
[Cancer Research 60, 7052-7056, December 15, 2000]
© 2000 American Association for Cancer Research
Loss of Heterozygosity on 10q23.3 and Mutation of the Tumor Suppressor Gene PTEN in Benign Endometrial Cyst of the Ovary: Possible Sequence Progression from Benign Endometrial Cyst to Endometrioid Carcinoma and Clear Cell Carcinoma of the Ovary1
Nakako Sato,
Hajime Tsunoda,
Masato Nishida,
Yukio Morishita,
Yasuhiko Takimoto,
Takeshi Kubo and
Masayuki Noguchi2
Departments of Obstetrics and Gynecology [N. S., H. T., M. N., T. K.], Clinical Pathology [Y. M.], and Urology [Y. T.], Institute of Clinical Medical Sciences, and Department of Pathology, Institute of Basic Medical Sciences [N. S., Y. T., M. N.], University of Tsukuba, Ibaraki 305-8575, Japan
 |
ABSTRACT
|
|---|
Loss
of heterozygosity (LOH) at locus 10q23.3 and mutation of the
PTEN tumor suppressor gene occur frequently in both
endometrial carcinoma and ovarian endometrioid carcinoma. To
investigate the potential role of the PTEN gene in the
carcinogenesis of ovarian endometrioid carcinoma and its related
subtype, clear cell carcinoma, we examined 20 ovarian endometrioid
carcinomas, 24 clear cell carcinomas, and 34 solitary endometrial cysts
of the ovary for LOH at 10q23.3 and point mutations within the entire
coding region of the PTEN gene. LOH was found in 8 of 19
ovarian endometrioid carcinomas (42.1%), 6 of 22 clear cell carcinomas
(27.3%), and 13 of 23 solitary endometrial cysts (56.5%). In 5
endometrioid carcinomas synchronous with endometriosis, 3 cases
displayed LOH events common to both the carcinoma and the
endometriosis, 1 displayed an LOH event in only the carcinoma, and 1
displayed no LOH events in either lesion. In 7 clear cell carcinomas
synchronous with endometriosis, 3 displayed LOH events common to both
the carcinoma and the endometriosis, 1 displayed an LOH event in only
the carcinoma, and 3 displayed no LOH events in either lesion. In no
cases were there LOH events in the endometriosis only. Somatic
mutations in the PTEN gene were identified in 4 of 20
ovarian endometrioid carcinomas (20.0%), 2 of 24 clear cell carcinomas
(8.3%), and 7 of 34 solitary endometrial cysts (20.6%). These results
indicate that inactivation of the PTEN tumor suppressor
gene is an early event in the development of ovarian endometrioid
carcinoma and clear cell carcinoma of the ovary.
 |
INTRODUCTION
|
|---|
The tumor suppressor gene
PTEN/MMAC1,3
located on chromosome arm 10q (10q23.3), was first reported in 1997 by
Li et al. (1)
. Frequent LOH at 10q23.3 and
mutations of the gene have been found in various types of cancer
(1, 2, 3, 4, 5)
, and germ-line mutations of PTEN have
also been associated with some familial neoplastic diseases such as
Cowden disease, Lhermitte-Ducos disease, and Bannayan-Zonana syndrome
(6, 7, 8)
. Introduction of wild-type PTEN into the
mutant PTEN glioma cell line results in growth suppression
in vivo and in vitro (9)
.
PTEN encodes a phosphatase that dephosphorylates
phosphatidylinositol-3,4,5-triphosphate. The function of the
phosphatase is to interfere with the function of
phosphatidylinositol-3,4,5-triphosphate, to inhibit cell death mediated
by protein kinase B, and to encourage cell proliferation (10
, 11)
. Furthermore, Di Cristofano and Pandolfi (12)
reported that loss of function of just a single allele of
PTEN is sufficient to confer a growth advantage. Their
results indicated that PTEN mutation without LOH in the
PTEN region or LOH in the PTEN region without
mutation can reduce the function of PTEN. Recently, Perren et
al. (13)
examined the expression of the
PTEN gene in breast cancer immunohistochemically and showed
that hemizygous PTEN deletions were well correlated with
lack of staining for PTEN protein.
