyclophosphamide in vitro. Exp. Hematol., 20: 1252-1256, 1992.[Medline]
  36. Pierce D. F., Jr., Coffey R. J. Therapeutic manipulation of cytokines: transforming growth factor ß-1 protects mice treated with lethal doses of cytarabine. Am. Surg., 60: 18-25, 1994.[Medline]
  37. Weyman C. M., Stacey D. W. Transient blockage of proliferative signalling: a novel strategy for protective chemotherapy. Anticancer Res., 16: 493-498, 1996.[Medline]
  38. Sonis S. T., Lindquist L., Van Vugt A., Stewart A. A., Stam K., Qu G. Y., Iwata K. K., Haley J. D. Prevention of chemotherapy-induced ulcerative mucositis by transforming growth factor ß 3. Cancer Res., 54: 1135-1138, 1994.[Abstract/Free Full Text]
  39. Moser M. H., Paukovits W. R. Haemoprotection against cytostatic drugs by stem cell inhibition. Trends Pharmacol. Sci., 12: 304-310, 1991.[Medline]
  40. Strife A., Lambek C., Perez A., Darzynkiewicz Z., Skierski J., Gulati S., Haley J. D., ten Dijke P., Iwata K. K., Clarkson B. D. The effects of transforming growth factor ß 3 on the growth of highly enriched hematopoietic progenitor cells derived from normal human bone marrow and peripheral blood. Cancer Res., 51: 4828-4836, 1991.[Abstract/Free Full Text]
  41. Kudo K., Yoshida H., Kiyoi H., Numata S., Horibe K., Naoe T. Etoposide-related acute promyelocytic leukemia. Leukemia, 12: 1171-1175, 1998.[Medline]
  42. Wang, J. C. DNA topoisomerases as targets of therapeutics: an overview. Adv. Pharmacol., 1–19, 1994.
  43. Isaacs R. J., Davies S. L., Wells N. J., Harris A. L. Topoisomerases II {alpha} and ß as therapy targets in breast cancer. Anticancer Drugs, 6: 195-211, 1995.[Medline]
  44. Teicher B. A., Ikebe M., Ara G., Keyes S. R., Herbst R. S. Transforming growth factor-ß 1 overexpression produces drug resistance in vivo: reversal by decorin. In Vivo, 11: 463-472, 1997.[Medline]
  45. Teicher B. A., Maehara Y., Kakeji Y., Ara G., Keyes S. R., Wong J., Herbst R. Reversal of in vivo drug resistance by the transforming growth factor-ß inhibitor decorin. Int. J. Cancer, 71: 49-58, 1997.[Medline]
  46. Ohmori T., Yang J. L., Price J. O., Arteaga C. L. Blockade of tumor cell transforming growth factor-ßs enhances cell cycle progression and sensitizes human breast carcinoma cells to cytotoxic chemotherapy. Exp. Cell Res., 245: 350-359, 1998.[Medline]
  47. Peters H., Border W. A., Noble N. A. Targeting TGF-ß overexpression in renal disease: maximizing the antifibrotic action of angiotensin II blockade. Kidney Int., 54: 1570-1580, 1998.[Medline]
  48. Isaka Y., Akagi Y., Ando Y., Tsujie M., Sudo T., Ohno N., Border W. A., Noble N. A., Kaneda Y., Hori M., Imai E. Gene therapy by transforming growth factor-ß receptor-IgG Fc chimera suppressed extracellular matrix accumulation in experimental glomerulonephritis. Kidney Int., 55: 465-475, 1999.[Medline]
  49. Border W. A., Noble N. A. TGF-ß in kidney fibrosis: a target for gene therapy. Kidney Int., 51: 1388-1396, 1997.[Medline]
  50. Border W. A., Noble N. A. Targeting TGF-ß for treatment of disease. Nat. Med., 1: 1000-1001, 1995.[Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
D. K. Lee, B.-C. Kim, I. Y. Kim, E.-a. Cho, D. J. Satterwhite, and S.-J. Kim
The Human Papilloma Virus E7 Oncoprotein Inhibits Transforming Growth Factor-beta Signaling by Blocking Binding of the Smad Complex to Its Target Sequence
J. Biol. Chem., October 4, 2002; 277(41): 38557 - 38564.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Satterwhite, D. J.
Right arrow Articles by Neufeld, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Satterwhite, D. J.
Right arrow Articles by Neufeld, K. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online