Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention  Joint Metastasis Research Society-AACR Conference on Metastasis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Cell Growth & Differentiation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dessain, S. K.
Right arrow Articles by Weinberg, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dessain, S. K.
Right arrow Articles by Weinberg, R. A.
[Cancer Research 60, 537-541, February 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Methylation of the Human Telomerase Gene CpG Island1

Scott K. Dessain, Hua-yin Yu, Roger R. Reddel, Roderick L. Beijersbergen and Robert A. Weinberg2

Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02142 [S. K. D., H-y. Y., R. A. W.]; Department of Hematology/Oncology, Massachusetts General Hospital, Boston, Massachusetts 02114 [S. K. D.]; Harvard Medical School, Boston, Massachusetts 02115 [S. K. D.]; Children’s Medical Research Institute, Westmead, N.S.W. 2145, Australia [R. R. R.]; and Netherlands Cancer Institute, 1066 CX Amsterdam, the Netherlands [R. L. B.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The acquisition of expression of hTERT, the catalytic subunit of the telomerase enzyme, seems to be an essential step in the development of a majority of human tumors. However, little is known about the mechanisms preventing telomerase gene expression in normal and transformed cells that do not express hTERT. Using a methylation-specific PCR-based assay, we have found that the CpG island associated with the hTERT gene is unmethylated in telomerase-negative primary tissues and nonimmortalized cultured cells, indicating that mechanisms independent of DNA methylation are sufficient to prevent hTERT expression. The hTERT CpG island is methylated in many telomerase-negative and telomerase-positive cultured cells and tumors, but the extent of methylation did not correlate with expression of hTERT. Demethylation of DNA with 5-azacytidine in two cell lines induced expression of hTERT, suggesting that DNA methylation can contribute to hTERT repression in some cells. Together, these data show that the hTERT CpG island can undergo cytosine methylation in cultured cells and tumors and that DNA methylation may contribute to the regulation of the hTERT gene, but that CpG island methylation is not responsible for repressing hTERT expression in most telomerase-negative cells.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cancer cells possess two fundamental traits, uncontrolled proliferation and immortality. Mutations in oncogenes and tumor suppressor genes provide cancer cells with the impetus for uncontrolled cell division, but a growing body of evidence suggests that replicative immortality through the maintenance of telomere length is also required for human cells to form tumors in vivo (1 , 2) . Between 85% and 90% of cancer cells maintain their telomere length through the expression of the telomerase holoenzyme, in contrast to most normal tissues that do not express the enzyme, and are, therefore, mortal (3) .

The activity of the telomerase holoenzyme is largely governed by the intracellular level of its catalytic subunit hTERT3 (4 , 5) . Little is known about the mechanisms regulating the expression of hTERT in normal and malignant cells. The hTERT promoter contains a high density of CpG dinucleotides that in aggregate define a typical CpG island–a DNA sequence that is a potential target for repression through DNA methylation (6, 7, 8) .4 Most CpG island sequences are unmethylated in normal cells, and protection from DNA methylation is necessary but not sufficient for gene transcription (9, 10, 11) .

The de novo methylation of CpG islands in postembryonic cells is associated with aging, the establishment of cells in culture, and tumorigenesis. In the colon, progressive DNA methylation that correlates with aging has been observed at the CpG islands of a number of genes, including the estrogen receptor gene (12 , 13) . Widespread CpG island methylation accompanies the establishment of nontransformed cells in culture (14) . In tumors, de novo CpG island methylation has been shown to repress the expression of the von Hippel-Lindau, retinoblastoma, and p16 tumor suppressor genes, among others (9, 10, 11) . A phenotype of extensive de novo CpG island methylation has been identified in colon cancers that appear to cause, among other things, the repression of the hMLH1 gene, which in turn may contribute to microsatellite instability and tumor progression (13 , 15) .