PTEN gene abnormalities have been identified in
various types of human carcinoma, including brain, endometrium,
prostate, breast, thyroid, liver, lung (small cell carcinoma), and head
and neck carcinomas and lymphomas (1
, 2
, 5
, 14, 15, 16, 17)
. In particular, high frequencies of LOH at
10q23.3 and mutation of the gene have been reported in glioma,
endometrial carcinoma of the uterus, and ovarian endometrioid carcinoma
(1
, 2
, 18, 19, 20)
. However, the roles of the PTEN
gene in the carcinogenesis of glioma and endometrial carcinoma of the
uterus seem to be different. Rasheed et al.
(21)
, Maier et al. (22)
,
and Davis et al. (23)
reported that the
PTEN gene mutations are restricted to high-grade rather than
low-grade gliomas and may be associated with the transition from a low
histological grade to anaplasia. In contrast, Risinger et
al. (24)
reported that, in the genesis of endometrial
carcinoma, PTEN mutations are associated with early-stage,
rather than late and metastatic, carcinomas. Furthermore, Maxwell
et al. (25)
have found frequent PTEN
mutations in endometrial hyperplasia with and without atypia. These
reports indicate that inactivation of the PTEN gene is an
early event in the development of endometrial carcinoma of the uterus.
Endometriosis, the presence of ectopic endometrial tissue, is a
common gynecological disease and is considered to be a benign tumor.
Malignant transformation of endometriosis was first documented in 1925
by Sampsons (26)
and has been thought to occur in
0.71.0% of all cases of endometriosis (27, 28, 29)
.
Genetically, ovarian endometrial cysts have a monoclonal origin
(30)
, and endometrioid and clear cell carcinoma of the
ovary may arise through malignant transformation of ectopic endometrium
(31)
. These findings support the possibility that
endometriosis is a precancerous form of certain types of ovarian
cancer. The aim of the present study was to assess the role of LOH at
the 10q23.3 locus and PTEN gene mutation in the multistep
carcinogenesis of ovarian clear cell and endometrioid carcinoma. We
examined ovarian endometrial cysts and ovarian endometrioid and clear
cell carcinoma for LOH at the loci flanking the PTEN gene
and mutation of the PTEN gene, using a laser-assisted
microdissection method (32)
. We found frequent LOHs at
10q23.3 and mutations of the PTEN gene in endometrial cysts
and clear cell carcinoma of the ovary, as well as in endometrioid
carcinoma of the ovary, suggesting that there is a sequential
progression from ovarian endometrial cyst to endometrioid or clear cell
carcinoma of the ovary.
 |
MATERIALS AND METHODS
|
|---|
Cases and Microdissection.
We examined 20 endometrioid carcinomas, 24 clear cell carcinomas, and
34 solitary endometrial cysts of the ovary, which were resected at the
University Hospital of Tsukuba (Ibaraki, Japan) between 1976 and 1998.
We also examined 12 specimens of normal endometrium without
endometriosis or leiomyoma. We used normal fallopian tubes or lymph
nodes without metastases as normal controls for the endometrial cyst
and carcinoma cases and myometrium as a normal control for normal
endometrial tissue. Eight of the 20 cases of endometrioid carcinoma and
12 of the 24 cases of clear cell carcinoma contained apparently benign
ectopic endometrium in the same ovary. All specimens were fixed with
10% formalin and embedded in paraffin. After histological
examination, the ectopic endometrial cells, carcinoma cells, normal
endometrium, and normal cells that were used as normal controls were
microdissected with a Pixcell Laser Captured Microdissection System
(Arcturus Engineering, Inc., Mountain View, CA; Fig. 1
). Finally, we microdissected about
2040 cells from each specimen and extracted the genomic DNA.
LOH Analysis.
Three microsatellite markers (D10S215, D10S541,
and D10S608) were used to evaluate LOH on 10q23.3. All
primers used in this study were obtained from Research Genetics
(Huntsville, AL). Genomic DNA corresponding to DNA extracted from eight
cells was subjected to PCR amplification in 10 µl of reaction
mixture. The reaction mixture consisted of 3.6 units of Ex-Taq DNA
polymerase (Takara, Tokyo, Japan); 200 µM dATP,
dTTP, and dGTP; 20 µM dCTP; 5 µCi of
[
-32P]dCTP (Amersham Life Science,
Buckinghamshire, United Kingdom); 33.5 mM
Tris-HCl (pH 8.8); 1.5 mM
MgCl2; 16 mM
(NH4)2SO4; 0.01% Tween 20;
and 0.3 µl of each primer as supplied (20 µM
each). PCR was carried out over 35 amplification cycles for 45 s
at 94°C, 45 s at 55°C, and 60 s at 72°C in a Takara
Thermal Cycler MP (Takara). The PCR products were resolved on a 6%
denaturing polyacrylamide gel and visualized by autoradiography film
(Kodak, Rochester, NY) exposure.
