Cancer Research Annual Meeting 2010 Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, L.-C.
Right arrow Articles by Dahiya, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, L.-C.
Right arrow Articles by Dahiya, R.
[Cancer Research 60, 702-706, February 1, 2000]
© 2000 American Association for Cancer Research

Regular Articles

Frequent Methylation of Estrogen Receptor in Prostate Cancer: Correlation with Tumor Progression1

Long-Cheng Li, Richard Chui, Koichi Nakajima, Bong Ryoul Oh, Harry C. Au and Rajvir Dahiya2

Department of Urology, Veterans Affairs Medical Center, and University of California–San Francisco, San Francisco, California 94121


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prior studies have shown that the estrogen receptor (ER) gene is down-regulated in prostate cancer, but the mechanism of its inactivation is not known. We hypothesize that inactivation of the ER gene in prostate cancer is through promoter methylation. To test this hypothesis, we investigated the methylation status of the ER gene in prostate cancer cell lines, prostate cancer, and benign prostatic hyperplasia (BPH) tissues samples using the bisulfite genomic sequencing method. Our results show that the ER gene promoter was methylated in 100% (six of six) of the prostate cancer cell lines tested and all were accompanied by loss of ER mRNA expression. Treatment of these cell lines with demethylating agent 5-aza-2'-deoxycytidine restored ER mRNA expression in all of the ER-negative cell lines. In addition, elevated expression of DNA methyltransferase mRNA was found in all of the prostate cancer cell lines. Of the prostate tissue samples analyzed, 60% (6 of 10) in the BPH samples, 80% (8 of 10) in the low-grade cancer samples (grades I and II), and 95% (20 of 21) in the high-grade cancer samples (grades III-V) exhibited promoter methylation of the ER gene. The overall methylation levels in the cancer samples were higher than that in the BPH samples. The differences between the high-grade cancer samples and BPH samples were significant at all CpG sites. Only at three CpG sites were the differences significant between the low-grade cancer samples and BPH samples. This study presents the first evidence that ER gene is transcriptionally inactivated by DNA methylation in prostate cancer. Our data suggest that ER may be involved in the pathogenesis of prostate cancer, as well as BPH.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During the past 50 years, estrogen has been used for the treatment of prostate cancer. Palliative, although not curative, effects have been widely acknowledged (1) . It is generally believed that the favorable response to estrogen therapy in hormone-sensitive prostate cancer is mediated primarily via suppression of the hypothalmo-hypophyseal axis, thus reducing the circulating androgens. Mangan et al. (2) have proposed a direct action of estrogen on prostate, presumably via the ER.3 This hypothesis is also supported by several other investigators (3 , 4) ; however, the functional role of estrogenic steroids and ER in the prostate is not clear. In recent years, with the demonstration of ER in normal, hyperplastic, and cancerous prostate tissue (5 , 6) and of stimulating or inhibitory effects of estrogen on in vitro growth of prostate cancer cells (7 , 8) , evidence began to accumulate that estrogen may exert direct effects on prostate via its own receptor.

The ER gene is located on chromosome 6q25.1 (9) and belongs to a superfamily of transcription activators (10) . Its protein product is a transcription factor that regulates the expression of estrogen-responsive genes by binding to a specific DNA sequence found in their regulatory regions. As a mediator of estrogen hormone action, the ER is involved in many important physiological processes. Loss or down-regulation of ER expression in prostate cancer has been frequently documented (5 , 11 , 12) . In addition, an inverse correlation was found between ER expression and histological grade or pathological stage by Nativ et al. (13) and others (14 , 15) . Low ER expression was also associated with poor prognosis for effective endocrine therapy (14) . However, the precise role of ER in neoplasmic transformation of prostate has not been established.