Because the expression of telomerase catalytic activity can be an important contributor to malignant transformation in human cells (1 , 2) , we reasoned that mechanisms leading to the repression of hTERT could have a potential tumor suppressor function. Consequently, we sought to determine whether the CpG island of the telomerase gene is a potential target for repression by DNA methylation.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Bisulfite Treatment of DNA (16) .
Approximately 1 µg of genomic DNA was digested with PstI in 10 µl and then denatured in 0.3 M NaOH at 37°C for 10 min. Six microliters of 10 mM hydroquinone (Sigma Chemical Co.) and 104 µl of 3 M sodium bisulfite (Sigma Chemical Co.; both freshly mixed) were added. The samples were treated with 20 cycles of 95°C for 30 s, 50°C for 15 min, followed by 10 h at 50°C. The DNA was purified using the Qiaquick gel extraction kit (Qiagen) according to the manufacturer’s protocol. The eluted samples were incubated in 0.3 M NaOH for 5 min at 20°C, ethanol precipitated, washed in 70% ethanol, and resuspended in 10 µl of H2O. DNA (1.5 µl) was used in each PCR reaction. Methylation-specific primers were: 5' primer set, specific for unmethylated DNA: forward primer: 5'-GTGGGTATAGATGTTTAGGATTG T-3'; reverse primer: 5'-CCACATACACAACAAAACACAACA-3'. 5' primer set, specific for methylated DNA: forward primer: 5'-GGGTATAGACGTTTAGGATCGC-3'; reverse primer: 5'-CGTACGCAACAAAACGCAACG-3'. 3' primer set, specific for unmethylated DNA: forward primer: 5'-AGTTTTGGTTTTGGTTATTTTTGT-3'; reverse primer: 5'-AAACACTAAACCACCAACACA-3'. 3' primer set, specific for methylated DNA: forward primer: 5'- AGTTTTGGTTTCGGTTATTTTCGC-3'; reverse primer: 5'- CAAACACTAAACCACCAACGCG-3'.

Methylation-specific PCR.
PCR reactions were performed in 25 µl, using published conditions (16) and 1.25 units of Taq Polymerase (Perkin-Elmer Corp.) complexed with TaqStart antibody (Clontech). Reactions were assembled on ice and hot-started at 95°C for 5 min, followed by PCR: 10 cycles of 95°C for 30 s; 70°C for 30 s (decreasing by 1°C with each cycle); and 72°C for 30 s. This was followed by 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, and concluded at 72°C for 600 s. Reactions were analyzed on ethidium bromide-stained 2.5% agarose gels in 1x Tris-borate EDTA buffer.

RT-PCR for hTERT mRNA.
Total RNA (5 µg) was used in a cDNA synthesis reaction using the First-strand cDNA synthesis kit (Pharmacia), with the reverse hTERT and GAPDH primers, each at 2 mM. PCR reactions were run in standard conditions with 2.5 units of Taq Polymerase (Perkin-Elmer Corp.) complexed with Taq Start antibody (Clontech) and 32P-labeled forward primers. cDNA (5 µl) was used in the hTERT reactions; one microliter of a 1:400 dilution of the cDNA was used in the GAPDH reactions. PCR reactions were cycled 25 times: 94°C for 30 s, 60°C for 30 s, 72°C for 30 s. Ten microliters of each reaction were analyzed with 8% PAGE, 1x Tris-borate EDTA. hTERT primers were: LT5 forward (CGGAAGAGTGTCTGGAGCAA) and LT6 reverse (LT6GGATGAAGCGGAGTCTGGA; Ref. 17 ). GAPDH primers were: GAPDH1 forward (GACCCCTTCATTGACCTCAAC) and GAPDH2 reverse primer (CTTCTCCATGGTGGTGAAGA).

Sequencing of MSP Products.
MSP products were subcloned into plasmid vectors using the Topo TA cloning kit (Invitrogen), following the manufacturer’s instructions. Plasmid DNAs were purified using the Wizard Plus miniprep kit (Promega), and then sequenced by Research Genetics (Huntsville, AL).

Cell Culture.
Cultured cells were maintained in standard conditions in DME with 10% heat-inactivated fetal bovine serum. For 5-aza-C treatment, cells were incubated in MEM{alpha} with 10 µM 5-aza-C for 24 h on day 1 and day 4, and then harvested on day 7 for analysis (15) . Total cell RNA was prepared using RNAzol (Tel-Test).


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The telomerase gene has a typical CpG island domain overlying putative transcription start site and a number of potential transcriptional regulatory sequences (6, 7, 8) . On the basis of the quantitative criteria proposed by Antequera and Bird (18) , this CpG island is from 654 bp upstream of the putative transcription start site (6) to 510 bp downstream of the transcription start site, ending 56 bp after the start of the first intron (6, 7, 8 , 18) .5 Within this region, the DNA has a GC content of 74% and a CG:GC ratio of 0.87.

