| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02142 [S. K. D., H-y. Y., R. A. W.]; Department of Hematology/Oncology, Massachusetts General Hospital, Boston, Massachusetts 02114 [S. K. D.]; Harvard Medical School, Boston, Massachusetts 02115 [S. K. D.]; Childrens Medical Research Institute, Westmead, N.S.W. 2145, Australia [R. R. R.]; and Netherlands Cancer Institute, 1066 CX Amsterdam, the Netherlands [R. L. B.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The activity of the telomerase holoenzyme is largely governed by the intracellular level of its catalytic subunit hTERT3 (4 , 5) . Little is known about the mechanisms regulating the expression of hTERT in normal and malignant cells. The hTERT promoter contains a high density of CpG dinucleotides that in aggregate define a typical CpG islanda DNA sequence that is a potential target for repression through DNA methylation (6, 7, 8) .4 Most CpG island sequences are unmethylated in normal cells, and protection from DNA methylation is necessary but not sufficient for gene transcription (9, 10, 11) .
The de novo methylation of CpG islands in postembryonic cells is associated with aging, the establishment of cells in culture, and tumorigenesis. In the colon, progressive DNA methylation that correlates with aging has been observed at the CpG islands of a number of genes, including the estrogen receptor gene (12 , 13) . Widespread CpG island methylation accompanies the establishment of nontransformed cells in culture (14) . In tumors, de novo CpG island methylation has been shown to repress the expression of the von Hippel-Lindau, retinoblastoma, and p16 tumor suppressor genes, among others (9, 10, 11) . A phenotype of extensive de novo CpG island methylation has been identified in colon cancers that appear to cause, among other things, the repression of the hMLH1 gene, which in turn may contribute to microsatellite instability and tumor progression (13 , 15) .
Because the expression of telomerase catalytic activity can be an important contributor to malignant transformation in human cells (1 , 2) , we reasoned that mechanisms leading to the repression of hTERT could have a potential tumor suppressor function. Consequently, we sought to determine whether the CpG island of the telomerase gene is a potential target for repression by DNA methylation.
| Materials and Methods |
|---|
|
|
|---|
Methylation-specific PCR.
PCR reactions were performed in 25 µl, using published conditions
(16)
and 1.25 units of Taq Polymerase (Perkin-Elmer Corp.)
complexed with TaqStart antibody (Clontech). Reactions were assembled
on ice and hot-started at 95°C for 5 min, followed by PCR: 10 cycles
of 95°C for 30 s; 70°C for 30 s (decreasing by 1°C with
each cycle); and 72°C for 30 s. This was followed by 30 cycles of
95°C for 30 s, 60°C for 30 s, and 72°C for 30 s,
and concluded at 72°C for 600 s. Reactions were analyzed on
ethidium bromide-stained 2.5% agarose gels in 1x Tris-borate EDTA
buffer.
RT-PCR for hTERT mRNA.
Total RNA (5 µg) was used in a cDNA synthesis reaction using the
First-strand cDNA synthesis kit (Pharmacia), with the reverse
hTERT and GAPDH primers, each at 2 mM.
PCR reactions were run in standard conditions with 2.5 units of Taq
Polymerase (Perkin-Elmer Corp.) complexed with Taq Start antibody
(Clontech) and 32P-labeled forward primers. cDNA
(5 µl) was used in the hTERT reactions; one microliter of
a 1:400 dilution of the cDNA was used in the GAPDH reactions. PCR
reactions were cycled 25 times: 94°C for 30 s, 60°C for
30 s, 72°C for 30 s. Ten microliters of each reaction were
analyzed with 8% PAGE, 1x Tris-borate EDTA. hTERT primers
were: LT5 forward (CGGAAGAGTGTCTGGAGCAA) and LT6 reverse
(LT6GGATGAAGCGGAGTCTGGA; Ref. 17
). GAPDH primers were:
GAPDH1 forward (GACCCCTTCATTGACCTCAAC) and GAPDH2 reverse primer
(CTTCTCCATGGTGGTGAAGA).
Sequencing of MSP Products.
MSP products were subcloned into plasmid vectors using the Topo TA
cloning kit (Invitrogen), following the manufacturers instructions.
Plasmid DNAs were purified using the Wizard Plus miniprep kit
(Promega), and then sequenced by Research Genetics (Huntsville, AL).