SSCP Analysis.
Nine exons of PTEN (except for the first primer set of exon
5) were amplified separately using the primer sets described by
Risinger et al. (19)
. We used
ATCTTTTTACCACAGTTGCAC and GTCCCTTTCCAGCTTTACAG as the first primer set
for exon 5. Genomic DNA corresponding to DNA extracted from eight cells
was subjected to PCR amplification in 10 µl of the reaction mixture
used in the LOH analysis. PCR was carried out as described previously
(19)
. The PCR products were resolved on a 0.5x Mutation
Detection Enhancement gel (FMC Bioproducts, Rockland, ME) and
visualized by autoradiography film (Kodak, Rochester, NY) exposure.
DNA Sequencing.
Shifted SSCP bands were excised from the Mutation Detection Enhancement
gel. We extracted the DNA from the gel with distilled water and
reamplified it using the original PCR primers. The reamplified PCR
products were cloned into the pCRII TA vector (Invitrogen, San Diego,
CA), according to the companys instructions, and then sequenced with
an ABI PRISM 310 Dye Terminator Cycle Sequencing Ready Reaction kit
(Perkin-Elmer, Foster City, CA). For the cases with mutations, we
repeated the microdissection, SSCP analysis and sequencing, and
confirmed the results.
 |
RESULTS
|
|---|
LOH Analysis.
We examined the genotypes of 20 endometrioid carcinomas of the ovary at
three highly polymorphic loci distributed at 10q23.3
(D10S215, D10S541, and D10S608). As
Table 1
shows, 8 of 19 informative cases
of endometrioid carcinoma (42.1%) demonstrated LOH in the 10q23.3
region. To examine whether the LOH found frequently in this region in
endometrioid carcinoma of the ovary was also present in clear cell
carcinoma and endometrial cysts (which are thought to be associated
histologically with endometrioid carcinoma of the ovary), we further
studied 24 clear cell carcinomas and 34 endometrial cysts of the ovary
(Table 1
and Fig. 1
). Six of 22 informative cases of clear cell
carcinoma (27.3%) and 13 of 23 informative cases of endometrial cyst
(56.5%) demonstrated LOH at 10q23.3. None of the 12 specimens of
normal endometrium showed LOH at D10S215,
D10S541, or D10S608.
View this table:
[in this window]
[in a new window]
|
Table 1 Frequency of LOH at 10q23.3 in normal endometrium, endometrial cyst,
endometrioid carcinoma, and clear cell carcinoma of the ovary
|
|
SSCP and Sequencing.
SSCP analysis of the PTEN gene was performed on 20
endometrioid carcinomas, 24 clear cell carcinomas, and 34 solitary
endometrial cysts without carcinoma. We screened the entire
PTEN coding region (9 exons; Fig. 2
). Four, 3, and 11 abnormally shifted
bands that were detected from cases of ovarian endometrioid carcinoma,
clear cell carcinoma, and endometrial cyst, respectively, were eluted
from the gel, and the DNA extracted was sequenced (Table 2)
. There was one missense mutation
(transversion), two nonsense mutations, and one deletion in four
endometrioid carcinomas. Two missense mutations (transitions) and one
deletion were detected in two clear cell carcinomas. Eight missense
mutations (seven transitions and one transversion) and two deletions
were detected in seven endometrial cysts. In the ovarian endometrioid
carcinomas, the codons that showed the mutation were scattered between
exons 1 and 9, but they appeared to cluster around the catalytic
signature motif of the PTEN gene in the clear cell
carcinomas and endometrial cysts (Fig. 3)
. Two of four cases of endometrioid
carcinoma, one of two cases of clear cell carcinoma, and five of eight
cases of solitary endometrial cyst were accompanied by LOH at 10q23.3.

View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Representative results of LOH at 10q23.3 and SSCP analysis
of PTEN gene in endometrial cyst (case 26), endometrioid
carcinoma (case 2), and clear cell carcinoma (case 18) of the ovary.
Arrow, shifted band in SSCP analysis.
Arrowhead, allelic loss. T, tumor;
N, normal.
|
|
Comparison of LOH at 10q23.3 in Ovarian Carcinoma and Synchronous
Apparently Benign Endometrium.