The MSP technique we have used to determine the methylation state of the hTERT CpG island is based on the observation that sodium bisulfite treatment of DNA converts cytosines into uridines and that this reaction is strongly inhibited when cytosines are methylated (19) . DNA that has been treated with sodium bisulfite, therefore, retains only methylated cytosines, and can subsequently be tested with PCR primers that amplify specifically either modified or unmodified DNA (16) . We generated PCR primers that distinguish between bisulfite-modified and -unmodified cytosines in the hTERT CpG island. For this study, we chose primer sets to assay the methylation state of the transcription start site, as well as regions 3' to the translation start site that are near the first intron and which may contribute to hTERT activation (Refs. 6, 7, 8 ; Fig. 1aCitation ).5 Primer sets generated to test sequences near the 5' boundary of the hTERT CpG island revealed complete DNA methylation in most of the cell lines and tumors examined, independent of the state of expression of the hTERT gene, suggesting that methylation at the extreme 5' end of the CpG island does not play a significant role in hTERT regulation (data not shown). Additional primer pairs at ~300 and 140 bp upstream of the transcription start site yielded results that correlated closely with the results described below for the 5' primer pairs (data not shown) and, therefore, will not be discussed further.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. MSP of the hTERT gene CpG island. a, map of the hTERT promoter, depicting the CpG island, the transcription start site (TS; Ref. 6 ), the translation start site (ATG), and the location of the methylation-specific oligonucleotides. In the 5' primer pairs, the forward primers overlie the transcription start site and are upstream of the 5' E-box, and the reverse primers overlie the 3' E-box (6 7 8) .5 The forward primers of the 3' set hybridize upstream of the ATG codon. Primer pairs that analyze sequences approximately 140 and 300 bp upstream of the transcription start site gave essentially the same results as the 5' primer set depicted here (data not shown). b, control MSP using plasmid DNA containing the hTERT promoter. The 5' and 3' primer pairs with specificity for unmethylated (Un) or methylated (Meth) hTERT CpG island sequences were tested on Sss I methylated (+) or Sss I unmethylated (-) hTERT plasmid DNA. Each primer pair amplifies only methylated or unmethylated hTERT DNA.

 
To establish the specificity of our PCR primers, we used hTERT promoter plasmid DNA before and after treatment with Sss I DNA methylase as controls. This enzyme methylates all CpG cytosines. As shown in Fig. 1bCitation , each primer set generated a PCR product specifically with either methylated or unmethylated control DNA. None of the sets generated a product with plasmid DNA that had not been treated with bisulfite (data not shown), indicating that DNA that has been incompletely treated with sodium bisulfite was unlikely to be amplified by primer sets specific for methylated sequences and, therefore, inadvertently interpreted as being methylated.

We sought to establish whether telomerase-negative cells have hTERT CpG island methylation that might underlie the absence of hTERT expression in these cells. To do so, we tested DNA prepared from a series of primary, mortal cell strains and immortal cell lines. As shown in Fig. 2aCitation , the hTERT CpG island is unmethylated in the WI38 cell strain (primary fibroblasts), the HA-1 precrisis cell strain (mortal, SV40 large T-transformed embryonic kidney cells), and the JFCF-6T/5K precrisis cell strain (mortal, SV40 large T-transformed fibroblasts), all of which are telomerase negative as judged by the highly sensitive TRAP assay (Ref. 20 ; data not shown). We observed identical results with DNA prepared from IMR90 and BJ primary fibroblast cells (data not shown), which are also telomerase negative.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2. MSP of the human hTERT CpG island in cultured cells. Genomic DNA was tested with 5' and 3' primer sets specific for either unmethylated (U) or methylated (M) hTERT CpG island DNA. a, telomerase-negative cells: WI38, primary fibroblasts; HA-1 pre, mortal SV40 large T transformed primary embryonic kidney cells; JFCF-6T/5K, mortal SV40 large T-transformed primary fibroblasts; U2OS, immortal osteosarcoma cells; GM847 and VA13, immortal SV40 large T-transformed human fibroblasts. b, telomerase-positive cell lines. HA-1 post, immortalized postcrisis HA-1 cells (SV40 large T transformed primary embryonic kidney cells); JFCF 6T/1J.6B, immortalized postcrisis SV40 large T-transformed fibroblast cells; 293, immortalized adenovirus-transformed human embryonic kidney cells; HT29and SW480, colon carcinoma cells; HeLa, cervical carcinoma cells.

 
In contrast, three immortalized telomerase-negative cell lines that use an alternative mechanism for lengthening telomeres (ALT) (21) , showed hTERT CpG island methylation (Fig. 2a)Citation . The U2OS osteosarcoma cell line has partial methylation of its hTERT CpG island, and the immortal fibroblast lines GM847 and VA13 have complete methylation. These results indicate that hTERT CpG island is subject to DNA methylation in cultured cells, but that DNA methylation is not a requirement for repression of the telomerase gene in telomerase-negative cells. In addition, the lack of CpG island methylation in the primary cell fibroblasts suggests that hTERT is not an imprinted gene.

