Cancer Research Meeting Calendar  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Korah, R. M.
Right arrow Articles by Wieder, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Korah, R. M.
Right arrow Articles by Wieder, R.
[Cancer Research 60, 733-740, February 1, 2000]
© 2000 American Association for Cancer Research


Tumor Biology

Basic Fibroblast Growth Factor Confers a Less Malignant Phenotype in MDA-MB-231 Human Breast Cancer Cells1

Reju M. Korah, Vilayvanh Sysounthone, Yosef Golowa and Robert Wieder2

Division of Medical Oncology, University of Medicine and Dentistry of New Jersey-New Jersey Medical School, Newark, New Jersey 07103


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Basic fibroblast growth factor (FGF-2) expression is associated with a more differentiated phenotype, earlier stage of disease, and a better prognosis in breast cancer patients. To determine whether expression of FGF-2 can cause a less malignant phenotype, we engineered MDA-MB-231 cells, a highly dedifferentiated, invasive breast cancer cell line, to express different isoforms of FGF-2. Cells expressed either cytoplasmic, nuclear, or a combination of both FGF-2 isoforms. Western blots of 2 M NaCl washes and of conditioned medium demonstrated that these cells did not export FGF-2. Cells expressing FGF-2 had levels of fibroblast growth factor receptors equivalent with those of control cells. Transformation was assayed by anchorage-independent colony formation and tumor formation in athymic mice. All of the constructs expressing various FGF-2 isoforms had a 60–70% reduction in colony formation in soft agar, but only cells expressing the Mr 18,000 FGF-2 isoform formed fewer and smaller tumors in mice. To determine potential mechanisms responsible for a less malignant phenotype, experiments measuring invasion in Matrigel, the secretion of matrix metalloprotease activity and migration in a modified Boyden chamber and in a patch wound motility assay were carried out. Cells expressing the Mr 18,000 cytoplasmic FGF-2 moiety had a 45% decrease in invasion in Matrigel compared to vector-transfected controls. Cells expressing Mr 18,000 FGF-2 had an increase in Mr 97,000 and Mr 48,000 collagenase, demonstrating that the decreased invasive potential was not due to a down-regulation of gelatinolytic or caseinolytic matrix metalloproteinases. However, motility was decreased in both assays, primarily in cells expressing Mr 18,000 FGF-2, whereas exogenous recombinant human FGF-2 had no effect. These studies demonstrate for the first time that FGF-2 expression can cause a less malignant phenotype in breast cancer cells, possibly as a result of decreased motility and invasion.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The transformation of benign mammary ductal epithelial cells into metastatic breast cancer requires the completion of a series of distinct steps, each of which imparts the cells with a new phenotype. These steps include, but are not limited to, the loss of polarity, acquisition of unlimited growth potential, loss of intercellular adhesion, acquisition of the capacity to bind to the basement membrane, cleave and migrate through the basement membrane, form new blood vessels, intravasate, exit the blood vessels at a metastatic site, invade, form a new blood supply, and proliferate at a metastatic site (1) . Additional epigenetic phenomena play necessary roles.

One of the most important angiogenesis factors in breast cancer cells is FGF-2.3 As mammary epithelial cells dedifferentiate, they acquire the capacity to export FGF-2 in a nonclassical manner. The extracellular FGF-2, in turn, causes vascular endothelial cells to migrate and proliferate. As breast cancer cells further dedifferentiate, they stop synthesizing FGF-2. The loss of intracellular FGF-2 is associated with a more malignant tendency in breast cancer in both premalignant and malignant lesions. Breast cysts lined by flattened epithelial cells of low malignant potential contain fluid with higher FGF-2 content than cysts lined with premalignant metaplastic epithelial cells (2) . Less FGF-2 mRNA can be detected in breast cancer biopsies than in nonmalignant breast biopsies (3 , 4) , and immunohistochemically detectable FGF-2 protein can be observed only in benign myoepithelial remnants and basement membranes surrounding tumors, and not in the malignant cells (5) . Clinically, low levels of FGF-2 in breast cancer are associated with a more malignant phenotype (6) , larger tumor size, later disease stage (7) , and worse overall and disease-free survival (6 , 7) .