We detected apparently benign ectopic endometrium synchronously in 8 of
20 endometrioid carcinomas and 12 of 24 clear cell carcinomas. These
endometrial tissues were diagnosed as benign ectopic endometrium
histologically and were also examined for LOH in the PTEN
region (D10S215 and D10S541), the patterns of LOH
being compared between them and the carcinomas. Five of eight
endometrioid carcinoma cases synchronous with endometriosis and 7 of 12
clear cell carcinoma cases synchronous with endometriosis were
informative. Of these five endometrioid carcinoma cases, three
displayed LOH events common to both the carcinoma and endometriosis,
one displayed an LOH event only in the carcinoma, and one displayed no
LOH event in either lesion (Fig. 4)
. Of
the seven clear cell carcinoma cases, three displayed LOH events common
to both the carcinoma and endometriosis, 1 displayed an LOH event only
in the carcinoma, and three displayed no LOH event in either lesion. In
no case was LOH detected only in endometriosis.

View larger version (94K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Comparison of LOH at 10q23.3 in ovarian carcinoma and
synchronous endometrial cyst. LOH analysis at D10S541 in
each lesion of endometrioid carcinoma, cases 20 and 21
(Em20 and Em21), and clear cell
carcinoma, cases 7 and 8 (CCC7 and CCC8;
A). T, carcinoma; E,
benign ectopic endometrium; N, normal;
arrowhead, allelic loss. B, histological
section of clear cell carcinoma case 7. High-power views of clear cell
carcinoma (C) and endometrial cyst (D)
are shown; H&E, x200.
|
|
 |
DISCUSSION
|
|---|
In this study, we confirmed the high frequency of LOH at 10q23.3
in endometrioid carcinoma of the ovary (42.1%) and demonstrated high
frequencies of LOH at 10q23.3 in solitary endometrial cysts (56.5%)
and clear cell carcinoma of the ovary (27.3%). SSCP and DNA sequence
analysis also displayed somatic mutations in the solitary endometrial
cysts (20.6%), as well as in the endometrioid type (20.0%) and clear
cell type (8.3%) of ovarian carcinoma.
Clinicopathologically, endometrial cysts of the ovary are thought to
develop from ectopic endometrium in the ovary, and they have recently
been confirmed to grow monoclonally (30)
. Jiang et
al. (33) found that <20% of endometrial cysts had
LOH at the loci (chromosomes 9q, 11q, and 22q) of candidate tumor
suppressor genes associated with ovarian cancers. We found more
frequent LOH at 10q23.3 in endometrial cysts of the ovary than at these
other loci (see Table 1
). Furthermore, we observed mutations of the
PTEN gene in seven cases of solitary endometrial cyst
(20.6%), and five of these seven were accompanied by LOH at 10q23.3
(Table 2)
. Maxwell et al. (25)
reported somatic
mutation of the PTEN gene in
20% of cases of endometrial
hyperplasia, which is thought to be the precursor of endometrial
carcinoma of the uterus, and the frequencies did not differ between
hyperplasia with atypia and that without atypia. These data indicated
the genetic sequence from endometrial hyperplasia to endometrial
carcinoma of the uterus. The high frequency of PTEN gene
mutation we observed in solitary endometrial cysts suggests a similar
genetic association between solitary endometrial cyst of the ovary and
ovarian endometrioid carcinoma. Our results indicate that LOH at
10q23.3 and mutations of the PTEN gene are very early events
in the development of ovarian endometrioid carcinoma and also support
the concept that solitary endometrial cysts of the ovary are a
precancerous form of ovarian endometrioid carcinoma. In contrast, the
frequency of PTEN gene alterations (including LOH on 10q23.3
and somatic mutations of the PTEN gene) in other types of
ovarian carcinoma, such as serous or mucinous adenocarcinoma, has been
reported to be very small compared with that in ovarian endometrioid
carcinoma (20)
. However, the frequency and significance of
PTEN gene abnormalities in clear cell carcinoma of the ovary
is still unclear. Obata et al. (20)
reported
LOH at 10q23.3 in one of seven informative cases of clear cell
carcinoma but found no mutations of the PTEN gene in any of
the cases they examined (0 of 8). We examined a large number of clear
cell carcinomas (24 cases) and demonstrated LOH at 10q23.3 in 6 of 22
informative cases (27.3%); we found PTEN mutations in 8.3%
(2 of 24). Although LOH at 10q23.3 and PTEN mutation
occurred less frequently in clear cell carcinoma than in endometrioid
carcinoma, there were no significant differences in their occurrences
in the two types of carcinoma, and the frequency of LOH was still
higher than in other histological types of ovarian carcinoma.