To determine whether the inhibition of DNA methylation could induce hTERT expression in cells with methylated hTERT loci, we treated GM847, U2OS, and VA13 cells with the DNA-methylation inhibitor 5-aza-C (22) . Treatment of GM847 cells with 5-aza-C induced transcription of hTERT that was detectable with RT-PCR (Fig. 3a)Citation . Similarly, 5-aza-C treatment of U2OS cells reproducibly increased a low level of hTERT transcription by 2–3-fold. The VA13 cell line did not induce hTERT expression with 5-aza-C treatment despite having substantial CpG island methylation (data not shown). As a negative control, we treated the HA-1 precrisis cell line with 5-aza-C, which is telomerase negative but does not have a methylated hTERT CpG island. As expected, hTERT was not induced. The levels of mRNA induced by 5-aza-C in U2OS and GM847 cells were much lower than in telomerase-positive HA-1 postcrisis cells, and telomerase catalytic activity could not be detected in the 5-aza-C-treated GM847 or U2OS cells using the TRAP assay (Ref. 20 ; data not shown). Taken together, these data indicate that DNA methylation of the hTERT CpG island can contribute to repression the hTERT gene, but that additional regulatory mechanisms operate to limit hTERT expression in U2OS and GM847 cells, and to prevent hTERT expression in VA13 and HA-1 cells.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Induction of hTERT gene expression by 5-aza-C and extent of methylation of the GM847 CpG island. a, cells were treated with 10 µM 5-aza-C on days 1 and 4 and analyzed on day 7 for hTERT gene expression using RT-PCR. The autoradiographs are overexposed to show the induced hTERT expression; the RT-PCR assay was designed to be linear for hTERT and GAPDH mRNA concentrations close to those in the telomerase-positive HA-1 postcrisis cell line (data not shown). No RT, a control reaction without reverse transcriptase; BJ, a telomerase-negative primary fibroblast cell strain; H20, a water-only control; GM847, untreated; G+aza, 5-aza-C-treated GM847 cells; HA-1, untreated; H+aza, 5-aza-C-treated HA-1 cells; U2OS, untreated; U+aza, 5-aza-C-treated U2OS cells. b, GM847 MSP products were subcloned into plasmid vectors, and individual subclones were sequenced. The locations of the CpG sites are given in reference to the transcription start site. •, methylation; {circ}, no methylation. Each row represents one sequenced allele. Placenta DNA (Plac) was sequenced as a control for the bisulfite reaction. Coordinates are given relative to the putative transcription start site (Ref. 6 ). The black bar denotes a cluster of CpG cytosines that are hypomethylated in GM847 cells.

 
The MSP technique used here only allowed us to assess the methylation state of the hTERT genomic sequences represented in the primers themselves. We wished additionally to determine the state of methylation of the 42 CpG cytosines that lie between our MSP primer pairs. To do so, we subcloned and sequenced MSP products from bisulfite-treated GM847 DNA (Fig. 3)Citation . Because we observed only methylation-specific products with the GM847 cell DNA, we concluded that use of these methylation-specific primers to amplify GM847 DNA would enable us to survey all hTERT gene copies carried by these cells. For comparison, and as a positive control for the completeness of the bisulfite modification, we analyzed human placenta DNA, which has an unmethylated hTERT CpG island (data not shown). This sequencing revealed that most of the 42 CpG cytosines in the hTERT CpG island of GM847 cells are methylated, with the exception of a cluster of 5 CpGs that were largely unmethylated and lie between +71 and +152 bp downstream of the transcription start site. Analysis of the placenta control DNA revealed a virtually complete conversion of cytosines to uridines, indicating effective bisulfite treatment and a lack of cytosine methylation. The extent of hTERT CpG island methylation in GM847 cells is similar to the extent of methylation described by others as being responsible for the repression of the gene encoding tissue inhibitor of metalloproteinase-3 (TIMP-3) (23) . Hence, this level of methylation may account, on its own, for the absence of hTERT expression in these cells, explaining thereby the inducibility of hTERT expression upon 5-aza-C treatment.

In general, CpG island methylation correlates inversely with gene expression (9, 10, 11) . We, therefore, expected that the hTERT CpG islands of telomerase-positive cell lines would not be methylated. The telomerase-positive postcrisis HA-1 embryonic kidney and the JFCF-6T/1J.6B fibroblast cell lines both revealed unmethylated hTERT loci (Fig. 2b)Citation . However, we observed partial methylation of the hTERT CpG island in the 293 human embryonic kidney cell line, the HeLa cervical carcinoma cell line, and the SW480 and HT29 colon carcinoma cell lines, all of which are strongly telomerase positive (Fig. 2b)Citation . Specifically, all four lines revealed DNA methylation with the 5' primer set (specific for the transcription start site), with the HeLa and SW480 cells also exhibiting partial methylation with the 3' primer set (downstream of the translation start site). Partial methylation did not correlate with the level of hTERT mRNA expression because the 293 cells have steady-state hTERT mRNA levels 8-fold greater than HA-1 postcrisis cells (data not shown). These results indicate that partial hTERT CpG island methylation can exist in telomerase-positive cells and is not inhibitory of telomerase gene expression.