Whereas these data demonstrate an association of FGF-2 with a more differentiated phenotype in breast cancer, it has not been determined whether FGF-2 can cause a more differentiated phenotype in breast cancer, particularly in light of prior, extensive data in fibroblasts that demonstrate FGF-2 to be a transforming factor. These prior data demonstrate that expression of low levels of FGF-2 linked to a signal peptide that permits classical secretion and autocrine stimulation of the cells (8 , 9) , as well as expression of high levels of intracellular unmodified FGF-2 (10 , 11) ; both result in transformation of NIH 3T3 cells. Both intracellular and autocrine signaling are required for transformation as demonstrated by abrogation of focus formation by neutralizing antibody to FGF-2. In these cells, overexpression and autocrine stimulation by FGF-2 is also correlated with increased locomotion (12 , 13) , increased invasion in Matrigel, and increased levels of activity of interstitial collagenases (14) . Expression of FGF-2 also induces increased colony formation in soft agar in SW13 adrenal carcinoma (15) and immortalized prostate cells (16) .

However, although causing increased migration in benign glial cells (17) , expression of FGF-2 does not induce tumor formation in these cells or in bladder carcinoma cells (18) and is not tumorigenic in a benign diploid rat mammary epithelial cell line (19) . These data would suggest that FGF-2 is not tumorigenic in all cell types but may have alternate and divergent roles in different cells. This supports a rationale for investigating a paradoxic role for FGF-2 in the transformation of breast cancer cells. Paradoxic roles for FGF-2 in breast cancer have already been demonstrated with respect to proliferation (20, 21, 22) and cell death (23 , 24) . Based on all of the available evidence, we hypothesize that the expression of FGF-2 can cause a more differentiated phenotype in breast cancer cells. For our studies, we selected MDA-MB-231 cells, a cell line that is a prototype for a highly dedifferentiated breast cancer cell. These cells lack estrogen receptor, have mutant p53, are highly invasive, and form tumors in athymic mice. They also lack expression of intracellular FGF-2. We transfected these cells with vectors coding for various isoforms of FGF-2 with cytoplasmic and nuclear localizing capabilities, with a rationale based on prior data suggesting different roles for the different isoforms of FGF-2 in transformation and proliferation (25, 26, 27) . In this study, we demonstrate for the first time that FGF-2 expression in breast cancer cells can reverse phenotypic features of malignancy, including migration, invasion, and tumor formation in vivo.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Culture Conditions.
Malignant human mammary epithelial cell line MDA-MB-231 was purchased from the American Type Culture Collection (Rockville, MD). The cells were cultured in standard medium consisting of DMEM, 2 mM glutamine, 10% heat-inactivated FCS, 50 units/ml penicillin, and 50 µg/ml streptomycin (Gemini Bio-Products, Calabasa, CA).

Construction of FGF-2 Expression Vectors and Transfected Cells.
The FGF vector was constructed by subcloning a 1000-bp EcoRI FGF-2 cDNA fragment (10) into the EcoRI unique cloning site of the pCI-neo (Promega, Madison, WI) expression vector 3' to a CMV immediate early promoter. This vector contains a SV40 enhancer/early promoter-linked bacterial neomycin phosphotransferase gene (Neo) downstream to the EcoRI cloning site (Fig. 1)Citation . To construct {Delta}A, the FGF vector was cleaved with restriction endonucleases SacII and ApaI, deleting 307 bases that encompass the three CUG codons upstream of the ApaI site located 11 bases 5' of the AUG classical start site of FGF-2. The endonuclease-cleaved ends were treated with Klenow fragment and religated. FGFval was constructed by creating a transition mutation at position 364 to change codon AUG to GUG, changing methionine to valine. A new 488-bp ApaI-BalI fragment was created by PCR amplification. The 5' primer was CGGCCGGGCCCCGCAGGGACCGTGGCA, which includes the ApaI site and the new GUG site 17 bases downstream. The 3' primer was GAGATTAGATGTGGCCATTAAAAT, which includes the BalI site. This fragment was digested with ApaI and BalI and used to replace the ApaI/BalI fragment of FGF to make construct FGFval coding for the Mr 24,000, Mr 22,000, and Mr 21,500 moieties. FGFval was cleaved with SacII, deleting 208 bp and the 5' most CUG site, and religated to form the construct {Delta}Sval coding for the Mr 22,000 and the Mr 21,500 FGF-2 proteins. The constructs were all sequenced.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Expression vectors used to transduce MDA-MB-231 cells. The parental vector, pCI-neo (Promega), contains a SV40-promoted bacterial neomycin phosphotransferase gene (Neor) and an immediate early CMV promoter. The FGF vector was constructed by subcloning a 1000-bp EcoRI FGF-2 cDNA fragment (10) into the unique EcoRI cloning site of the pCI-neo vector 3' to the CMV promoter. To construct {Delta}A, the FGF vector was cleaved with restriction endonucleases SacII and ApaI, deleting the three CUG codons upstream of the ApaI site 11 bases upstream to the AUG start site of FGF-2. FGFval was constructed by creating a transition mutation at position 364 to change codon AUG to GUG, changing methionine to valine, as described in "Materials and Methods." FGFval was cleaved with restriction endonuclease SacII, deleting the 5' most CUG site to form the construct {Delta}Sval. Bars above and below the ApaI and BalI sites of the FGF vector, respectively, represent the PCR primer sites.