No mutation or other gross structural alterations of the ER gene in prostate cancer has been reported thus far to be responsible for ER down-regulation. One mechanism that could block transcription of the ER gene in ER-negative prostate cancer, without structural alteration in the gene, is the de novo methylation of cytosine-rich areas, termed "CpG islands," in the 5' regulatory region of the gene (16) . To date, the DNA Mtase encoded by Dnmt 1 is the only enzyme that has been shown to cause increased CpG dinucleotide methylation (17) and to trigger transformation (18) . ER gene methylation has been observed in several human cancers, such as breast cancer (19) , lung cancer, colorectal cancer, (20) and hematopoietic neoplasms (21) , and has been related to inactivation of ER expression. The purpose of this investigation was to determine whether ER methylation is involved in inactivation of the ER gene in prostate cancer. Using the bisulfite genomic sequencing methods, we examined a 447-bp region of the ER promoter located immediately upstream from the transcribed sequence of the human ER gene.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Treatment.
Human prostatic cancer cell lines LNCaP, PC3, and DU145 were obtained from American Type Culture Collection (Manassas, VA). ND1 (human primary prostate cancer) and BPH1 (human benign prostate epithelium) cell lines were developed in our laboratory (22 , 23) . DU145 and ND1 cells were cultured in DMEM. PC3 cells were cultured in F-12 Ham’s. LNCaP, TSUPr1, DUPro, and BPH1 cells were maintained in RPMI 1640. All media were supplemented with 10% (v/v) fetal bovine serum and 2 mM L-glutamine. All media and supplements were obtained from the University of California–San Francisco Cell Culture Facility. For drug treatment, exponentially growing cells were seeded at a density of 2 x106 cells/83 cm2 flask (day 0). Cells were allowed to attach overnight before the addition of freshly prepared 5-azaC (Sigma Chemical Co., St. Louis, MO). On day 1, a final concentration of 2 µg/ml 5-azaC in PBS was added to the flask. The next day, the medium was changed. On day 3 and day 5, the cells were treated two more times as on day 1. On day 6, the cells were harvested.

Tissue Samples and Microdissection.
Archival prostate cancer and BPH samples were obtained from the Veterans Affairs Medical Center in San Francisco and the University of California–San Francisco. Sections were cut 5 µm thick from formalin-fixed, paraffin-embedded tissues and mounted on microscope slide and diagnosed according to the Gleason scoring system. To collect cancer tissues for DNA extraction, microdissection was carried out as described previously (24) .

Nucleic Acid Extraction.
DNA from cell lines and microdissected tissues was extracted using QIAamp Tissue Kit (Qiagen Inc., Valencia, CA) according to the manufacturer’s instructions. Total RNA was extracted by guanidium thiocyanate-phenol-chloroform extraction using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH).

Reverse Transcription-PCR.
Total cellular RNA (1–5 µg) was reverse transcribed using random hexamers primer and Superscript II reverse transcriptase (Life Technologies, Inc., Gaithersburg, MD) in a 40-µl reaction. cDNA was amplified by differential PCR using primers specific for the ER gene (GGAGACATGAGAGCTGCCA, sense; CCAGCAGCATGTCGAAGATC, antisense) and the ß-actin gene (TCTACAATGAGCTGCGTGTG, sense; ATCTCCTTCTGCATCCTGTC, antisense). For amplification of Dnmt 1 gene, primers TTCCATCCTTCTGCACAGG (sense) and TCTCCATCTTCGTCCTCGTCAG (antisense) were used, and the ß-actin gene was also amplified as an interior control using primer TCTACAATGAGCTGCGTGTG (sense) and primer AATGTCAGGCACGATTTCCC (antisense). PCR reactions were performed in a PTC-200 thermal cycler (MJ Research, Watertown, MA) at 94°C for 1 min, 30 cycles at 94°C for 20 s, 57°C for 20 s, and 72°C for 30 s, followed by an extension step at 72°C for 5 min. The PCR products were electrophoresed through a 1.5% agarose gel containing ethidium bromide and were visualized by UV rays.

Bisulfite Genomic Sequencing.
Bisulfite modification of genomic DNA was carried out according to reported methods (25) . Modified DNA was amplified by two rounds of PCR with primers S1 (AAAGTGGTTAAGAGGTGGATTTA, upstream, sequence position 464 to 487; GenBank accession number X68051) and S2 (TCAAATTTACAAAATAAAACATAAA, downstream, sequence position 912 to 887; Fig. 1Citation ). The PCR conditions were 94°C for 2 min, 35 cycles of 94°C for 20 s, 55°C for 20 s, and 72°C for 30 s, with a final extension at 72°C for 5 min. The first PCR products (1 µl) were subjected to a second round PCR cycled for 30 times. The resulting products were sequenced on an ABI automated sequencer with Dye terminators (Perkin-Elmer Corp., Foster City, CA).



View larger version (6K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Schematic representation of ER gene promoter structure. TATA, ATG signal, and CACC box are indicated. Primer S1 and primer S2 were used to amplify a 447-bp fragment for direct sequencing. The position of primers is indicated (GenBank accession number X68051). •, CpG sites amplified by PCR.