The de novo methylation of CpG islands is a frequent accompaniment to malignant transformation (9, 10, 11) . We, therefore, sought to evaluate whether hTERT CpG island methylation occurs during tumorigenesis and is a feature of telomerase-negative tumors. We used MSP to test for a correlation between hTERT CpG island methylation and telomerase expression in a series of primary tumor and normal control tissues (Fig. 4)Citation . A telomerase-negative adrenal carcinoma (Adrenal ALT), that has the telomere length pattern characteristic of all telomerase-negative, immortalized human cells studied to date (21) , exhibited no hTERT CpG island methylation, as did the telomerase-positive CT1485 colon carcinoma (Fig. 4)Citation . A telomerase-negative breast carcinoma (Breast ALT) (21) and a telomerase-negative colon carcinoma (Co1310) both revealed partial CpG island methylation. However, the extent of methylation, as indicated by the pattern of primer pairs that amplified the bisulfite-treated DNA, was identical to that seen in the telomerase-positive Br1958 and Co1229 carcinomas, respectively. In accord with the observations made with telomerase-negative cell lines, these results do not reveal a correlation between telomerase-expression and hTERT CpG island methylation in tumors. Furthermore, they reveal that methylation of the hTERT CpG island is not a prerequisite for the telomerase-negative phenotype in tumors.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. MSP of primary human tissues, depicted as in Fig. 2Citation . The telomerase expression of each of the samples is indicated by a + or - suffix. In the left column are data from telomerase-negative tumors from the adrenal gland (Adrenal ALT) and breast (Breast ALT) that both have the characteristic phenotype of cells that use the alternate mechanism of telomere maintenance (Ref. 21 ), and a telomerase-positive breast carcinoma (BT1958). The middle and right columns depict data from paired normal and tumor DNAs taken from the same surgical specimens. CN1483 and CN1231 are normal, telomerase-negative colon tissues that correspond to the telomerase-positive colon tumors positive CT1485 and CT1229, respectively. CN1312is a telomerase-negative normal colon sample that corresponds to the telomerase-negative colon carcinoma CT1310.

 
For three of the tumor DNAs that we examined we obtained normal control tissues taken from the surgical margins of the tumors. All three were telomerase-negative and showed no hTERT CpG island methylation. This indicates that methylation of the hTERT CpG island is not a feature of the telomerase-negative state in normal colon tissues and suggests that the partial methylation we observed in the tumor DNAs occurred de novo during tumorigenesis.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Using the MSP technique, we have found that the hTERT CpG island is unmethylated in normal tissues and in nonimmortalized mortal, telomerase-negative cell strains. This indicates that hTERT is not an imprinted gene and that mechanisms operating independently of DNA methylation are sufficient to prevent hTERT expression in most telomerase-negative cells. Such mechanisms could include the absence of positively acting transcription factors or the presence of active repressors of hTERT transcription.

In contrast to normal and primary tissues, we found that the hTERT CpG island is methylated in a variety of primary tumor tissues and cultured cells. However, both telomerase-positive and telomerase-negative cell lines and tumors exhibited partial methylation of their hTERT CpG islands, and we observed no correlation between the degree of methylation and telomerase activity. Therefore, hTERT CpG island methylation is unlikely to play a substantial role in the regulation of hTERT in vivo, and the CpG island methylation we observed likely reflects the de novo CpG island methylation that is a frequent accompaniment of tumorigenesis and the establishment of cells in culture (10 , 11 , 14) .

Nonetheless, indirect evidence suggests that CpG island methylation is able to contribute to the repression of hTERT in certain cultured cell lines. The level of cytosine methylation of individual hTERT alleles in GM847 cells is consistent with the level of methylation implicated in the repression of the TIMP-3 gene (23) . Furthermore, the methylation-inhibitor 5-aza-C was able to induce expression of hTERT in GM847 cells and in U2OS cells that have partial methylation of the hTERT CpG island. 5-aza-C treatment did not induce hTERT expression in the HA-1 precrisis cell strain, which has an unmethylated hTERT CpG island. This argues against the possibility that the activity of 5-aza-C on DNA methylation at sites other than the hTERT CpG island was responsible for the activation of hTERT in GM847 and U2OS cells. Although our data suggest that DNA methylation can repress hTERT, the low level of 5-aza-C-induced expression in GM847 and U2OS cell lines indicates that additional transcriptional regulatory mechanisms in those cells prevent hTERT from attaining expression levels typical of telomerase-positive cell lines.