 
MDA-MB-231 cells were incubated at 1 x 105 cells/60-mm-diameter tissue culture dish in standard medium. After 24 h, the cells were transfected with 2 µg of plasmid DNA of the various pCI-neo-based FGF-2 vectors using LipofectAMINE (Life Technologies, Inc., Gaithersburg, MD). G418 (neomycin analogue; Gemini Bio-Products) was added 24 h later to a concentration of 800 µg/ml, and the cells were selected for 12–18 days until control, nontransfected cells were completely nonviable. Both populations and clones were selected for evaluation, yielding similar results. The data presented here are from selected populations.

Western Blots.
Western blots were performed as described previously (20 , 27) using a mouse monoclonal antibody to human FGF-2 (Oncogene Science, Cambridge, MA) and to FGF receptors 1–4 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). All blots were carried out at least twice. Cell lysates were prepared as described previously (27) . Extraction and measurement of extracellular matrix-bound FGF-2 was carried out by 2 M NaCl wash and 10% trichloroacetic acid precipitation as described previously (27) . Exported FGF-2 was concentrated from 8 ml of conditioned medium (DMEM/0.5% BSA, obtained after a 48-h coincubation with a confluent cell monolayer) with 50 µl of heparin-Sepharose beads (Pharmacia, Piscataway, NJ). Conditioned medium was incubated with beads overnight at 4°C, washed twice for 1 h each with cold 0.5 M NaCl and 20 mM Tris-HCl (pH 7.4), precipitated by centrifugation at 5000 rpm, and solubilized in 2x SDS loading buffer.

Immunofluorescence.
FGF-2 was detected by immunofluorescence microscopy as described previously (27) , using a primary anti-FGF-2 mouse monoclonal antibody (Ab-3; Oncogene Sciences, Cambridge, MA). Fluorescence-tagged cells were visualized and photographed using an Olympus BX40 fluorescence microscope and an Olympus PM20 photographic system.

Cell Growth Kinetic Studies.
MDA-MB-231-derived cells were treated with 0.05% trypsin/0.53 mM EDTA (Life Technologies, Inc.) and incubated on 60-mm dishes at an initial density of 4.3 x 104 cells/dish in 4 ml of standard medium, with and without 0.5 ng/ml rhFGF-2 (R&D Systems, Minneapolis, MN). Cell numbers were manually counted using 0.2% trypan blue exclusion. Viability was consistently above 90%.

Patch Wound Technique of Scatter/Migration.
Cells were grown to confluence in 100-mm-diameter tissue culture dishes in standard medium and analyzed using a modified classical scratch wound method (28) . The medium was removed, and cells were gently scraped with a sterile razor blade to create four or five radial areas of clearing. The plates were washed twice with PBS, medium or medium containing rhFGF-2 was added, and the cells were permitted to scatter/migrate past the razor-drawn line into the area of clearing for 24 h. They were then stained with methylene blue. Four representative fields were photographed at x100 magnification, and the number of cells per photographic field that had migrated into the clear patch were counted. The experiment was repeated twice.

Transwell Migration.
The capacity of cells to migrate was assayed using a modified Boyden chamber with ethylene terephthalate filters with 8-µm pores (Becton Dickinson, Lincoln Park, NJ). MDA-MB-231 cells transfected with the control vector were compared with cells expressing the Mr 18,000 isoforms of FGF-2, either alone ({Delta}A) or in combination with the high molecular weight forms (FGF) or the high molecular weight forms alone (FGFval). A total of 1.0 x 104 cells were incubated in the top chamber of triplicate wells in 300 µl of serum-free medium consisting of standard medium with 0.5% BSA replacing the FCS to measure chemokinesis or in standard medium to measure nondirectional migration. The cells were allowed to migrate for 4 h, and then they were stained and counted. The bottom chamber also contained standard medium with 10% FCS. The experiments was repeated four times.

Matrigel Invasion.
The invasive capacity was assayed in the same modified Boyden chambers with ethylene terephthalate filters with 8 µm pores used for invasion studies (29) . A total of 105 cells were mixed with 15 µl of Matrigel in standard medium and allowed to invade for 8 h at 37°C to assess invasion. The bottom chamber also contained standard medium. Cells were fixed in 4% paraformaldehyde, stained with methylene blue, counted, and photographed.