 
Quantitation of Methylation Levels and Statistical Analysis.
The methylation levels of individual CpG sites were expressed as percentages of 5-methyl cytosine among the whole cytosine population (methylated plus unmethylated) at the same site as shown on the computer-generated sequencing chromatogram (26) . A single "C" at the corresponding CpG site was considered as 100% methylation, a single "T" as no methylation, and overlapping "C" and "T" as partial methylation. In the last case, the percentage of methylation was expressed as the ratio of "C" peak value to the peak values of "C" plus "T." Data are given as mean ± SE. Statistical analysis was performed using Student’s t test for unpaired sample. Significance was defined as P < 0.01.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
ER Methylation in Human Prostate Cancer Cell Lines.
Using direct bisulfite genome sequencing techniques, we examined seven prostate cell lines (six cancerous and one normal) for ER gene promoter methylation. A 447-bp region (sequence position 464–912) of the proximal promoter of the ER gene, encompassing eight CpG sites, was amplified by PCR from bisulfite-modified DNA. The ER gene promoter structure is depicted in Fig. 1Citation . Sequencing results revealed that all cytosines were converted to thymines, except those that existed as CpG doublet, and were methylated.

All of the six prostate cancer cell lines examined showed extensive methylation of the ER gene promoter (Fig. 2A)Citation . Of them, DU145, TSUPr1, DUPro, and ND1 exhibited 100% methylation at most of the CpG sites. PC3 and LNCaP were less methylated but still had sites that were 100% methylated. However, the normal cell line BPH1 did not show methylation at any CpG sites (Fig. 2A)Citation . We further treated ER-negative cell lines with the demethylating agent 5-azaC for 3 nonsuccessive days. After treatment, DNA was extracted and modified again, and the ER gene promoter was amplified using the same primers. Sequencing results of the PCR products from 5-azaC-treated cell lines revealed that most of the previously methylated CpG sites were demethylated completely with no methylated cytosine existing at the same CpG sites compared with that before treatment. Although the demethylation was not complete in some of the CpG sites, a lesser degree of methylation was observed when compared with the degree of methylation in nontreated cells (data not shown).



View larger version (70K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. ER methylation in prostate cell lines and tissue samples. DNA was bisulfite-modified and amplified by two rounds of PCR. The resulting PCR products were direct sequenced. A, ER methylation in prostate cell lines. Methylation percentage of the individual CpG site is presented as the ratio of methylated cytosine to the total cytosine (methylated plus unmethylated) in each cell line. B, ER methylation in prostate cancer and BPH tissues. The methylation percentage of the individual CpG site is presented as the average ratio of methylated cytosine to the total cytosine (methylated plus unmethylated) of all samples in each group. *, sites with significant difference in methylation between cancer and BPH samples. Numbers on X axis are the position of CpG sites (GenBank accession number X68051).

 
ER Methylation in Human Prostate Cancer Tissues.
A total of 31 prostate cancer and 10 BPH tissue samples were analyzed for ER gene methylation. For cancer samples, we used microdissection techniques to collect tumor cells for DNA extraction and subsequent PCR amplification. Of the 31 prostate cancer tissue samples, 10 were low grade (including grades I and II) and 21 were high grade (including grades III-V). Overall, the percentages of samples that showed ER methylation were 60% (6 of 10) in BPH, 80% (8 of 10) in the low-grade cancer, and 96 (20 of 21) in the high-grade cancer. In contrast to methylation found in cell lines, no CpG site with complete methylation was found in tissue samples. To correlate methylation levels with tumor grades, we calculated the average methylation levels of individual CpG sites among each group. The resulting data from the cancer samples were compared with that from BPH samples using Student’s t test. DNA from cancer exhibited a universally higher average of methylation at every CpG site than DNA from BPH. The differences between the high-grade samples and BPH samples were significant at every CpG site (P < 0.01; Fig. 2BCitation ). Only three sites (positions 493, 516, and 528) showed significantly higher methylation in the low-grade samples compared with the BPH samples (P < 0.01; Fig. 2BCitation ). Examples of sequencing chromatograms are displayed in Fig. 3Citation .



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 3. Examples of direct sequencing chromatogram. DNA was first bisulfite-modified and PCR amplified. PCR products were then sequenced on an ABI automated sequencer with Dye terminators (Perkin-Elmer Corp.). Upper sequence represents GenBank sequence of the ER promoter (number X68051) from position 681–689. A CpG site is underlined, and the cytosine (C) or thymine (T) peaks are indicated by asterisks. A, complete methylation as found in prostate cancer cell lines. B, partial methylation as found in prostate cancer tissue. C, no methylation as found in BPH1 cell line.