It is plausible that in cells with a high de novo DNA methylase activity, the hTERT CpG island is under continuous pressure to become increasingly methylated. Such a mechanism could explain the partial methylation we observed in some telomerase-positive cell lines and tumors. One possible consequence of such pressure would be the emergence of cell clones that have repressed the telomerase gene. This may explain the observation that subclones derived from the telomerase-positive 293 and HeLa cell lines were occasionally telomerase negative (24) . In cultured cells and tumor cells that depend on telomerase activity for continued proliferation, repression of the telomerase gene would lead to the loss of telomere maintenance and subsequent cell death. Such an effect could potentially slow the growth of tumor cell clones that express a high level of methylase activity, counteracting, in part, the detrimental effects of methylation of tumor suppressor gene CpG islands. We suggest that the analysis of the methylation patterns of hTERT CpG island alleles in telomerase-positive cell lines may help to delineate regulatory elements that are essential for the regulation of the telomerase gene.


    ACKNOWLEDGMENTS
 
We thank Drs. Laurie Jackson-Grusby, James Herman, Lisa Spirio, and Michael Powers for helpful discussions. We also thank Brain Elenbaas, William Hahn, Sheila Stewart, and Randolph Watnick for critical reading of the manuscript. We thank the Massachusetts General Hospital Tumor Bank, Mohammed Miri, and Dr. Francis Haluska for providing tumor samples.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by a Merck/MIT collaboration agreement (to R. A. W.), NIH Grant T32 CA713452, the Lauri Strauss Leukemia Foundation (to S. K. D.), and by a grant from the National Health and Medical Research Council of Australia (to R. R. R.). Back

2 To whom requests for reprints should be addressed, at The Whitehead Institute for Biomedical Research, 9 Cambridge Center, Cambridge, MA 02142. Phone: (617) 258-5158; Fax: (617) 258-5213; E-mail: hickey{at}wi.mit.edu Back

3 The abbreviations used are: hTERT, human telomerase; MSP, methylation-specific PCR; RT-PCR; reverse transcriptase-PCR; 5-aza-C, 5-azacytidine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back