Matrix Metalloprotease Assays.
The release of matrix metalloproteases with gelatinolytic and caseinolytic activities was assayed using 10% zymogram gelatin ready gels and 12% zymogram casein ready gels (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. A total of 50 µl of conditioned medium (DMEM/0.5% BSA coincubated with confluent cell monolayers for 48 h) was loaded per well.

Colony Formation in Soft Agar.
Colony formation in soft agar was determined in 0.3% Bacto Agar (Difco Laboratories, Detroit, MI), 0.67x DMEM, and 6.7% heat-inactivated FCS overlaying a preformed 0.6% agar layer. Plates (35 mm in diameter) containing 1000 cells in agar were incubated at 37°C in 5% CO2, and colonies containing >30 cells were counted under the microscope at 12 ± 2 days as reported previously (11) .

In Vivo Xenograft Tumor Formation in Mice.
Five million freshly trypsinized semiconfluent cells were injected s.c. over the scapulae of 6-week-old female NCr nu/nu or BALB/c athymic mice (Taconic Farms, Germantown, NY) under an Institutional Animal Care and Use Committee-approved protocol. Tumor sizes were measured weekly using calipers, and volume was estimated using the formula length x width2/2 (cm3; Ref. 30 ). After 10 weeks, tumors were excised and weighed. Fresh tumors were minced in medium containing 0.01% collagenase (Sigma, St. Louis, MO), and single cell suspensions were incubated the following day in tissue culture with and without G418. Neomycin-resistant cells were selected and used for detection of intracellular and/or exported FGF-2, as described previously.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterization of Transfected Cells.
Lysates were electrophoresed and analyzed by Western blot. Fig. 2ACitation demonstrates the expected pattern of FGF-2 expression: (a) Mr 24,000, Mr 22,000, and Mr 18,000 species in the cells transfected with the FGF vector; (b) Mr 24,000 and Mr 22,000 species in cells transfected with the FGFval vector; (c) the Mr 22,000 species in the cells transfected with the {Delta}Sval vector; and (d) the Mr 18,000 species in the cells transfected with the {Delta}A vector. Low levels of expression of Mr 18,000 FGF-2 species are also noted in FGFval and {Delta}Sval in addition to the predominant species, demonstrating background levels of valine initiated protein from the mutant GUG codon (31) . Immunofluorescence photographs confirmed that the FGF-2 species expressed in the various cell constructs were distributed in the cells as expected. Cells expressing the FGF vector were positive for FGF-2 staining in both the cytoplasm and the nucleus; cells expressing the FGFval vector (and the {Delta}Sval vector; data not shown) stained primarily in the nucleus, whereas cells expressing the {Delta}A vector stained positively only in the cytoplasm (Fig. 2B)Citation . Because {Delta}Sval cells behaved similarly to FGFval cells, they were not further characterized. MDA-MB-231 cells transfected with the Neo vector did not express FGF-2.



View larger version (83K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Western immunoblots of lysates (A), 2 M NaCl washes (C), and conditioned medium (D) from MDA-MB-231 cells transfected with vectors expressing various FGF-2 isoforms. rhFGF-2 was used as a control in all of the Western blots. B, immunofluorescence photomicrographs of MDA-MB-231 cells stained with antibody to FGF-2 demonstrating ubiquitous, nuclear, and cytoplasmic localization of FGF species in cells transfected with the FGF, FGFval, and {Delta}A vectors, respectively. No staining was present in pCI-neo (Neo)-transfected controls.

 
Cells were analyzed for the capacity to export FGF-2. We have previously demonstrated that MCF-7 cells engineered to express FGF-2 are capable of exporting all of the isoforms (11 , 27) . These cells were used as positive controls in the NaCl wash and conditioned medium Western blots and confirmed our published data (11 , 27) . In contrast, MDA-MB-231 cells engineered to express FGF-2 did not export FGF-2 to their extracellular milieu. FGF-2 was not detectable on Western blots of trichloroacetic acid-precipitated 2 M NaCl washes of confluent MDA-MB-231 cells expressing various FGF-2 constructs (Fig. 2C)Citation . Because MDA-MB-231 cells have a reduced quantity of heparan sulfate proteoglycans compared with MCF-7 cells (32) , permitting any potential extracellular FGF-2 to remain in solution in the conditioned medium, we also analyzed heparin beads incubated with conditioned medium from the various cell constructs by Western blot (Fig. 2D)Citation . These data also demonstrated that at a level of sensitivity of much less than 0.2 ng/8 ml, FGF-2 was not detectable in the conditioned medium of the MDA-MB-231 cell constructs. The conditioned medium from the MCF-7/FGF construct was positive for FGF-2. To support the data demonstrating a lack of extracellular FGF-2 in cells expressing the various FGF-2 isoforms, we confirmed that FGF receptors in the four cell types were not down-regulated by stimulation from exported FGF-2. Western blots in Fig. 3Citation demonstrate that the levels of FGF receptors 1 and 3 were unchanged in the cells expressing any of the FGF-2 isoforms as compared to the Neo-transfected cells. FGF receptor 2 levels were very low on Western blots of MDA-MB-231 cells, and FGF receptor 4 levels were undetectable (data not shown).



