| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Laboratoire de Toxicologie Moléculaire, U490 INSERM, Université René Descartes, 75006 Paris, France [F. C., H. B., A. C., T. L., P. B., P. L-P.]; Service de Chirurgie de la Face et du Cou. Assistance Publique Hôpitaux de Paris, Hôpital Laennec, 75007 Paris [O. L., D. B.]; and Centre d’Etude du Polymorphisme Humain U434 Laboratoire de Génétique des Tumeurs, 75010 Paris [J. Z.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
However, two issues need to be addressed. The first one concerns the technical aspects of plasma DNA analyses, and the second one concerns the clinical relevance of such an approach in the management of the cancer patients. Indeed, discrepancies have appeared between studies. In some series, LOH or MSI in plasma indicated the presence of a large excess of tumor DNA (4 , 6 , 7) , and in others, the necessity of developing very sensitive mutation detection methods tends to prove that tumor DNA is largely diluted in normal DNA (8 , 9) . In several studies, LOH or MSI was observed in plasma DNA but not in corresponding tumor DNA, without any clear or well-stated explanations. This fact needs to be investigated because obviously the long-term goal of such research is to analyze serum or plasma samples in the absence of tumor DNA. Furthermore, series that were screened previously were not large enough to allow clinical evaluation of plasma DNA analyses. To find answers to those questions, a large series of head and neck cancer patients was screened for DNA plasma alterations. Tumor-specific serum markers could contribute with the clinical evaluation to the follow-up of patients; therefore, it seemed interesting to look for tumor DNA in the plasma of head and neck cancer patients (6) . In this work, plasma DNA was screened using microsatellite marker UT5085, which demonstrates a high rate of instability. This test was chosen to enhance efficiency by comparison with LOH analysis and allowed rapid tumor screening. Different arguments in this series as well as in previously published studies have suggested the existence of PCR artifacts in plasma amplified microsatellites. This last point was analyzed by studying the influence of PCR conditions on microsatellite patterns.
|
PATIENTS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Sample Preparation and Storage.
Sample collection and storage were done according to standard methods.
Tumor tissues and 10 ml of peripheral blood were collected at the time
of initial diagnosis, during endoscopy under general anesthesia. Tumors
were immediately snap-frozen in liquid nitrogen, and blood samples in
EDTA tubes were centrifuged for 10 min at 3000 x g to separate buffy coats and plasma. Buffy coats were
stored, whereas plasma was carefully removed from the EDTA-containing
tubes, transferred into propylene tubes for a second centrifugation
under identical conditions, and stored in fresh tubes. All samples were
stored at -80°C until further processing.
The presence of neoplastic tissue was confirmed by histopathological analysis before DNA extraction. All samples were diagnosed as invasive squamous cell carcinomas. Tissue DNA was extracted using a standard method, and matching lymphocyte DNA was extracted using the WIZARD extraction kit (Promega, Charbonnières, France).
Plasma DNA Extraction.
DNA was extracted from plasma by using the QIAmp Blood Kit (Qiagen,
Courtaboeuf, France) according to the blood and body fluid protocol
recommended by the manufacturer. One ml of plasma was treated, and a
DNA elution volume of 50 µl was obtained per extraction. The
extraction yield has been established to 70% using dilutions of known
quantities of SW480 cell line DNA (2, 20, and 200 ng/ml); this result
is in accordance with previously published data (14)
.
DNA Quantification.
Quantification of plasma DNA was performed for all samples on a volume
of 3 µl by fluorescence emission after intercalation of Hoechst dye.
The fluorescence was read by a DyNA Quant 200 fluorimeter, using the
cuve and capillary DyNA Quant Capillary Cuvette Adaptor Kit
(Pharmacia Biotech, Orsay, France). The threshold of DNA detection
established by the manufacturer is 2 ng/µl, which corresponds to 100
ng/ml plasma in our extraction protocol.
Microsatellite Analysis.