4 P. Steiner, personal communication. Back

5 P. Steiner and R. A.Weinberg, unpublished data. Back

Received 9/ 7/99. Accepted 12/13/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Hahn W. C., Counter C. M., Lundberg A. S., Beijersbergen R. L., Brooks M. W., Weinberg R. A. Creation of human tumour cells with defined genetic elements. Nature (Lond.), 400: 464-468, 1999.[Medline]
  2. Greenberg R. A., Chin L., Femino A., Lee K. H., Gottlieb G. J., Singer R. H., Greider C. W., DePinho R. A. Short dysfunctional telomeres impair tumorigenesis in the INK4a({Delta}2/3) cancer-prone mouse. Cell, 97: 515-525, 1999.[Medline]
  3. Shay J. W., Bacchetti S. A survey of telomerase activity in human cancer, Eur. J. Cancer, 33: 787-791, 1997.
  4. Counter C. M., Meyerson M., Eaton E. N., Ellisen L. W., Caddle S. D., Haber D. A., Weinberg R. A. Telomerase activity is restored in human cells by ectopic expression of hTERT (hEST2), the catalytic subunit of telomerase. Oncogene, 16: 1217-1222, 1998.[Medline]
  5. Weinrich S. L., Pruzan R., Ma L., Ouellette M., Tesmer V. M., Holt S. E., Bodnar A. G., Lichtsteiner S., Kim N. W., Trager J. B., Taylor R. D., Carlos R., Andrews W. H., Wright W. E., Shay J. W., Harley C. B., Morin G. B. Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nat. Genet., 17: 498-502, 1997.[Medline]
  6. Horikawa I., Cable P. L., Afshari C., Barrett J. C. Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res., 59: 826-830, 1999.[Abstract/Free Full Text]
  7. Cong Y. S., Wen J., Bacchetti S. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter [In Process Citation]. Hum. Mol. Genet., 8: 137-142, 1999.[Abstract/Free Full Text]
  8. Takakura M., Kyo S., Kanaya T., Hirano H., Takeda J., Yutsudo M., Inoue M. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res., 59: 551-557, 1999.[Abstract/Free Full Text]
  9. Jones P. A., Laird P. W. Cancer epigenetics comes of age. Nat. Genet., 21: 163-167, 1999.[Medline]
  10. Laird P. W., Jaenisch R. The role of DNA methylation in cancer genetic and epigenetics. Annu. Rev. Genet., 30: 441-464, 1996.[Medline]
  11. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
  12. Ahuja N., Li Q., Mohan A. L., Baylin S. B., Issa J. P. Aging, and DNA methylation in colorectal mucosa and cancer. Cancer Res., 58: 5489-5494, 1998.[Abstract/Free Full Text]
  13. Toyota M., Ahuja N., Ohe-Toyota M., Herman J. G., Baylin S. B., Issa J. P. CpG island methylator phenotype in colorectal cancer. Proc. Natl. Acad. Sci. USA, 96: 8681-8686, 1999.[Abstract/Free Full Text]
  14. Antequera F., Boyes J., Bird A. High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines. Cell, 62: 503-514, 1990.[Medline]
  15. Veigl M. L., Kasturi L., Olechnowicz J., Ma A. H., Lutterbaugh J. D., Periyasamy S., Li G. M., Drummond J., Modrich P. L., Sedwick W. D., Markowitz S. D. Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers. Proc. Natl. Acad. Sci. USA, 95: 8698-8702, 1998.[Abstract/Free Full Text]
  16. Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation-specific PCR. a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826, 1996.[Abstract/Free Full Text]
  17. Nakamura T. M., Morin G. B., Chapman K. B., Weinrich S. L., Andrews W. H., Lingner J., Harley C. B., Cech T. R. Telomerase catalytic subunit homologs from fission yeast and human. Science (Washington DC), 77: 955-959, 1997.
  18. Antequera F., Bird A. Number of CpG islands and genes in human and mouse. Proc. Natl. Acad. Sci. USA, 90: 11995-11999, 1993.[Abstract/Free Full Text]
  19. Wang R. Y., Gehrke C. W., Ehrlich M. Comparison of bisulfite modification of 5-methyldeoxycytidine and deoxycytidine residues. Nucleic Acids Res., 8: 4777-4790, 1980.[Abstract/Free Full Text]
  20. Bryan T. M., Englezou A., Dalla-Pozza L., Dunham M. A., Reddel R. R. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat. Med., 3: 1271-1274, 1997.[Medline]
  21. Jones P. A., Taylor S. M. Cellular differentiation, cytidine analogs and DNA methylation. Cell, 20: 85-93, 1980.[Medline]
  22. Kim N. W., Wu F. Advances in quantification and characterization of telomerase activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res., 25: 2595-2597, 1997.[Abstract/Free Full Text]
  23. Bachman K. E., Herman J. G., Corn P. G., Merlo A., Costello J. F., Cavenee W. K., Baylin S. B., Graff J. R. Methylation-associated silencing of the tissue inhibitor of metalloproteinase-3 gene suggest a suppressor role in kidney, brain, and other human cancers. Cancer Res., 59: 798-802, 1999.[Abstract/Free Full Text]
  24. Bryan T. M., Englezou A., Dunham M. A., Reddel R. R. Telomere length dynamics in telomerase-positive immortal human cell populations. Exp. Cell Res., 239: 370-378, 1998.[Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
B.-G. Jeon, G. Coppola, S. D Perrault, G.-J. Rho, D. H Betts, and W A. King
S-adenosylhomocysteine treatment of adult female fibroblasts alters X-chromosome inactivation and improves in vitro embryo development after somatic cell nuclear transfer
Reproduction, June 1, 2008; 135(6): 815 - 828.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
A P Moulin, G Clement, F T Bosman, L Zografos, and J Benhattar
Methylation of CpG island promoters in uveal melanoma
Br. J. Ophthalmol., February 1, 2008; 92(2): 281 - 285.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
P. Oikonomou, I. Messinis, and A. Tsezou
DNA Methylation Is Not Likely to Be Responsible for hTERT Expression in Premalignant Cervical Lesions
Experimental Biology and Medicine, July 1, 2007; 232(7): 881 - 886.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Renaud, D. Loukinov, Z. Abdullaev, I. Guilleret, F. T. Bosman, V. Lobanenkov, and J. Benhattar
Dual role of DNA methylation inside and outside of CTCF-binding regions in the transcriptional regulation of the telomerase hTERT gene
Nucleic Acids Res., February 28, 2007; 35(4): 1245 - 1256.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Wang, C. Hu, and J. Zhu
Transcriptional Silencing of a Novel hTERT Reporter Locus during In Vitro Differentiation of Mouse Embryonic Stem Cells
Mol. Biol. Cell, February 1, 2007; 18(2): 669 - 677.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. L. Zinn, K. Pruitt, S. Eguchi, S. B. Baylin, and J. G. Herman
hTERT Is Expressed in Cancer Cell Lines Despite Promoter DNA Methylation by Preservation of Unmethylated DNA and Active Chromatin around the Transcription Start Site
Cancer Res., January 1, 2007; 67(1): 194 - 201.
[Abstract] [Full Text] [PDF]