View larger version (75K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Western immunoblots of FGF receptors in the four cell constructs. A total of 100 µg of protein from lysates from the four cell constructs transfected with vectors expressing various FGF-2 isoforms and control vector were electrophoresed and analyzed by Western blot with antibodies to FGF receptors 1 and 3 and developed using a chemiluminescence detection system.

 
Proliferation.
The doubling time Tc of the various cell constructs was calculated using the formula Tc = 0.3T/log A/A0, where A is the number of cells at time T of proliferation, and Ao is the number of cells at an initial time point (33) . The data depicted in Table 1Citation demonstrate that neither recombinant FGF-2 nor the expression of any of the isoforms individually or in combination had a significant effect on the doubling time of MDA-MB-231 cells. This was in contrast to the effects observed in MCF-7 cells, which were growth-inhibited by both endogenous overexpression and exogenous incubation with recombinant FGF-2 (P < 0.05 for both compared with control MCF-7 cells), as demonstrated previously (20 , 27) .


View this table:
[in this window]
[in a new window]

 
Table 1 Effect of FGF-2 on the doubling time of MDA-MB-231 and MCF-7 breast cancer cells

 
Anchorage-independent Growth.
To determine whether FGF-2 inhibited anchorage-independent colony formation, a hallmark in vitro characteristic of transformation, the transfected cells were incubated in a soft agar culture system, and colony formation was counted 12 ± 2 days later. Fig. 4Citation shows the results of a typical experiment demonstrating a significant decrease in colony formation in soft agar by MDA-MB-231 cells expressing FGF-2 isoforms that localized exclusively in the cytoplasm ({Delta}A), exclusively in the nucleus (FGFval), or a combination of the two (FGF). Neo-transfected control cells formed 620 ± 73 colonies, whereas FGF-transfected cells formed 265 ± 79 colonies, FGFval-transfected cells formed 209 ± 61 colonies, and {Delta}A-transfected cells formed 179 ± 48 colonies (P < 0.001 for all cells compared with Neo). The data demonstrate that expression of FGF-2 isoforms decreased in vitro colony formation by MDA-MB-231 cells, an effect that is not attributable to a decrease in proliferative capacity.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Colony-forming capacity of MDA-MB-231 cells expressing the various FGF-2 isoforms in 0.3% soft agar. One thousand cells per dish were incubated for 12 ± 2 days at 37°C in 5% CO2, and colonies of >30 cells were counted.

 
In Vivo Tumor Formation.
To determine whether the effects on the in vitro phenotype translated to in vivo effects on tumorigenicity, a xenograft tumor model in athymic mice was used. A total of 5 x 106 cells/mouse were injected s.c. into three sets of athymic mice, and tumor formation was determined as outlined in "Materials and Methods." Sets of five NCr nu/nu mice were injected with all four cell constructs in two experiments, and sets of four BALB/c nu/nu mice were injected with the Neo and the FGF cell constructs in a third experiment. Table 2Citation demonstrates the results of a representative experiment with NCr nu/nu mice and the efficiency of tumor formation calculated from all of the experiments. In the experiment shown, the size of the tumors formed by cells transfected with the {Delta}A vector was significantly smaller than the size of tumors formed by cells transfected with the Neo vector. Cell constructs expressing all of the FGF-2 isoforms (FGF) and cells expressing only Mr 18,000 FGF-2 ({Delta}A) had a lower rate of tumor formation than the Neo controls. In contrast, all of the mice injected with cells expressing only the high molecular weight FGF-2 isoforms (FGFval) formed tumors. The results were similar, and the differences were highly significant compared to the Neo controls (Student’s t test) when data from the three sets of mice were combined.