The mutation spectra of the PTEN gene in these three
different types of ovarian tumors were of interest. Mutations in the
endometrial cysts and clear cell carcinomas were concentrated at exons
56, which encode the phosphatase domain of the PTEN gene
(Fig. 3)
. These results indicate the functional similarity of
tumorigenesis between endometrial cyst and clear cell carcinoma of the
ovary.
To confirm the sequences of carcinogenesis between endometrial cyst and
ovarian endometrioid carcinoma or clear cell carcinoma of the ovary, we
investigated LOH events at D10S215 and D10S541
(which flank the PTEN gene) in five endometrioid carcinomas
and seven clear cell carcinomas that were thought to have occurred
synchronously with endometrial cysts. We found cases that displayed LOH
events in both the carcinoma and apparently benign cyst, or only in the
carcinoma, but none of the cases showed LOH events only in the cyst
(Fig. 4)
. Although there is a possibility that cystic lesions may be
part of an extremely well differentiated adenocarcinoma, these results
are thought to support the concept of sequential progression from
endometrial cyst of the ovary to ovarian endometrioid or clear cell
carcinoma.
In this study, we used a laser-assisted microdissection system
(32)
, which enabled us to collect not only tumor cells
from carcinoma tissue but also the epithelial lining cells of
endometriosis tissue, without contamination by nontumor cells such as
lymphocytes, endothelial cells, and fibroblasts. This approach made it
possible to analyze various genetic alterations in the endometrial
cysts. We expect that this technique will be very useful for
investigating genetic alterations in other tissues or precancerous
lesions such as ulcerative colitis, lung fibrosis, or benign prostatic
hyperplasia, because in these lesions, the dysplastic or atypical cells
that are thought to be carcinoma precursors are widely mixed with
numerous nontumor cells. Early genetic alterations in various
precancerous cells detected by light microscopy can be readily
identified by the tissue-microdissection method.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by a Grant-in-Aid for Cancer
Research from the Ministry of Health and Welfare of Japan. 
2 To whom requests for reprints should be
addressed, at Department of Pathology, Institute of Basic Medical
Sciences, University of Tsukuba, Tennodai 1-1-1, Tsukuba-shi, Ibaraki
305-8575, Japan. Phone: 81-298-53-3350; Fax: 81-298-53-3150; E-mail: nmasayuk{at}md.tsukuba.ac.jp 
3 The abbreviations used are: PTEN/MMAC1,
phosphatase and tensin homologue deleted on chromosome 10/mutated in
multiple advanced cancers 1; LOH, loss of heterozygosity; SSCP,
single-strand conformational polymorphism. 
Received 12/28/99.
Accepted 10/19/00.
 |
REFERENCES
|
|---|
-
Li J., Yen C., Liaw D., Podsypanina K., Bose S., Wang S. I., Puc J., Miliaresis C., Rodgers L., McCombie R., Bigner S. H., Giovanella B. C., Ittmann M., Tycko B., Hibshoosh H., Wigler M. H., Parsons R. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science (Washington DC), 275: 1943-1947, 1997.[Abstract/Free Full Text]
-
Steck P. A., Pershouse M. A., Jasser S. A., Yung W. K. A., Lin H., Ligon A. H., Langford L. A., Baumgard M. L., Hattier T., Davis T., Frye C., Hu R., Swedlund B., Teng D. H. F., Tavtigian S. V. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23. 3 that is mutated in multiple advanced cancers. Nat. Genet., 15: 356-362, 1997.[Medline]
-