 
Inactivation and Reactivation of the ER Gene in Prostate Cancer.
To understand whether mRNA expression of ER is inactivated by ER promoter methylation, we performed RT-PCR analysis. No ER mRNA expression was found in all of the prostate cancer cell lines examined, whereas BPH1, the normal prostate epithelial cell line, showed normal levels of ER mRNA expression (Fig. 4A)Citation . The mRNA expression in cell lines correlated well with their methylation status, as revealed by sequencing study (Fig. 2A)Citation . Treatment of cell lines with 5-azaC for 3 nonsuccessive days restored ER mRNA expression in all of the cancer cell lines that showed no ER expression before treatment (Fig. 4B)Citation .



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 4. ER mRNA expression in prostate cancer and BPH1 cell lines before (A) and after (B) demethylating agent treatment. Cells were treated for 3 nonsuccessive days with 5-azaC at a concentration of 2 µg/ml. After treatment, the cells were harvested for RNA extraction. Total cellular RNA (1–5 µg) was reverse transcribed, and the resulting cDNA was amplified with differential PCR using primers for the ß-actin gene and ER gene.

 
Dnmt1 mRNA Expression
To understand the possible mechanism of ER methylation, we also examined the mRNA expression of the Dnmt1 gene in the cell lines and found all of the cancer cell lines exhibited elevated levels of Dnmt 1 expression, whereas, interestingly, BPH1 showed only minimal expression (Fig. 5)Citation .



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 5. mRNA expression of the Dnmt1 gene in cell lines. Total cellular RNA (1–5 µg) was reverse transcribed, and the resulting cDNA was amplified with differential PCR using primers for the ß-actin gene and Dnmt1gene.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The results of our study demonstrate that the ER gene is extensively methylated both in prostate cancer cell lines and prostate cancer tissues. The methylation levels correlate with tumor pathological grades and reversely correlate with ER gene expression. We also analyzed ER gene methylation in BPH tissues as a control. Surprisingly, the ER gene is also methylated in BPH tissue, although at much lower levels when compared with cancer. In human colorectal mucosa, physiological aging has been associated with de novo methylation in the ER gene (20) . BPH is an age-related benign condition seen in the majority of men over 50 years and is characterized by stromal and/or glandular (epithelial) hyperplastic changes of the prostate. It is not clear whether ER methylation in BPH is an age-related event because data on ER methylation in normal prostate is lacking. Another possible explanation for ER methylation found in BPH is that it represents a disease-specific epigenetic mechanism that may contribute to pathogenesis of BPH. Although no link has been established between BPH and prostate cancer, it has been suggested that BPH and malignant prostate growth share a common origin because they commonly coexist and demonstrate androgen dependency (27) . Therefore, BPH may be a premalignant lesion in prostate cancer development. The methylation of the ER gene in BPH could be one of the earliest events that predispose to prostate cancer.

There are two possible mechanisms of inactivation of the ER gene in prostate cancer. First, activators responsible for ER transcription are not available or transcriptional repressors predominate. Alternatively, the CpG island within the promoter region of the ER gene may be methylated, which leads to transcriptional inactivation of the ER gene through several undefined mechanisms. In the prostate cancer cell lines analyzed in our study, mRNA expression of the ER gene was well correlated with methylation status in those cell lines. Furthermore, ER mRNA expression was restored by treatment with demethylating agent 5-azaC, a cytosine analogue that acts as a suicide substrate for DNA methyltransferase when incorporated into DNA at the target site for DNA methylation, CpG dinucleotides (28) . These results clearly indicate that the promoter methylation is the mechanism of ER inactivation in prostate cancer.

Promoter methylation is an epigenetic mechanism by which the gene is silenced. Unlike germline mutation, which may affect the whole cell population of the body, DNA methylation may be tissue-specific or cell-specific. For methylation analysis of tumor DNA, contamination by DNA from normal cells may present a major concern because different methylation patterns may exist in these two cell populations. In the present study, we isolated pure population of cancer cells using microdissection technique for methylation study. Our data should have reflected the methylation status of a pure cancer cell population rather than a mixture of malignant and nonmalignant cells.

In normal adult tissues, CpG islands are unmethylated, with the exception of transcriptionally silent genes on the inactive X chromosome and some imprinted genes (29 , 30) . An imbalance of DNA methylation, involving widespread hypomethylation, regional hypermethylation, and increased cellular capacity for methylation, is characteristic of human neoplasm. This imbalance begins in preneoplastic cells and becomes more extensive throughout subsequent stages of tumor progression (31) . The data from our work showed a distinct trend of ER methylation in prostate cancer. With tumor progression, the ER is gradually methylated, leading to transcriptional inactivation. The most extensive methylation is observed in cultured cancer cell lines, which may be explained as the result of the fact that most of them were derived from metastatic prostate cancer.