View this table:
[in this window]
[in a new window]

 
Table 2 Xenograft tumor formation in athymic mice

 
The tumors were excised and minced, and cells were cultured to confluence in 800 µg/ml G418. Western blots of cell lysates and conditioned medium from confluent dishes were carried out to determine whether they were still expressing FGF-2 after in vivo passage and whether they had acquired a capacity to export FGF-2. Fig. 5Citation demonstrates that all of the cells from the experiment shown in Table 2Citation that continued to express FGF-2 after in vivo passage have acquired the capacity to export FGF-2. One of the tumors formed with {Delta}A-transfected cells no longer expressed detectable FGF-2 by Western blot. This was the larger of the two by far and essentially represented a Neo-transfected cell. In another set of animals, three of five NCr nu/nu mice injected with {Delta}A-expressing cells formed tumors, but none of the cultured cells from these excised tumors expressed FGF-2 any longer (data not shown). Thus, the rate of tumor formation by {Delta}A cells in the two experiments carried out in NCr nu/nu mice was 13% when the mice with the non-FGF-2-producing tumors were subtracted from the denominator (the mean of 1 of 4 and 0 of 2). These data suggest that there is a strong negative selective pressure in vivo against cells expressing Mr 18,000 FGF-2 in MDA-MB-231 cells.



View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Western immunoblots of lysates and conditioned medium from cells cultured and G418-selected from tumors excised from mice. Medium conditioned by a 48-h coculture with confluent cultures of cells obtained from excised tumors was incubated with heparin-Sepharose beads, and the bound FGF-2 was assayed by Western blot along with lysates from the cultured cells. The blots were stained with anti-FGF-2 antibody and developed using a chemiluminescence detection system. The mouse number in which the particular Neo, FGF, HMW, or {Delta}A tumors from which the cells were cultured are indicated.

 
Invasion in Matrigel.
To further deduce the aspects of transformation affected by FGF-2 expression, we assayed invasive capacity in Matrigel using the modified Boyden chamber assay. Fig. 6Citation demonstrates that expression of Mr 18,000 FGF-2 inhibited the invasive potential of MDA-MB-231 cells by approximately 45%. The invasive potential was not modulated by treatment with estradiol or rhFGF-2 (data not shown).



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Invasion of breast cancer cells expressing various FGF-2 isoforms in Matrigel-coated modified Boyden chambers with 8-µm pores. MDA-MB-231 cells were incubated at 1.0 x 105 cells/chamber for 8 h. The filters were stained with methylene blue and counted at x100 magnification.

 
Matrix Metalloprotease Production.
To determine whether the decrease in invasive potential was due to a change in matrix metalloprotease production, conditioned media were tested for levels of released metalloproteases in zymogen assays. Fig. 7Citation demonstrates that the level of gelatinase (Mr 97,000 type IV collagenase) activity in a gelatin/SDS polyacrylamide gel was increased in MDA-MB-231 cells expressing all FGF-2 isoforms, with the greatest increase in cells expressing Mr 18,000 FGF-2. Gelatinolytic activity also increased with the addition of recombinant FGF-2. In a casein/SDS polyacrylamide gel, the level of caseinolytic protease (Mr 72,000 type IV collagenase) was also found to be elevated primarily in MDA-MB-231 cells expressing Mr 18,000 FGF-2 and with recombinant FGF-2. These experiments demonstrate that the decreased invasive potential in these cells was not due to a down-regulation of gelatinolytic or caseinolytic matrix metalloproteinases.



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Negative images of photographs taken of zymogen gels electrophoresed with conditioned medium from the MDA-MB-231 cells expressing the various FGF-2 isoforms. Fifty µl of conditioned medium from each dish were electrophoresed in a 12% SDS polyacrylamide gel containing 0.1% gelatin in the MMP-9 gel and 0.1% casein in the MMP-2 gel. The MMPs in the gel were activated after electrophoresis in a 37°C bath for 16 h, stained with Coomassie Blue, and photographed.