Cell Culture.
Cultured cells were maintained in standard conditions in DME
with 10% heat-inactivated fetal bovine serum. For 5-aza-C treatment,
cells were incubated in MEM
with 10 µM 5-aza-C for
24 h on day 1 and day 4, and then harvested on day 7 for analysis
(15)
. Total cell RNA was prepared using RNAzol (Tel-Test).
| Results |
|---|
|
|
|---|
The MSP technique we have used to determine the methylation state of
the hTERT CpG island is based on the observation that sodium
bisulfite treatment of DNA converts cytosines into uridines and that
this reaction is strongly inhibited when cytosines are methylated
(19)
. DNA that has been treated with sodium bisulfite,
therefore, retains only methylated cytosines, and can subsequently be
tested with PCR primers that amplify specifically either modified or
unmodified DNA (16)
. We generated PCR primers that
distinguish between bisulfite-modified and -unmodified cytosines in the
hTERT CpG island. For this study, we chose primer sets to
assay the methylation state of the transcription start site, as well as
regions 3' to the translation start site that are near the first intron
and which may contribute to hTERT activation (Refs.
6, 7, 8
; Fig. 1a
).5 Primer sets generated to test
sequences near the 5' boundary of the hTERT CpG island
revealed complete DNA methylation in most of the cell lines and tumors
examined, independent of the state of expression of the
hTERT gene, suggesting that methylation at the extreme 5'
end of the CpG island does not play a significant role in
hTERT regulation (data not shown). Additional primer pairs
at
300 and 140 bp upstream of the transcription start site yielded
results that correlated closely with the results described below for
the 5' primer pairs (data not shown) and, therefore, will not be
discussed further.
|
We sought to establish whether telomerase-negative cells have
hTERT CpG island methylation that might underlie the absence
of hTERT expression in these cells. To do so, we tested DNA
prepared from a series of primary, mortal cell strains and immortal
cell lines. As shown in Fig. 2a
, the hTERT CpG island is unmethylated in the
WI38 cell strain (primary fibroblasts), the HA-1 precrisis cell strain
(mortal, SV40 large T-transformed embryonic kidney cells), and the
JFCF-6T/5K precrisis cell strain (mortal, SV40 large T-transformed
fibroblasts), all of which are telomerase negative as judged by the
highly sensitive TRAP assay (Ref. 20
; data not
shown). We observed identical results with DNA prepared from IMR90 and
BJ primary fibroblast cells (data not shown), which are also telomerase
negative.
|
To determine whether the inhibition of DNA methylation could induce
hTERT expression in cells with methylated hTERT
loci, we treated GM847, U2OS, and VA13 cells with the DNA-methylation
inhibitor 5-aza-C (22)
. Treatment of GM847 cells with
5-aza-C induced transcription of hTERT that was detectable
with RT-PCR (Fig. 3a)
. Similarly, 5-aza-C treatment of U2OS cells reproducibly
increased a low level of hTERT transcription by 23-fold.
The VA13 cell line did not induce hTERT expression with
5-aza-C treatment despite having substantial CpG island methylation
(data not shown). As a negative control, we treated the HA-1 precrisis
cell line with 5-aza-C, which is telomerase negative but does not have
a methylated hTERT CpG island. As expected, hTERT
was not induced. The levels of mRNA induced by 5-aza-C in U2OS and
GM847 cells were much lower than in telomerase-positive HA-1 postcrisis
cells, and telomerase catalytic activity could not be detected in the
5-aza-C-treated GM847 or U2OS cells using the TRAP assay (Ref.
20
; data not shown). Taken together, these data indicate
that DNA methylation of the hTERT CpG island can contribute
to repression the hTERT gene, but that additional regulatory
mechanisms operate to limit hTERT expression in U2OS and
GM847 cells, and to prevent hTERT expression in VA13 and
HA-1 cells.