Microsatellite UT5085 was amplified with primers referenced in the
GenBank sequence database (accession number GDB309286): (a)
UT5085A, 5'-AAAGTGGGGATAAGGCAGC-3'; and (b) UT5085B,
5'-AGATGCACAACACATACACG-3'. Amplification was performed in a 50-µl
reaction volume with 1.25 units of Amplitaq Gold polymerase Cetus (PE
Applied Biosystems, Inc., Les Ulis, France), 200
mM deoxynucleotide triphosphate, 7.5 pmol of each
forward and reverse primer, 1.5 mM
MgCl2, and 5 µl of 10x Amplitaq buffer.
A total of 50 ng of DNA was used as a template for tumors and
lymphocytes. In the case of plasma, 5 µl of the DNA elution volume
obtained after Qiagen extraction was used as a template. The mixes were
denatured for 12 min at 95°C followed by cycles of 95°C for 30 s, 54°C for 45 s, and 72°C for 90 s. A final elongation
was performed for 10 min at 72°C. The number of cycles performed was
35 for tumor and lymphocyte and 45 for plasma. Amplified products
diluted in a loading buffer (1:3) were run on 6% polyacrylamide
sequencing gels [7 M urea and 32% (v/v)
formamide; acrylamide:bisacrylamide (29:1)] and then transferred
quickly by capillary blotting into a nylon membrane and
hybridized with a 32P-labeled 3'-oligonucleotide
probe. First, tumors and lymphocytes were amplified to select UT5085
unstable samples. MSI was defined by the occurrence of at least one
extra band in tumor DNA by comparison with lymphocyte DNA. Plasma
corresponding to shifted tumors were amplified, and tumor, lymphocyte,
and plasma amplifications were coanalyzed to compare the different
microsatellite patterns.
To demonstrate the existence of DNA in plasma at concentrations lower than the threshold value of 2 ng/µl, an amplification of the HLA locus was performed with the following primers: (a) GH26, GTGCTGCAGGTGTAAACTTGTACCAG; and (b) GH27, CACGGATCCGGTAGCAGCGGTAGAGTT. The PCR protocol was similar to that used with UT5085 for plasma DNA.
Microsatellite Typing on an Automated Sequencer.
This method was used to analyze the influence of PCR conditions on
microsatellite patterns using normal DNA as a template. Four
microsatellite markers were selected for this analysis (D13S1293,
D13S1248, D13S152, and D13S1319). Amplifications were run with sets of
primers, one of which was labeled with a fluorescent dye and different
amounts of DNA (40, 20, 10, 4, 2, 1, 0.5, 0.25, 0.125, and 0.065 ng).
Amplifications were performed with Amplitaq polymerase Cetus (PE
Applied Biosystems, Inc.) according to the manufacturer’s
instructions. PCR products were detected by laser fluorescence on
ABI373 (PE Applied Biosystems, Inc.). Data were analyzed by Genescan
analysis and genotyper software (PE Applied Biosystems, Inc.).
TP53 Mutation Detection in Tumor DNA.
Exons 5–8 were screened for mutations using denaturing gradient gel
electrophoresis in accordance with the method described by Hamelin
(15)
. Tumors showing an electrophoretic variant pattern
were amplified and sequenced for each variant exon. PCR products were
purified with QIAquick PCR Purification Kit (Qiagen) and sequenced on
both strands using an ABI 310 genetic analyzer (Applied Biosystems,
Inc., Courtaboeuf, France). We used the Big Dye Terminator sequencing
kit (PE Applied Biosystems) according to the manufacturer’s
instructions. Sequences were analyzed by Sequence Analysis 3.0 software
(PE Applied Biosystems).
TP53 Mutation Detection in Plasma DNA.
The detection of p53 mutations in plasma was performed by mutant
allele-specific amplification, a method adapted from that of Takeda
et al. (16)
with mutation-specific primers
(Table 1)
. Amplifications were performed in 50-µl reaction volumes with 1.25
units of Amplitaq Gold polymerase Cetus (Perkin-Elmer, Saint Quentin en
Yvelines, France), 200 mM deoxynucleotide
triphosphate, 7.5 pmol of each forward and reverse primer, 1.5
mM of MgCl2, 5 µl of 10x
Amplitaq buffer, and 5 µl of DNA elution volume. Three
different PCR touchdown protocols were used. PCR protocol 1 was 12 min
of denaturation at 95°C, followed by five cycles of 95°C for
30 s, 62°C for 45 s, and 72°C for 1 min; five cycles of
95°C for 30 s, 60°C for 45 s, and 72°C for 1 min; and
35 cycles of 95°C for 30 s, 58°C for 45 s, and 72°C for
1 min. A 10-min final elongation was performed at 72°C. PCR protocols
4–6 differed from protocol 1 with regard to the annealing time (30 s),
and protocols 2, 3, and 7 differed from protocol 1 on annealing
temperatures, respectively, 58°C, 56°C, and 54°C. Amplified
products were run on 8% acrylamide gel and visualized after ethidium
bromide staining.