 
Effects of FGF-2 Expression on Migration and Scatter.
The patch wound repair assay was used to determine the capacity of cells to scatter and migrate randomly. Cells that have migrated past the razor line (Fig. 8A)Citation in four or more random photographic fields were counted, and the means and SDs were graphed (Fig. 8B)Citation . Fig. 8Citation shows the results of a representative experiment and demonstrates that MDA-MB-231 cells expressing the Mr 18,000 species of FGF-2 ({Delta}A-transfected cells) had significantly less scatter at 24 h than vector-transfected controls (P < 0.001). The differences between vector-transfected cells and cells transfected with either FGF or FGFval were not statistically significant. To confirm that the observed effects were due to intracellular FGF-2 and not autocrine signaling, the effects of rhFGF-2 were determined on scatter migration. Fig. 8CCitation demonstrates that neither 1 nor 10 ng/ml FGF-2 inhibited migration of MDA-MB-231 cells in this assay. These data demonstrate that the expression of the Mr 18,000 FGF-2 species can decrease scatter and random migration in MDA-MB-231 cells.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Scatter/migration of MDA-MB-231 cells expressing the various FGF-2 isoforms. A, photomicrographs (x250) of representative fields of cells that scattered from confluent cultures that were stained with methylene blue 24 h after a patch was cleared by a razor blade (the arrow represents the starting point). B, graphic representation of four fields that were photographed and counted. Error bars, SDs. C, scatter migration assay of Neo vector-transfected MDA-MB-231 cells comparing the effects of expressing Mr 18,000 FGF-2 with those of exogenous recombinant FGF-2. D, migration of breast cancer cells expressing various FGF-2 isoforms in a modified Boyden chamber with 8-µm pores. MDA-MB-231 cells were incubated at 1 x 104 cells/chamber for 4 h. The filters were stained with methylene blue and counted at x100 magnification.

 
Migration was also assessed in modified Boyden chambers using 10% serum in the lower chamber as a chemoattractant. Fig. 8DCitation demonstrates that MDA-MB-231 cells expressing the Mr 18,000 isoforms of FGF-2, either alone ({Delta}A) or in combination with the higher molecular weight forms (FGF), were inhibited from migrating. Counting cells that migrated over 4 h demonstrated that for 625 ± 25 Neo-transfected control cells that migrated, 450 ± 50 FGF-transfected cells (P < 0.002) and 325 ± 25 {Delta}A-transfected cells (P < 0.001) migrated. Cells that were transfected with FGFval did not have inhibited migratory capacity. The assays were repeated with the same serum-containing standard medium in the upper and lower chambers and yielded similar results of migration inhibition by Mr 18,000 FGF-2. Addition of exogenous rhFGF-2 or estradiol to the medium had no effect on the migratory response of parental MDA-MB-231 cells or derivatives expressing various isoforms of FGF-2 (data not shown).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Experiments performed in this study demonstrate for the first time that expression of FGF-2 in an estrogen receptor-negative breast cancer cell line with mutated p53 induces a less malignant phenotype, both in vitro and in vivo. Cells that express FGF-2 form fewer colonies in soft agar and form fewer and smaller tumors than controls in athymic mice. The cells selected for this study, MDA-MB-231 cells, are highly dedifferentiated and are not capable of exporting FGF-2. FGF-2 was not detected in either Western blots of conditioned medium or 2 M NaCl washes of confluent layers of FGF-2-expressing cells. FGF receptor levels were not altered in any of the cells expressing the different FGF-2 isoforms. In addition, extracellular rhFGF-2 had no effect on migration. These data, taken together, suggest that the demonstrated phenotypic effects were due to the intracellular effects of FGF-2.

Whereas the effects on colony formation were observed in cells expressing all of the FGF-2 isotypes, the decrease in the efficiency of in vivo tumor formation was only observed in cells expressing the Mr 18,000 cytoplasm-localizing species. Cells expressing the high molecular weight FGF-2 species (FGFval) were still capable of expressing a low level of the Mr 18,000 FGF-2 species, probably due to background levels of valine tRNA initiation at GUG (31) . This level of expression was probably sufficient to inhibit soft agar colony formation. Mechanisms responsible for the intracytoplasmic FGF-2 signaling are not known.

The inhibition of tumor formation by Mr 18,000 cytoplasmic FGF-2 was profound. Because of the powerful negative selective advantage of cells expressing Mr 18,000 FGF-2, a majority of {Delta}A tumors, and, in particular, those that grew faster, did not express detectable levels of FGF-2 after they were excised and cultured. There was no such negative selective advantage in cells expressing other forms of FGF-2. In fact, mice injected with cells expressing HMW FGF-2 had a 100% rate of tumor formation. This phenomenon may have been due to an acquired angiogenic phenotype in these cells. All of the cells cultured from excised tumors under G418 selection that still expressed FGF-2 had acquired the ability to export FGF-2. Although MDA-MB-231 cells engineered to express FGF-2 lack the capacity to export these proteins during in vitro passage, we have previously demonstrated that MCF-7 cells engineered to overexpress FGF-2 are capable of exporting all of the isoforms of FGF-2, in contrast to fibroblasts that only export Mr 18,000 FGF-2 (27) . The export mechanism of FGF-2 is not understood, but data have demonstrated an association with an energy-dependent mechanism (34) involving the {alpha}1 subunit of Na+,K+-ATPase (35) . The expression of this subunit is induced by differentiation agents (36) . We hypothesize that the shift in the capacity of cells that formed tumors to export FGF-2 was due to a selection mechanism for cells more capable of inducing angiogenesis. Indeed, there was a distinct increase in the number of blood vessels per high-power field in tumors formed by cells expressing HMW forms of FGF-2 (data not shown), possibly providing the selective advantage able to account for the 100% rate of tumor formation and continued expression of FGF-2 in 100% of these cells. However, it appears that Mr 18,000 FGF-2 is insufficient by itself to induce the angiogenic effects. We postulate that the primary function of the Mr 18,000 isoform of FGF-2 was to inhibit intrinsic tumor growth in vivo.