The function of estrogen in the prostate has remained unclear. The hypothesis is proposed that estrogen interact with androgen in setting up the pace of prostatic growth and function. Estrogen not only directs stromal proliferation and secretion but also, through insulin-like growth factor I, conditions the response of the epithelium to androgen (32) . The action of estrogen requires presence of its receptor, ER, in its target cells. The ER gene itself has metastasis suppressor properties in breast cancer cells (33) and suppresses the growth of many different cell types in vitro (34) . Therefore, a tumor-suppressor role has been suggested (20) . The altered methylation patterns observed during prostate cancer progression may possess wide implications in our understanding of the role of estrogen and its receptor in the pathogenesis and endocrinal manipulation of prostate cancer. Our study provides a clue that estrogen and its receptor may be involved in the initiation and progression of prostate cancer, as well as BPH.

To understand the potential mechanism of ER methylation, we examined in cell lines the mRNA expression of Dnmt1, the enzyme that methylates cytosines that are 5' to guanosines and responsible for generating and maintaining DNA methylation patterns. Dnmt1 expression was elevated in all of the cancer cell lines examined. Our results are consistent with the current concept that the level of Dnmt1 expression is elevated significantly in neoplastic cells compared with normal cells (33) . Recent evidence showed that increased DNA Mtase activity is an early event in carcinogenesis (34) . One possible molecular mechanism of this elevation of DNA Mtase in cancer cells is that the expression of the Dnmt1 gene is regulated by oncogenic signaling pathways, such as the Ras-Jun signaling pathways (35 , 36) .

In conclusion, we demonstrate for the first time that ER gene methylation is a common event in prostate cancer, as well as BPH, can lead to inactivation of ER transcription, and is markedly associated with tumor progression. Our data offer insight into the mechanism by which ER is down-regulated in prostate cancer and may support the hypothesis that estrogen can have direct effects on prostate via its own receptor.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grants DK-47517, CA-64872, AG-16870, and DK-52708; VA/DOD and VA REAP awards; and VA Merit Review (to R. D.). Back

2 To whom requests for reprints should be addressed, at Urology Research Center (112F), 4150 Clement Street, San Francisco, CA 94121. Phone: (415) 750-6964; Fax: (415) 750-6639; E-mail: urolab{at}aol.com Back

3 The abbreviations used are: ER, estrogen receptor; DNA Mtase, DNA methlytransferase; BPH, benign prostate hyperplasia; 5-azaC, 5-aza-2'-deoxycytidine. Back