|
2 tests were used to compare qualitative
variables. |
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. An amplification test was performed for all plasma on the HLA locus
using 5 µl of the elution volume of the Qiagen column as DNA
template, although the DNA concentration was below the threshold of
detection. Amplification products were visualized in all cases by
ethidium bromide staining showing the presence of DNA in all samples.
|
. In 62 of 65 cases, plasma patterns were comparable to
lymphocyte patterns; in 1 case, the plasma pattern showed a shift
similar to the tumor pattern (Fig. 1B)
; and in 2 cases,
plasma DNA demonstrated LOH, but no such alteration was detected in
tumor DNA (Fig. 1, C and D)
. In these two cases,
plasma DNA could not be quantified and was therefore estimated to be
<100 ng/ml plasma. The discordant results between tumor and plasma DNA
could not be explained by contamination of the tumor tissue by normal
cells because at least one tumor demonstrated clear LOH on other
chromosome arms. Therefore, we suspect the existence of PCR artifacts.
|
, allelic imbalance appeared in PCR products run with 1 ng of DNA, and
complete allelic losses were observed for 
0.25 ng of DNA (Fig. 2,
A–C
). In the last part of this study, the characterization
of plasma DNA was done in a subgroup of samples, using a method with
enhanced sensitivity. Eleven patients with tumors demonstrating eight
different p53 mutations were selected for plasma analysis. We searched
for mutations in plasma by a mutant allele-specific amplification
method adapted to each type of mutation. The method was shown to be
highly sensitive because 1 mutant allele could be detected among 10,000
wild-type alleles. In 11 plasma samples tested, two p53 mutations were
retrieved, demonstrating the existence, in a few cases, of tumor DNA in
plasma collected from cancer patients.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). In this series, plasma DNA concentrations were studied in 117
untreated primary HNSCC patients. The results demonstrated that in the
vast majority of cases, plasma DNA concentrations were <100 ng/ml
(n = 76), whereas 41 cases had plasma DNA
concentrations of >100 ng/ml. This represents low levels of
circulating DNA, although >50% of tumors were high stages (stage III
and stage IV). As far as it is possible to compare plasma DNA
concentrations between different series, this result seems comparable
to those published previously (2
, 6)
. No correlation was
seen between tumor stage and the level of plasma DNA. It is known that
the choice of microsatellite markers can influence results, depending
on the abilities of markers to exhibit shifts or LOH. To analyze all
tumors under the same condition, a single tetranucleotide
microsatellite UT5085 that was particularly prone to replication errors
was selected for plasma analysis, and it allowed the screening of 55%
of the tumors. Surprisingly, only one patient (1.5%) showed a similar
pattern in both tumor and plasma DNA, which differs greatly from the
percentage of 26% observed by Nawroz et al.