Home page
J. Dent. Res.Home page
T. Ohi, Y. Uehara, M. Takatsu, M. Watanabe, and T. Ono
Hypermethylation of CpGs in the Promoter of the COL1A1 Gene in the Aged Periodontal Ligament.
J. Dent. Res., March 1, 2006; 85(3): 245 - 250.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Quante, S. Heeg, A. von Werder, G. Goessel, C. Fulda, M. Doebele, H. Nakagawa, R. Beijersbergen, H. E. Blum, and O. G. Opitz
Differential transcriptional regulation of human telomerase in a cellular model representing important genetic alterations in esophageal squamous carcinogenesis
Carcinogenesis, November 1, 2005; 26(11): 1879 - 1889.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Shevchuk, L. Kretzner, K. Munson, J. Axume, J. Clark, O. V. Dyachenko, M. Caudill, Y. Buryanov, and S. S. Smith
Transgene-induced CCWGG methylation does not alter CG methylation patterning in human kidney cells
Nucleic Acids Res., October 24, 2005; 33(19): 6124 - 6136.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. P. Atkinson, S. F. Hoare, R. M. Glasspool, and W. N. Keith
Lack of Telomerase Gene Expression in Alternative Lengthening of Telomere Cells Is Associated with Chromatin Remodeling of the hTR and hTERT Gene Promoters
Cancer Res., September 1, 2005; 65(17): 7585 - 7590.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S.-i. Kumakura, T. W. Tsutsui, J. Yagisawa, J. C. Barrett, and T. Tsutsui
Reversible Conversion of Immortal Human Cells from Telomerase-Positive to Telomerase-Negative Cells
Cancer Res., April 1, 2005; 65(7): 2778 - 2786.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L. Gewin, H. Myers, T. Kiyono, and D. A. Galloway
Identification of a novel telomerase repressor that interacts with the human papillomavirus type-16 E6/E6-AP complex
Genes & Dev., September 15, 2004; 18(18): 2269 - 2282.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A. Biroccio and C. Leonetti
Telomerase as a new target for the treatment of hormone-refractory prostate cancer
Endocr. Relat. Cancer, September 1, 2004; 11(3): 407 - 421.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Widschwendter, C. Gattringer, L. Ivarsson, H. Fiegl, A. Schneitter, A. Ramoni, H. M. Muller, A. Wiedemair, S. Jerabek, E. Muller-Holzner, et al.
Analysis of Aberrant DNA Methylation and Human Papillomavirus DNA in Cervicovaginal Specimens to Detect Invasive Cervical Cancer and Its Precursors
Clin. Cancer Res., May 15, 2004; 10(10): 3396 - 3400.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
I. Horikawa and J. C. Barrett
Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms
Carcinogenesis, July 1, 2003; 24(7): 1167 - 1176.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Wang and J. Zhu
Evidence for a Relief of Repression Mechanism for Activation of the Human Telomerase Reverse Transcriptase Promoter
J. Biol. Chem., May 23, 2003; 278(21): 18842 - 18850.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
Y.-S. Cong, W. E. Wright, and J. W. Shay
Human Telomerase and Its Regulation
Microbiol. Mol. Biol. Rev., September 1, 2002; 66(3): 407 - 425.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J.-L. Mergny, J.-F. Riou, P. Mailliet, M.-P. Teulade-Fichou, and E. Gilson
Natural and pharmacological regulation of telomerase
Nucleic Acids Res., February 15, 2002; 30(4): 839 - 865.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
K. Nomoto, M. Maekawa, K. Sugano, M. Ushiama, N. Fukayama, S. Fujita, and T. Kakizoe
Methylation Status and Expression of Human Telomerase Reverse Transcriptase mRNA in Relation to Hypermethylation of the p16 gene in Colorectal Cancers as Analyzed by Bisulfite PCR-SSCP
Jpn. J. Clin. Oncol., January 1, 2002; 32(1): 3 - 8.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. S. J. Elenitoba-Johnson
Complex Regulation of Telomerase Activity : Implications for Cancer Therapy
Am. J. Pathol., August 1, 2001; 159(2): 405 - 410.
[Full Text]


Home page
J. Med. Genet.Home page
J. F Costello and C. Plass
Methylation matters
J. Med. Genet., May 1, 2001; 38(5): 285 - 303.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
D. M. Loeb, E. Evron, C. B. Patel, P. M. Sharma, B. Niranjan, L. Buluwela, S. A. Weitzman, D. Korz, and S. Sukumar
Wilms' Tumor Suppressor Gene (WT1) Is Expressed in Primary Breast Tumors Despite Tumor-specific Promoter Methylation
Cancer Res., February 1, 2001; 61(3): 921 - 925.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
S. F. Hoare, L. A. Bryce, G. B. A. Wisman, S. Burns, J. J. Going, A. G. J. van der Zee, and W. N. Keith
Lack of Telomerase RNA Gene hTERC Expression in Alternative Lengthening of Telomeres Cells Is Associated with Methylation of the hTERC Promoter
Cancer Res., January 1, 2001; 61(1): 27 - 32.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y.-S. Cong and S. Bacchetti
Histone Deacetylation Is Involved in the Transcriptional Repression of hTERT in Normal Human Cells
J. Biol. Chem., November 10, 2000; 275(46): 35665 - 35668.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dessain, S. K.
Right arrow Articles by Weinberg, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dessain, S. K.
Right arrow Articles by Weinberg, R. A.