|
In general, CpG island methylation correlates inversely with gene
expression (9, 10, 11)
. We, therefore, expected that the
hTERT CpG islands of telomerase-positive cell lines would
not be methylated. The telomerase-positive postcrisis HA-1 embryonic
kidney and the JFCF-6T/1J.6B fibroblast cell lines both revealed
unmethylated hTERT loci (Fig. 2b)
. However, we
observed partial methylation of the hTERT CpG island in the
293 human embryonic kidney cell line, the HeLa cervical carcinoma cell
line, and the SW480 and HT29 colon carcinoma cell lines, all of which
are strongly telomerase positive (Fig. 2b)
. Specifically,
all four lines revealed DNA methylation with the 5' primer set
(specific for the transcription start site), with the HeLa and SW480
cells also exhibiting partial methylation with the 3' primer set
(downstream of the translation start site). Partial methylation did not
correlate with the level of hTERT mRNA expression because
the 293 cells have steady-state hTERT mRNA levels 8-fold
greater than HA-1 postcrisis cells (data not shown). These results
indicate that partial hTERT CpG island methylation can exist
in telomerase-positive cells and is not inhibitory of telomerase gene
expression.
The de novo methylation of CpG islands is a frequent
accompaniment to malignant transformation (9, 10, 11)
. We,
therefore, sought to evaluate whether hTERT CpG island
methylation occurs during tumorigenesis and is a feature of
telomerase-negative tumors. We used MSP to test for a correlation
between hTERT CpG island methylation and telomerase
expression in a series of primary tumor and normal control tissues
(Fig. 4)
. A telomerase-negative adrenal carcinoma (Adrenal ALT), that has the
telomere length pattern characteristic of all telomerase-negative,
immortalized human cells studied to date (21)
, exhibited
no hTERT CpG island methylation, as did the
telomerase-positive CT1485 colon carcinoma (Fig. 4)
. A
telomerase-negative breast carcinoma (Breast ALT) (21)
and
a telomerase-negative colon carcinoma (Co1310) both revealed partial
CpG island methylation. However, the extent of methylation, as
indicated by the pattern of primer pairs that amplified the
bisulfite-treated DNA, was identical to that seen in the
telomerase-positive Br1958 and Co1229 carcinomas, respectively. In
accord with the observations made with telomerase-negative cell lines,
these results do not reveal a correlation between telomerase-expression
and hTERT CpG island methylation in tumors. Furthermore,
they reveal that methylation of the hTERT CpG island is not
a prerequisite for the telomerase-negative phenotype in tumors.
|
| Discussion |
|---|
|
|
|---|
In contrast to normal and primary tissues, we found that the hTERT CpG island is methylated in a variety of primary tumor tissues and cultured cells. However, both telomerase-positive and telomerase-negative cell lines and tumors exhibited partial methylation of their hTERT CpG islands, and we observed no correlation between the degree of methylation and telomerase activity. Therefore, hTERT CpG island methylation is unlikely to play a substantial role in the regulation of hTERT in vivo, and the CpG island methylation we observed likely reflects the de novo CpG island methylation that is a frequent accompaniment of tumorigenesis and the establishment of cells in culture (10 , 11 , 14) .
Nonetheless, indirect evidence suggests that CpG island methylation is able to contribute to the repression of hTERT in certain cultured cell lines. The level of cytosine methylation of individual hTERT alleles in GM847 cells is consistent with the level of methylation implicated in the repression of the TIMP-3 gene (23) . Furthermore, the methylation-inhibitor 5-aza-C was able to induce expression of hTERT in GM847 cells and in U2OS cells that have partial methylation of the hTERT CpG island. 5-aza-C treatment did not induce hTERT expression in the HA-1 precrisis cell strain, which has an unmethylated hTERT CpG island. This argues against the possibility that the activity of 5-aza-C on DNA methylation at sites other than the hTERT CpG island was responsible for the activation of hTERT in GM847 and U2OS cells. Although our data suggest that DNA methylation can repress hTERT, the low level of 5-aza-C-induced expression in GM847 and U2OS cell lines indicates that additional transcriptional regulatory mechanisms in those cells prevent hTERT from attaining expression levels typical of telomerase-positive cell lines.