(6)
. The sensitivity of our method has been tested and has
shown that a 0.5% tumor:normal ratio could be detected. These data are
in accordance with the usual sensitivity level described in the
literature for microsatellite shift detection (18)
. This
first result led to the conclusion that plasma tumor DNA, if present in
head and neck cancer patients, is largely diluted in normal DNA. In
previously published series, the finding of LOH in plasma suggested, on
the contrary, that tumor DNA is enriched in plasma DNA (4
, 6
, 7
, 17)
. Tumor type is not likely to be the only explanation for
this discrepancy. In plasma DNA studies, arguments suggesting
the existence of PCR artifacts, probably due to low DNA concentrations,
and leading to overinterpretations of LOH have to be put
forward. Indeed in some cases, LOHs are found in plasma, but the
alteration is not found in tumor tissue (as reported for two samples in
our series). When this was the case, the alteration in plasma was
always interpreted as true LOH (Refs. 4
and
7
; Table 3
), and the discordance between plasma and tumor
was discussed using arguments that failed to arrive at a totally
satisfactory conclusion. The different possible explanations
forwarded included: (a) the characterization of LOH in the tumor failed
due to excessive contamination of tumor tissue by normal cells; or
(b) a subclone of tumor cells with the alteration could
release DNA in the plasma at higher concentrations compared to other
clones in the tumor. The possibility of technical artifacts was
not even discussed by the authors. Another point that needs to be
discussed is the fact that for some tumors exhibiting LOH and MSI, LOH
was retrieved in plasma, whereas instabilities were not. This is
inexplicable according to the sensitivities of both methods, and,
again, it suggests that LOH in the plasma could occasionally be due to
artifacts (Ref. 7
; Table 3
). Finally, most LOHs in plasma
that are shown in studies appeared as total allelic losses, suggesting
a very large excess of tumor plasma DNA (4
, 6
, 7)
.
Different arguments are in favor of a low ratio of tumor DNA:normal DNA
in plasma: (a) the impossibility of detecting gene mutations
by standard methods; (b) the necessity of developing highly
specific and sensitive techniques (5
, 8)
; and
(c) the finding that plasma DNA concentrations, in healthy
individuals, range up to 100 ng/ml (2
, 3)
.
|
The observation of the low ratio of tumor DNA:normal DNA has already been suggested by others (5 , 8 , 9) . Our mutation analysis was performed using a high sensitivity mutant allele-specific amplification method, and 2 of 11 plasma samples were shown to contain tumor DNA. This method, which allows the detection of 1 mutated copy among 10,000 copies of the wild-type allele, seems to be more efficient for the detection of tumor plasma DNA, as reported previously (8) .
In conclusion, we do not deny the existence of tumor plasma DNA as demonstration was done by mutation analysis, but certainly not in large concentrations or in a large excess as compared to normal DNA, at least in head and neck cancer patients. It is necessary to emphasize that the interpretation of microsatellite profiles in plasma DNA amplified products is particularly prone to errors due to PCR artifacts. Interpretation of LOH or instability in plasma DNA needs to be carefully stated, especially when tumor cell DNA is not available for analysis. One recommendation would be that the quantities of DNA templates used in PCR amplification need to be precisely known. New approaches to detecting alterations such as methylated CpG islands in the promoter of p16 (12 , 20) need to be evaluated for the detection of tumor DNA in plasma. In the case of head and neck cancer, the clinical usefulness of a test based on plasma DNA remains uncertain.
|
FOOTNOTES |
|---|
1 Supported by the Comité de Paris de la
Ligue Nationale de Lutte Contre le Cancer, by the
Délégation à la Recherche Clinique de l’Assitance
Publique-Hôpitaux de Paris (TBI 97006), and by the Association
pour la Recherche contre le Cancer. 
2 To whom requests for reprints should be
addressed, at Laboratoire de Toxicologie Moléculaire, 45 Rue des
Saints Pères, 75270 Paris Cedex 06, France. Phone:
33-1-42-86-20-81; Fax: 33-1-42-86-20-72; E-mail: Pierre.Laurent-Puig{at}biomedicale.univ-paris5.fr
3 The abbreviations used are: LOH, loss of
heterozygosity; HNSCC, head and neck squamous cell carcinoma; MSI,
microsatellite instability.