Guldberg P., Thor Straten P., Birck A., Ahrenkiel V., Kirkin A. F., Zeuthen J. Disruption of the MMAC1/PTEN gene by deletion or mutation is a frequent event in malignant melanoma. Cancer Res., 57: 3660-3663, 1997.[Abstract/Free Full Text]
-
Kim S. K., Su L. K., Oh Y., Kemp B. L., Hong W. K., Mao L. Alterations of PTEN/MMAC1, a candidate tumor suppressor gene, and its homologue, PTH2, in small cell lung cancer cell lines. Oncogene, 16: 89-93, 1998.[Medline]
-
Shao X., Tandon R., Samara G., Kanki H., Yano H., Close L. G., Parsons R., Sato T. Mutational analysis of the PTEN gene in head and neck squamous cell carcinoma. Int. J. Cancer, 77: 684-688, 1998.[Medline]
-
Liaw D., Marsh D. J., Li J., Dahia P. L., Wang S. I., Zheng Z., Bose S., Call K. M., Tsou H. C., Peacocke M., Eng C., Parsons R. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat. Genet., 16: 64-67, 1997.[Medline]
-
Marsh D. J., Dahia P. L., Zheng Z., Liaw D., Parsons R., Gorlin R. J., Eng C. Germline mutations in PTEN are present in Bannayan-Zonana syndrome. Nat. Genet., 16: 333-334, 1997.[Medline]
-
Nelen M. R., van Staveren W. C., Peeters E. A., Hassel M. B., Gorlin R. J., Hamm H., Lindboe C. F., Fryns J. P., Sijmons R. H., Woods D. G., Mariman E. C., Padberg G. W., Kremer H. Germline mutations in the PTEN/MMAC1 gene in patients with Cowden disease. Hum. Mol. Genet., 6: 1383-1387, 1997.[Abstract/Free Full Text]
-
Furnari F. B., Huang H-J. S., Cavenee W. K. The phosphoinositol phosphatase activity of PTEN mediates a serum-sensitive G1 growth arrest in glioma cells. Cancer Res., 58: 5002-5008, 1998.[Abstract/Free Full Text]
-
Maehama T., Dixon J. E. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-triphosphate. J. Biol. Chem., 273: 13375-13378, 1998.[Abstract/Free Full Text]
-
Myers M. P., Stolarov J. P., Eng C., Li J., Wang S. I., Wigler M. H., Parsons R., Tonks N. K. P-TEN, the tumor suppressor from human chromosome 10q23, is a dual-specificity phosphatase. Proc. Natl. Acad. USA, 94: 9052-9057, 1997.[Abstract/Free Full Text]
-
Di Cristofano A., Pandolfi P. P. The multiple roles of PTEN in tumor suppression. Cell, 100: 387-390, 2000.[Medline]
-
Perren A., Weng L-P., Boag A. H., Ziebold U., Thakore K., Dahia P. L. M., Komminoth P., Lees J. A., Mulligan L. M., Mutter G. L., Eng C. Immunohistochemical evidence of loss of PTEN expression in primary ductal adenocarcinomas of the breast. Am. J. Pathol., 155: 1253-1260, 1999.[Abstract/Free Full Text]
-
Dahia P. L., Marsh D. J., Zheng Z., Zedenius J., Komminoth P., Frisk T., Wallin G., Parsons R., Longy M., Larsson C., Eng C. Somatic deletions and mutations in the Cowden disease gene, PTEN, in sporadic thyroid tumors. Cancer Res., 57: 4710-4713, 1997.[Abstract/Free Full Text]
-
Yao Y. J., Ping X. L., Zhang H., Chen F. F., Lee P. K., Ahsan H., Chen C. J., Lee P. H., Peacocke M., Santella R. M., Tsou H. C. PTEN/MMAC1 mutations in hepatocellular carcinomas. Oncogene, 18: 3181-3185, 1999.[Medline]
-
Yokomizo A., Tindall D. J., Drabkin H., Gemmill R., Franklin W., Yang P., Sugio K., Smith D. I., Liu W. PTEN/MMAC1 mutations identified in small cell, but not in non-small cell lung cancers. Oncogene, 17: 475-479, 1998.[Medline]
-
Sakai A., Thieblemont C., Wellmann A., Jaffe E. S., Raffeld M. PTEN gene alterations in lymphoid neoplasms. Blood, 92: 3410-3415, 1998.[Abstract/Free Full Text]
-
Tashiro H., Blazes M. S., Wu R., Cho K. R., Bose S., Wang S. I., Li J., Parsons R., Ellenson L. H. Mutations in PTEN are frequent in endometrial carcinoma but rare in other common gynecological malignancies. Cancer Res., 57: 3935-3940, 1997.[Abstract/Free Full Text]
-