It is plausible that in cells with a high de novo DNA methylase activity, the hTERT CpG island is under continuous pressure to become increasingly methylated. Such a mechanism could explain the partial methylation we observed in some telomerase-positive cell lines and tumors. One possible consequence of such pressure would be the emergence of cell clones that have repressed the telomerase gene. This may explain the observation that subclones derived from the telomerase-positive 293 and HeLa cell lines were occasionally telomerase negative (24) . In cultured cells and tumor cells that depend on telomerase activity for continued proliferation, repression of the telomerase gene would lead to the loss of telomere maintenance and subsequent cell death. Such an effect could potentially slow the growth of tumor cell clones that express a high level of methylase activity, counteracting, in part, the detrimental effects of methylation of tumor suppressor gene CpG islands. We suggest that the analysis of the methylation patterns of hTERT CpG island alleles in telomerase-positive cell lines may help to delineate regulatory elements that are essential for the regulation of the telomerase gene.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by a Merck/MIT collaboration agreement
(to R. A. W.), NIH Grant T32 CA713452, the Lauri Strauss Leukemia
Foundation (to S. K. D.), and by a grant from the National Health and
Medical Research Council of Australia (to R. R. R.). ![]()
2 To whom requests for reprints should be
addressed, at The Whitehead Institute for Biomedical Research, 9
Cambridge Center, Cambridge, MA 02142. Phone: (617) 258-5158; Fax:
(617) 258-5213; E-mail: hickey{at}wi.mit.edu ![]()
3 The abbreviations used are:
hTERT, human telomerase; MSP, methylation-specific PCR;
RT-PCR; reverse transcriptase-PCR; 5-aza-C, 5-azacytidine; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase. ![]()
4 P. Steiner, personal communication. ![]()
5 P. Steiner and R. A.Weinberg, unpublished
data. ![]()
Received 9/ 7/99. Accepted 12/13/99.
| REFERENCES |
|---|
|
|
|---|
2/3) cancer-prone mouse. Cell, 97: 515-525, 1999.[Medline]
This article has been cited by other articles:
![]() |
B.-G. Jeon, G. Coppola, S. D Perrault, G.-J. Rho, D. H Betts, and W A. King S-adenosylhomocysteine treatment of adult female fibroblasts alters X-chromosome inactivation and improves in vitro embryo development after somatic cell nuclear transfer Reproduction, June 1, 2008; 135(6): 815 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
A P Moulin, G Clement, F T Bosman, L Zografos, and J Benhattar Methylation of CpG island promoters in uveal melanoma Br. J. Ophthalmol., February 1, 2008; 92(2): 281 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Oikonomou, I. Messinis, and A. Tsezou DNA Methylation Is Not Likely to Be Responsible for hTERT Expression in Premalignant Cervical Lesions Experimental Biology and Medicine, July 1, 2007; 232(7): 881 - 886. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Renaud, D. Loukinov, Z. Abdullaev, I. Guilleret, F. T. Bosman, V. Lobanenkov, and J. Benhattar Dual role of DNA methylation inside and outside of CTCF-binding regions in the transcriptional regulation of the telomerase hTERT gene Nucleic Acids Res., February 28, 2007; 35(4): 1245 - 1256. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang, C. Hu, and J. Zhu Transcriptional Silencing of a Novel hTERT Reporter Locus during In Vitro Differentiation of Mouse Embryonic Stem Cells Mol. Biol. Cell, February 1, 2007; 18(2): 669 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Zinn, K. Pruitt, S. Eguchi, S. B. Baylin, and J. G. Herman hTERT Is Expressed in Cancer Cell Lines Despite Promoter DNA Methylation by Preservation of Unmethylated DNA and Active Chromatin around the Transcription Start Site Cancer Res., January 1, 2007; 67(1): 194 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ohi, Y. Uehara, M. Takatsu, M. Watanabe, and T. Ono Hypermethylation of CpGs in the Promoter of the COL1A1 Gene in the Aged Periodontal Ligament. J. Dent. Res., March 1, 2006; 85(3): 245 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Quante, S. Heeg, A. von Werder, G. Goessel, C. Fulda, M. Doebele, H. Nakagawa, R. Beijersbergen, H. E. Blum, and O. G. Opitz Differential transcriptional regulation of human telomerase in a cellular model representing important genetic alterations in esophageal squamous carcinogenesis Carcinogenesis, November 1, 2005; 26(11): 1879 - 1889. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shevchuk, L. Kretzner, K. Munson, J. Axume, J. Clark, O. V. Dyachenko, M. Caudill, Y. Buryanov, and S. S. Smith Transgene-induced CCWGG methylation does not alter CG methylation patterning in human kidney cells Nucleic Acids Res., October 24, 2005; 33(19): 6124 - 6136. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Atkinson, S. F. Hoare, R. M. Glasspool, and W. N. Keith Lack of Telomerase Gene Expression in Alternative Lengthening of Telomere Cells Is Associated with Chromatin Remodeling of the hTR and hTERT Gene Promoters Cancer Res., September 1, 2005; 65(17): 7585 - 7590. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Kumakura, T. W. Tsutsui, J. Yagisawa, J. C. Barrett, and T. Tsutsui Reversible Conversion of Immortal Human Cells from Telomerase-Positive to Telomerase-Negative Cells Cancer Res., April 1, 2005; 65(7): 2778 - 2786. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gewin, H. Myers, T. Kiyono, and D. A. Galloway Identification of a novel telomerase repressor that interacts with the human papillomavirus type-16 E6/E6-AP complex Genes & Dev., September 15, 2004; 18(18): 2269 - 2282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Biroccio and C. Leonetti Telomerase as a new target for the treatment of hormone-refractory prostate cancer Endocr. Relat. Cancer, September 1, 2004; 11(3): 407 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Widschwendter, C. Gattringer, L. Ivarsson, H. Fiegl, A. Schneitter, A. Ramoni, H. M. Muller, A. Wiedemair, S. Jerabek, E. Muller-Holzner, et al. Analysis of Aberrant DNA Methylation and Human Papillomavirus DNA in Cervicovaginal Specimens to Detect Invasive Cervical Cancer and Its Precursors Clin. Cancer Res., May 15, 2004; 10(10): 3396 - 3400. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Horikawa and J. C. Barrett Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms Carcinogenesis, July 1, 2003; 24(7): 1167 - 1176. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang and J. Zhu Evidence for a Relief of Repression Mechanism for Activation of the Human Telomerase Reverse Transcriptase Promoter J. Biol. Chem., May 23, 2003; 278(21): 18842 - 18850. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Cong, W. E. Wright, and J. W. Shay Human Telomerase and Its Regulation Microbiol. Mol. Biol. Rev., September 1, 2002; 66(3): 407 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Mergny, J.-F. Riou, P. Mailliet, M.-P. Teulade-Fichou, and E. Gilson Natural and pharmacological regulation of telomerase Nucleic Acids Res., February 15, 2002; 30(4): 839 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nomoto, M. Maekawa, K. Sugano, M. Ushiama, N. Fukayama, S. Fujita, and T. Kakizoe Methylation Status and Expression of Human Telomerase Reverse Transcriptase mRNA in Relation to Hypermethylation of the p16 gene in Colorectal Cancers as Analyzed by Bisulfite PCR-SSCP Jpn. J. Clin. Oncol., January 1, 2002; 32(1): 3 - 8. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. J. Elenitoba-Johnson Complex Regulation of Telomerase Activity : Implications for Cancer Therapy Am. J. Pathol., August 1, 2001; 159(2): 405 - 410. [Full Text] |
||||
![]() |
J. F Costello and C. Plass Methylation matters J. Med. Genet., May 1, 2001; 38(5): 285 - 303. [Abstract] [Full Text] |
||||
![]() |
D. M. Loeb, E. Evron, C. B. Patel, P. M. Sharma, B. Niranjan, L. Buluwela, S. A. Weitzman, D. Korz, and S. Sukumar Wilms' Tumor Suppressor Gene (WT1) Is Expressed in Primary Breast Tumors Despite Tumor-specific Promoter Methylation Cancer Res., February 1, 2001; 61(3): 921 - 925. [Abstract] [Full Text] |
||||
![]() |
S. F. Hoare, L. A. Bryce, G. B. A. Wisman, S. Burns, J. J. Going, A. G. J. van der Zee, and W. N. Keith Lack of Telomerase RNA Gene hTERC Expression in Alternative Lengthening of Telomeres Cells Is Associated with Methylation of the hTERC Promoter Cancer Res., January 1, 2001; 61(1): 27 - 32. [Abstract] [Full Text] |
||||
![]() |
Y.-S. Cong and S. Bacchetti Histone Deacetylation Is Involved in the Transcriptional Repression of hTERT in Normal Human Cells J. Biol. Chem., November 10, 2000; 275(46): 35665 - 35668. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||