Received 7/ 8/99. Accepted 12/ 3/99.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  I. Muller, C. Beeger, C. Alix-Panabieres, X. Rebillard, K. Pantel, and H. Schwarzenbach Identification of Loss of Heterozygosity on Circulating Free DNA in Peripheral Blood of Prostate Cancer Patients: Potential and Technical Improvements Clin. Chem., April 1, 2008; 54(4): 688 - 696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Li, L. Harris, H. Mamon, M. H. Kulke, W.-H. Liu, P. Zhu, and G. Mike Makrigiorgos Whole Genome Amplification of Plasma-Circulating DNA Enables Expanded Screening for Allelic Imbalance in Plasma J. Mol. Diagn., February 1, 2006; 8(1): 22 - 30. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Woenckhaus, U. Grepmeier, B. Werner, C. Schulz, F. Rockmann, P. J. Wild, G. Rockelein, H. Blaszyk, M. Schuierer, F. Hofstaedter, et al. Microsatellite Analysis of Pleural Supernatants Could Increase Sensitivity of Pleural Fluid Cytology J. Mol. Diagn., October 1, 2005; 7(4): 517 - 524. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Temam, O. Casiraghi, J.-B. Lahaye, J. Bosq, X. Zhou, M. Julieron, G. Mamelle, J. J. Lee, L. Mao, B. Luboinski, et al. Tetranucleotide Microsatellite Instability in Surgical Margins for Prediction of Local Recurrence of Head and Neck Squamous Cell Carcinoma Clin. Cancer Res., June 15, 2004; 10(12): 4022 - 4028. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. von Knobloch, H. Brandt, A. J. Schrader, A. Heidenreich, and R. Hofmann Molecular Serological Detection of DNA Alterations in Transitional Cell Carcinoma Is Highly Sensitive and Stage Independent Clin. Cancer Res., February 1, 2004; 10(3): 988 - 993. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Stemmer, M. Beau-Faller, E. Pencreac'h, E. Guerin, A. Schneider, D. Jaqmin, E. Quoix, M.-P. Gaub, and P. Oudet Use of Magnetic Beads for Plasma Cell-free DNA Extraction: Toward Automation of Plasma DNA Analysis for Molecular Diagnostics Clin. Chem., November 1, 2003; 49(11): 1953 - 1955. [Full Text] [PDF]
|
|
|
|
|
|
A. Bearzatto, D. Conte, M. Frattini, N. Zaffaroni, F. Andriani, D. Balestra, L. Tavecchio, M. G. Daidone, and G. Sozzi p16INK4A Hypermethylation Detected by Fluorescent Methylation-specific PCR in Plasmas from Non-Small Cell Lung Cancer Clin. Cancer Res., December 1, 2002; 8(12): 3782 - 3787. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-W. Chang, S. M. Lee, S. N. Goodman, G. Singer, S. K. R. Cho, L. J. Sokoll, F. J. Montz, R. Roden, Z. Zhang, D. W. Chan, et al. Assessment of Plasma DNA Levels, Allelic Imbalance, and CA 125 as Diagnostic Tests for Cancer J Natl Cancer Inst, November 20, 2002; 94(22): 1697 - 1703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-W. Chang, S. Z. Ali, S. K. R. Cho, R. J. Kurman, and I.-M. Shih Detection of Allelic Imbalance in Ascitic Supernatant by Digital Single Nucleotide Polymorphism Analysis Clin. Cancer Res., August 1, 2002; 8(8): 2580 - 2585. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Combaret, C. Audoynaud, I. Iacono, M.-C. Favrot, M. Schell, C. Bergeron, and A. Puisieux Circulating MYCN DNA as a Tumor-specific Marker in Neuroblastoma Patients Cancer Res., July 1, 2002; 62(13): 3646 - 3648. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Utting, W. Werner, R. Dahse, J. Schubert, and K. Junker Microsatellite Analysis of Free Tumor DNA in Urine, Serum, and Plasma of Patients: A Minimally Invasive Method for the Detection of Bladder Cancer Clin. Cancer Res., January 1, 2002; 8(1): 35 - 40. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Silva, F. Bonilla, H. Blons, F. Coulet, and P. Laurent-Puig Correspondence re: F. Coulet et al., Detection of Plasma Tumor DNA in Head and Neck Squamous Cell Carcinoma by Microsatellite Typing and p53 Mutation Analysis. Cancer Res., 60: 707-709, 2000. Cancer Res., December 1, 2001; 61(23): 8595 - 8596. [Full Text] [PDF]
|
|
|
|
|
|
N. Franco, S.-F. Picard, F. Mege, L. Arnould, and S. Lizard-Nacol Absence of Genetic Abnormalities in Fibroadenomas of the Breast Determined at p53 Gene Mutations and Microsatellite Alterations Cancer Res., November 1, 2001; 61(21): 7955 - 7958. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