Risinger J. I., Hayes A. K., Berchiuck A., Barrett J. C. PTEN/MMAC1 mutation in endometrial cancers. Cancer Res., 57: 4736-4738, 1997.[Abstract/Free Full Text]
-
Obata K., Morland S. J., Watson R. H., Hitchcock A., Chenevix-Trench G., Thomas E. J., Campbell I. G. Frequent PTEN/MMAC1 mutations in endometrioid but not serous or mucinous epithelial ovarian tumors. Cancer Res., 58: 2095-2097, 1998.[Abstract/Free Full Text]
-
Rasheed B. K., Stenzel T. T., McLendon R. E., Parsons R., Friedman A. H., Friedman H. S., Bigner D. D., Bigner S. H. PTEN gene mutations are seen in high-grade but not in low-grade gliomas. Cancer Res., 57: 4187-4190, 1997.[Abstract/Free Full Text]
-
Maier D., Zhang Z., Taylor E., Hamou M. F., Gratzl O., Van Meir E. G., Scott R. J., Merlo A. Somatic deletion mapping on chromosome 10 and sequence analysis of PTEN/MMAC1 point to the 10q2526 region as the primary target in low-grade and high-grade gliomas. Oncogene, 16: 3331-3335, 1998.[Medline]
-
Davies M. P., Gibbs F. E., Halliwell N., Joyce K. A., Roebuck M. M., Rossi M. L., Salisbury J., Sibson D. R., Tacconi L., Walker C. Mutation in the PTEN/MMAC1 gene in archival low grade and high grade gliomas. Br. J. Cancer, 79: 1542-1548, 1999.[Medline]
-
Risinger J. I., Hayes K., Maxwell G. L., Carney M. E., Dodge R. K., Barrett J. C., Berchuck A. PTEN mutation in endometrial cancers is associated with favorable clinical and pathologic characteristics. Clin. Cancer Res., 4: 3005-3010, 1998.[Abstract]
-
Maxwell G. L., Risinger J. I., Gumbs C., Shaw H., Bentley R. C., Barrett J. C., Berchuck A., Futreal P. A. Mutation of the PTEN tumor suppressor gene in endometrial hyperplasias. Cancer Res., 58: 2500-2503, 1998.[Abstract/Free Full Text]
-
Sampsons J. A. Endometrial carcinoma of the ovary, arising in endometrial tissue in that organ. Arch. Surg., 10: 1-72, 1925.[Abstract/Free Full Text]
-
Corner G. W., Hu C. Y., Jr., Hertig A. T. Ovarian carcinoma arising in endometriosis. Am. J. Obstet. Gynecol., 59: 760-774, 1950.
-
Scully R. E., Richardson G. S., Barlow J. F. The development of malignancy in endometriosis. Clin. Obstet. Gynecol., 9: 384-441, 1966.[Medline]
-
Sainz de la Cuesta R., Eichhorn J. H., Rice L. W., Fuller A. F., Jr., Nikrui N., Goff B. A. Histologic transformation of benign endometriosis to early epithelial ovarian cancer. Gynecol. Oncol., 60: 238-244, 1996.[Medline]
-
Jimbo H., Hitomi Y., Yoshikawa H., Yano Y., Momoeda M., Sakamoto A., Tsutsumi O., Taketani Y., Esumi H. Evidence for monoclonal expansion of epithelial cells in ovarian endometrial cysts. Am. J. Pathol., 150: 1173-1178, 1997.[Abstract]
-
Jiang X., Morland S. J., Hitchcock A., Thomas E. J., Campbell I. G. Allelotyping of endometriosis with adjacent ovarian carcinoma reveals evidence of a common lineage. Cancer Res., 58: 1707-1712, 1998.[Abstract/Free Full Text]
-
Emmert-Buck M. R., Bonner R. F., Smith P. D., Chuaqui R. F., Zhuang Z., Goldstein S. R., Weiss R. A., Liotta L. A. Laser capture microdissection. Science (Washington DC), 274: 998-1001, 1996.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
B. C. Lin, M. Suzawa, R. D. Blind, S. C. Tobias, S. E. Bulun, T. S. Scanlan, and H. A. Ingraham
Stimulating the GPR30 Estrogen Receptor with a Novel Tamoxifen Analogue Activates SF-1 and Promotes Endometrial Cell Proliferation
Cancer Res.,
July 1, 2009;
69(13):
5415 - 5423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Oda, J. Okada, L. Timmerman, P. Rodriguez-Viciana, D. Stokoe, K. Shoji, Y. Taketani, H. Kuramoto, Z. A. Knight, K. M. Shokat, et al.