Received 7/13/99. Accepted 12/ 2/99.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Cox R. L., Crawford E. D. Estrogens in the treatment of prostate cancer. J. Urol., 154: 1991-1998, 1995.[Medline]
  2. Mangan F. R., Neal G. E., Williams D. C. The effects of diethylstilboestrol and castration on the nucleic acid and protein metabolism of rat prostate gland. Biochem. J., 104: 1075-1081, 1967.[Medline]
  3. Castagnetta L. A., Carruba G. Human prostate cancer: a direct role for oestrogens. Ciba Found. Symp., 191: 269-286, 1995.[Medline]
  4. Carruba G., Miceli M. D., Comito L., Farruggio R., Sorci C. M., Oliveri G., Amodio R., di Falco M., d’Amico D., Castagnetta L. A. Multiple estrogen function in human prostate cancer cells. Ann. N Y Acad. Sci., 784: 70-84, 1996.[Medline]
  5. Brolin J., Skoog L., Ekman P. Immunohistochemistry and biochemistry in detection of androgen, progesterone, and estrogen receptors in benign and malignant human prostatic tissue. Prostate, 20: 281-295, 1992.[Medline]
  6. Mobbs B. G., Johnson I. E., Liu Y. Quantitation of cytosolic and nuclear estrogen and progesterone receptor in benign, untreated, and treated malignant human prostatic tissue by radioligand binding and enzyme-immunoassays. Prostate, 16: 235-244, 1990.[Medline]
  7. Castagnetta L. A., Miceli M. D., Sorci C. M., Pfeffer U., Farruggio R., Oliveri G., Calabro M., Carruba G. Growth of LNCaP human prostate cancer cells is stimulated by estradiol via its own receptor. Endocrinology, 136: 2309-2319, 1995.[Abstract]
  8. Carruba G., Pfeffer U., Fecarotta E., Coviello D. A., D’Amato E., Lo Castro M., Vidali G., Castagnetta L. Estradiol inhibits growth of hormone-nonresponsive PC3 human prostate cancer cells. Cancer Res., 54: 1190-1193, 1994.[Abstract/Free Full Text]
  9. Menasce L. P., White G. R., Harrison C. J., Boyle J. M. Localization of the estrogen receptor locus (ESR) to chromosome 6q25.1 by FISH and a simple post-FISH banding technique. Genomics, 17: 263-265, 1993.[Medline]
  10. Evans R. M. The steroid and thyroid hormone receptor superfamily. Science (Washington DC), 240: 889-895, 1988.[Abstract/Free Full Text]
  11. Hobisch A., Hittmair A., Daxenbichler G., Wille S., Radmayr C., Hobisch-Hagen P., Bartsch G., Klocker H., Culig Z. Metastatic lesions from prostate cancer do not express oestrogen and progesterone receptors (see comments). J. Pathol., 182: 356-361, 1997.[Medline]
  12. Sonnenschein C., Olea N., Pasanen M. E., Soto A. M. Negative controls of cell proliferation: human prostate cancer cells and androgens. Cancer Res., 49: 3474-3481, 1989.[Abstract/Free Full Text]
  13. Nativ O., Umehara T., Colvard D. S., Therneau T. M., Farrow G. M., Spelsberg T. C., Lieber M. M. Relationship between DNA ploidy and functional estrogen receptors in operable prostate cancer. Eur. Urol., 32: 96-99, 1997.[Medline]
  14. Konishi N., Nakaoka S., Hiasa Y., Kitahori Y., Ohshima M., Samma S., Okajima E. Immunohistochemical evaluation of estrogen receptor status in benign prostatic hypertrophy and in prostate carcinoma and the relationship to efficacy of endocrine therapy. Oncology, 50: 259-263, 1993.[Medline]
  15. Ekman P., Snochowski M., Dahlberg E., Bression D., Hogberg B., Gustafsson J. A. Steroid receptor content in cytosol from normal and hyperplastic human prostates. J. Clin. Endocrinol. Metab., 49: 205-215, 1979.[Abstract/Free Full Text]
  16. Bird A. P. CpG-rich islands and the function of DNA methylation. Nature (Lond.), 321: 209-213, 1986.[Medline]
  17. Vertino P. M., Yen R. W., Gao J., Baylin S. B. De novo methylation of CpG island sequences in human fibroblasts overexpressing DNA (cytosine-5-)-methyltransferase. Mol. Cell. Biol., 16: 4555-4565, 1996.[Abstract]
  18. Wu J., Issa J. P., Herman J., Bassett D. E., Jr., Nelkin B. D., Baylin S. B. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells (see comments). Proc. Natl. Acad. Sci. USA, 90: 8891-8895, 1993.[Abstract/Free Full Text]
  19. Ottaviano Y. L., Issa J. P., Parl F. F., Smith H. S., Baylin S. B., Davidson N. E. Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. Cancer Res., 54: 2552-2555, 1994.[Abstract/Free Full Text]
  20. Issa J. P., Ottaviano Y. L., Celano P., Hamilton S. R., Davidson N. E., Baylin S. B. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat. Genet., 7: 536-540, 1994.[Medline]
  21. Issa J. P., Baylin S. B., Belinsky S. A. Methylation of the estrogen receptor CpG island in lung tumors is related to the specific type of carcinogen exposure. Cancer Res., 56: 3655-3658, 1996.[Abstract/Free Full Text]
  22. Narayan P., Dahiya R. Establishment and characterization of a human primary prostatic adenocarcinoma cell line (ND-1). J. Urol., 148: 1600-1604, 1992.[Medline]
  23. Hayward S. W., Dahiya R., Cunha G. R., Bartek J., Deshpande N., Narayan P. Establishment and characterization of an immortalized but non- transformed human prostate epithelial cell line: BPH-1. In Vitro Cell. Dev. Biol. Anim., 31: 14-24, 1995.[Medline]
  24. Dahiya R., Lee C., Zhu Z., Thompson H. J. Microsatellite instability in an animal model of mammary carcinogenesis. Int. J. Oncol., 13: 23-28, 1998.[Medline]
  25. Clark S. J., Harrison J., Paul C. L., Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res., 22: 2990-2997, 1994.[Abstract/Free Full Text]
  26. Paul C. L., Clark S. J. Cytosine methylation: quantitation by automated genomic sequencing and GENESCAN analysis. Biotechniques, 21: 126-133, 1996.[Medline]
  27. Cordon-Cardo C., Koff A., Drobnjak M., Capodieci P., Osman I., Millard S. S., Gaudin P. B., Fazzari M., Zhang Z. F., Massague J., Scher H. I. Distinct altered patterns of p27KIP1 gene expression in benign prostatic hyperplasia and prostatic carcinoma (see comments). J. Natl. Cancer Inst., 90: 1284-1291, 1998.[Abstract/Free Full Text]
  28. Bird A. The essentials of DNA methylation. Cell, 70: 5-8, 1992.[Medline]
  29. Mohandas T., Sparkes R. S., Shapiro L. J. Reactivation of an inactive human X chromosome: evidence for X inactivation by DNA methylation. Science (Washington DC), 211: 393-396, 1981.[Abstract/Free Full Text]
  30. Li E., Beard C., Forster A. C., Bestor T. H., Jaenisch R. DNA methylation, genomic imprinting, and mammalian development. Cold Spring Harb. Symp. Quant. Biol., 58: 297-305, 1993.[Abstract/Free Full Text]
  31. Baylin S. B., Makos M., Wu J. J., Yen R. W., de Bustros A., Vertino P., Nelkin B. D. Abnormal patterns of DNA methylation in human neoplasia: potential consequences for tumor progression. Cancer Cells, 3: 383-390, 1991.[Medline]
  32. Farnsworth W. E. Roles of estrogen and SHBG in prostate physiology. Prostate, 28: 17-23, 1996.[Medline]
  33. el-Deiry W. S., Nelkin B. D., Celano P., Yen R. W., Falco J. P., Hamilton S. R., Baylin S. B. High expression of the DNA methyltransferase gene characterizes human neoplastic cells and progression stages of colon cancer. Proc. Natl. Acad. Sci. USA, 88: 3470-3474, 1991.[Abstract/Free Full Text]
  34. Belinsky S. A., Nikula K. J., Baylin S. B., Issa J. P. Increased cytosine DNA-methyltransferase activity is target-cell- specific and an early event in lung cancer. Proc. Natl. Acad. Sci. USA, 93: 4045-4050, 1996.[Abstract/Free Full Text]
  35. Szyf M. DNA methylation properties: consequences for pharmacology. Trends Pharmacol. Sci., 15: 233-238, 1994.[Medline]
  36. Szyf M. The DNA methylation machinery as a target for anticancer therapy. Pharmacol. Ther., 70: 1-37, 1996.[Medline]