PIK3CA Cooperates with Other Phosphatidylinositol 3'-Kinase Pathway Mutations to Effect Oncogenic Transformation
Cancer Res.,
October 1, 2008;
68(19):
8127 - 8136.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. W. Montgomery, D. R. Nyholt, Z. Z. Zhao, S. A. Treloar, J. N. Painter, S. A. Missmer, S. H. Kennedy, and K. T. Zondervan
The search for genes contributing to endometriosis risk
Hum. Reprod. Update,
September 1, 2008;
14(5):
447 - 457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Treloar, Z. Z. Zhao, L. Le, K. T. Zondervan, N. G. Martin, S. Kennedy, D. R. Nyholt, and G. W. Montgomery
Variants in EMX2 and PTEN do not contribute to risk of endometriosis
Mol. Hum. Reprod.,
August 1, 2007;
13(8):
587 - 594.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S P Tan and S. Kaye
Ovarian clear cell adenocarcinoma: a continuing enigma
J. Clin. Pathol.,
April 1, 2007;
60(4):
355 - 360.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chaudhuri, S. Orsulic, and B. T. Ashok
Antiproliferative activity of sulforaphane in Akt-overexpressing ovarian cancer cells
Mol. Cancer Ther.,
January 1, 2007;
6(1):
334 - 345.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Grummer
Animal models in endometriosis research
Hum. Reprod. Update,
September 1, 2006;
12(5):
641 - 649.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Vigano, E. Somigliana, I. Chiodo, A. Abbiati, and P. Vercellini
Molecular mechanisms and biological plausibility underlying the malignant transformation of endometriosis: a critical analysis
Hum. Reprod. Update,
January 1, 2006;
12(1):
77 - 89.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I.-M. Shih and R. J. Kurman
Molecular Pathogenesis of Ovarian Borderline Tumors: New Insights and Old Challenges
Clin. Cancer Res.,
October 15, 2005;
11(20):
7273 - 7279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Shedden, M. P. Kshirsagar, D. R. Schwartz, R. Wu, H. Yu, D. E. Misek, S. Hanash, H. Katabuchi, L. H. Ellenson, E. R. Fearon, et al.
Histologic Type, Organ of Origin, and Wnt Pathway Status: Effect on Gene Expression in Ovarian and Uterine Carcinomas
Clin. Cancer Res.,
March 15, 2005;
11(6):
2123 - 2131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I.-M. Shih and R. J. Kurman
Ovarian Tumorigenesis: A Proposed Model Based on Morphological and Molecular Genetic Analysis
Am. J. Pathol.,
May 1, 2004;
164(5):
1511 - 1518.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Varma, T. Rollason, J. K Gupta, and E. R Maher
Endometriosis and the neoplastic process
Reproduction,
March 1, 2004;
127(3):
293 - 304.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-H. Tung, M. T. Goodman, A. H. Wu, K. McDuffie, L. R. Wilkens, L. N. Kolonel, A. M. Y. Nomura, K. Y. Terada, M. E. Carney, and L. H. Sobin
Reproductive Factors and Epithelial Ovarian Cancer Risk by Histologic Type:A Multiethnic Case-Control Study
Am. J. Epidemiol.,
October 1, 2003;
158(7):
629 - 638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lin, X. Zhang, and Y. Chen
Mutagen sensitivity as a susceptibility marker for endometriosis
Hum. Reprod.,
October 1, 2003;
18(10):
2052 - 2057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Masciullo, G. Baldassarre, F. Pentimalli, M. T. Berlingieri, A. Boccia, G. Chiappetta, J. Palazzo, G. Manfioletti, V. Giancotti, G. Viglietto, et al.
HMGA1 protein over-expression is a frequent feature of epithelial ovarian carcinomas
Carcinogenesis,
July 1, 2003;
24(7):
1191 - 1198.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Singer, R. Oldt III, Y. Cohen, B. G. Wang, D. Sidransky, R. J. Kurman, and I.-M. Shih
Mutations in BRAF and KRAS Characterize the Development of Low-Grade Ovarian Serous Carcinoma
J Natl Cancer Inst,
March 19, 2003;
95(6):
484 - 486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Shridhar, A. Sen, J. Chien, J. Staub, R. Avula, S. Kovats, J. Lee, J. Lillie, and D. I. Smith
Identification of Underexpressed Genes in Early- and Late-Stage Primary Ovarian Tumors by Suppression Subtraction Hybridization
Cancer Res.,
January 1, 2002;
62(1):
262 - 270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Aoyagi, T. Yokose, Y. Minami, A. Ochiai, T. Iijima, Y. Morishita, T. Oda, K. Fukao, and M. Noguchi
Accumulation of Losses of Heterozygosity and Multistep Carcinogenesis in Pulmonary Adenocarcinoma
Cancer Res.,
November 1, 2001;
61(21):
7950 - 7954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. L. Mutter
PTEN, a Protean Tumor Suppressor
Am. J. Pathol.,
June 1, 2001;
158(6):
1895 - 1898.
[Full Text]
[PDF]
|
 |
|