This article has been cited by other articles:


Home page
 CarcinogenesisHome page
M. Chen, J. Ni, H.-C. Chang, C.-Y. Lin, M. Muyan, and S. Yeh
CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells
Carcinogenesis, May 1, 2009; 30(5): 841 - 850.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
H. Asada, Y. Yamagata, T. Taketani, A. Matsuoka, H. Tamura, N. Hattori, J. Ohgane, N. Hattori, K. Shiota, and N. Sugino
Potential link between estrogen receptor-{alpha} gene hypomethylation and uterine fibroid formation
Mol. Hum. Reprod., September 1, 2008; 14(9): 539 - 545.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
J. C. Baker Jr., J. H. Ostrander, S. Lem, G. Broadwater, G. R. Bean, N. C. D'Amato, V. K. Goldenberg, C. Rowell, C. Ibarra-Drendall, T. Grant, et al.
ESR1 Promoter Hypermethylation Does Not Predict Atypia in RPFNA nor Persistent Atypia after 12 Months Tamoxifen Chemoprevention
Cancer Epidemiol. Biomarkers Prev., August 1, 2008; 17(8): 1884 - 1890.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
D. Y. Park, H. Sakamoto, S. D. Kirley, S. Ogino, T. Kawasaki, E. Kwon, M. Mino-Kenudson, G. Y. Lauwers, D. C. Chung, B. R. Rueda, et al.
The Cables Gene on Chromosome 18q Is Silenced by Promoter Hypermethylation and Allelic Loss in Human Colorectal Cancer
Am. J. Pathol., November 1, 2007; 171(5): 1509 - 1519.
[Abstract] [Full Text] [PDF]

Home page
 INT J SURG PATHOLHome page
Y.-F. Zhao, Y.-G. Zhang, X.-X. Tian, Juan Du, and Jie Zheng
Aberrant Methylation of Multiple Genes in Gastric Carcinomas
International Journal of Surgical Pathology, July 1, 2007; 15(3): 242 - 251.
[Abstract] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
L.-C. Li, S. T. Okino, H. Zhao, D. Pookot, R. F. Place, S. Urakami, H. Enokida, and R. Dahiya
Small dsRNAs induce transcriptional activation in human cells
PNAS, November 14, 2006; 103(46): 17337 - 17342.
[Abstract] [Full Text] [PDF]

Home page
 Endocr Relat CancerHome page
A. S Perry, R. Foley, K. Woodson, and M. Lawler
The emerging roles of DNA methylation in the clinical management of prostate cancer.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 357 - 377.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S.-M. Ho, W.-Y. Tang, J. Belmonte de Frausto, and G. S. Prins
Developmental Exposure to Estradiol and Bisphenol A Increases Susceptibility to Prostate Carcinogenesis and Epigenetically Regulates Phosphodiesterase Type 4 Variant 4
Cancer Res., June 1, 2006; 66(11): 5624 - 5632.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
L.-C. Li, P. R. Carroll, and R. Dahiya
Epigenetic Changes in Prostate Cancer: Implication for Diagnosis and Treatment
J Natl Cancer Inst, January 19, 2005; 97(2): 103 - 115.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
P. M. Das and R. Singal
DNA Methylation and Cancer
J. Clin. Oncol., November 15, 2004; 22(22): 4632 - 4642.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
J. Gilbert, S. D. Gore, J. G. Herman, and M. A. Carducci
The Clinical Application of Targeting Cancer through Histone Acetylation and Hypomethylation
Clin. Cancer Res., July 15, 2004; 10(14): 4589 - 4596.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. Sasaki, M. Kaneuchi, N. Sakuragi, and R. Dahiya
Multiple Promoters of Catechol-O-methyltransferase Gene Are Selectively Inactivated by CpG Hypermethylation in Endometrial Cancer
Cancer Res., June 15, 2003; 63(12): 3101 - 3106.
[Abstract] [Full Text] [PDF]

Home page
 JNCI J Natl Cancer InstHome page
M. Sasaki, Y. Tanaka, G. Perinchery, A. Dharia, I. Kotcherguina, S. i. Fujimoto, and R. Dahiya
Methylation and Inactivation of Estrogen, Progesterone, and Androgen Receptors in Prostate Cancer
J Natl Cancer Inst, March 6, 2002; 94(5): 384 - 390.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
K. R Dimitrova, K. DeGroot, A. K Myers, and Y. D Kim
Estrogen and homocysteine
Cardiovasc Res, February 15, 2002; 53(3): 577 - 588.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
J. F. Schmitt, D. S. Millar, J. S. Pedersen, S. L. Clark, D. J. Venter, M. Frydenberg, P. L. Molloy, and G. P. Risbridger
Hypermethylation of the Inhibin {alpha}-Subunit Gene in Prostate Carcinoma
Mol. Endocrinol., February 1, 2002; 16(2): 213 - 220.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
D. Pasquali, V. Rossi, D. Esposito, C. Abbondanza, G. A. Puca, A. Bellastella, and A. A. Sinisi
Loss of Estrogen Receptor {beta} Expression in Malignant Human Prostate Cells in Primary Cultures and in Prostate Cancer Tissues
J. Clin. Endocrinol. Metab., May 1, 2001; 86(5): 2051 - 2055.
[Abstract] [Full Text]

Home page
 Cancer Res.Home page
M. Sasaki, L. Kotcherguina, A. Dharia, S. Fujimoto, and R. Dahiya
Cytosine-Phosphoguanine Methylation of Estrogen Receptors in Endometrial Cancer
Cancer Res., April 1, 2001; 61(8): 3262 - 3266.
[Abstract] [Full Text]

Home page
 Cancer Res.Home page
A. Latil, I. Bièche, D. Vidaud, R. Lidereau, P. Berthon, O. Cussenot, and M. Vidaud
Evaluation of Androgen, Estrogen (ER{{alpha}} and ER{beta}), and Progesterone Receptor Expression in Human Prostate Cancer by Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction Assays
Cancer Res., March 1, 2001; 61(5): 1919 - 1926.
[Abstract] [Full Text]

Home page
 Cancer Res.Home page
M. Sasaki, A. Dharia, B. R. Oh, Y. Tanaka, S.-i. Fujimoto, and R. Dahiya
Progesterone Receptor B Gene Inactivation and CpG Hypermethylation in Human Uterine Endometrial Cancer
Cancer Res., January 1, 2001; 61(1): 97 - 102.
[Abstract] [Full Text]

Home page
 Cancer Res.Home page
C. I. Truica, S. Byers, and E. P. Gelmann
{beta}-Catenin Affects Androgen Receptor Transcriptional Activity and Ligand Specificity
Cancer Res., September 1, 2000; 60(17): 4709 - 4713.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, L.-C.
Right arrow Articles by Dahiya, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, L.-C.
Right arrow Articles by Dahiya, R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online