The experiments that followed attempted to identify components of tumorigenicity affected by FGF-2 that may be responsible for the overall phenotype. We first studied an in vitro invasion model. We demonstrated that, once again, it was the cytoplasm-localizing FGF-2 isoform that was responsible for inhibiting invasion, whereas other constructs did not have a consistent, statistically significant effect. Invasion is a phenotype that results from the accumulation of several effects, including induction of MMPs, dissolution of the matrix by these MMPs, and a subsequent migration of the cell into the hole they created in the matrix.

FGF-2 can cause an increased production and activity of MMPs (37, 38, 39, 40, 41) , which would not explain the decreased invasion observed. Indeed, our results confirm that both intracellular and exogenous recombinant Mr 18,000 FGF-2 caused an up-regulation in the activity of both gelatinolytic and caseinolytic MMPs in these cells. The mechanism of decreased migration in these cells is most likely not due to a decrease in MMP levels, although an up-regulation of MMP inhibitors by FGF-2 cannot be excluded (37 , 38) . However, a dissociation between MMP-9/tissue inhibitors of metalloproteases balance and migratory and invasive capacity has been demonstrated (42) . This suggests that other components of invasion are implicated. We investigated migration using several assays.

Using two assays and two conditions, one using a serum gradient as a chemoattractant and another assaying for scatter migration, and under two conditions, our data indicated that cells expressing Mr 18,000 FGF-2 migrated slower than controls, suggesting an intrinsic effect on the mechanism of migration by intracellular FGF-2. The expression of all isoforms of FGF-2 (FGF cells) also had a small inhibitory effect on migration in the transwell assay, whereas it had no effect on invasion through Matrigel in the same chambers. This may be due to opposing effects of the induced MMP-9 and the inhibitory effects of intracellular Mr 18,000 FGF-2 on migration, although there are too many unknown factors mediating the process to explain small differences. Extracellular rhFGF-2 had no clear effect on the scatter migration of these cells. Others have shown, however, that extracellular FGF induces migration mediated through FGF receptors (43 , 44) through urokinase-type plasminogen activator and urokinase-type plasminogen activator receptor as well as hepatocyte growth factor intermediates (45) through Src-mediated pathways (46) . In smooth muscle cells, FGF induces motility on collagen by up-regulating integrins (47) .

One potential mechanism for the decreased motility observed in these cells may be an effect on adhesion. Cells adhere to their substratum via cell surface integrins and form focal adhesion complexes (48) . Prior studies have demonstrated that recombinant FGF-2 (49) or FGF receptor-dependent autocrine signaling by Mr 18,000 FGF-2 (50) can cause an increase in both {alpha} and ß classes of integrins. Motility depends on an ordered series of events that require cell polarization, membrane extension into a lamellapodium, attachment of the leading edge to the substratum, traction by stress fibers formed from the leading edge, and release of the lagging end of the cell (48) . This cycle of adhesion and deadhesion is governed by aggregation and activation of a number of proteins into focal adhesion complexes at the membrane that serve as the initiation of downstream signaling. Several studies have demonstrated that intermediate levels of adherence are needed for optimal migration and that increasing or decreasing adherence decreases the rate of cell migration (51, 52, 53) . One possible explanation of the observed effects on migration is that expression of Mr 18,000 FGF-2 modifies the strength of adhesion of MDA-MB-231 cells to its substratum. These effects and potential regulation of integrins and the formation and activation of focal adhesion complexes by FGF-2 are being investigated.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by Career Development Award DAMD17-94-J-4463 from the United States Army Breast Cancer Research Program (to R. W.) and Grant 24-99 from the Foundation of the University of Medicine and Dentistry of New Jersey (to R. K.). Back

2 To whom requests for reprints should be addressed, at University of Medicine and Dentistry of New Jersey-New Jersey Medical School, MSB I-594, 185 South Orange Avenue, Newark, New Jersey 07103. Phone: (973) 972-4871; Fax: (973) 972-2384. Back

3 The abbreviations used are: FGF-2, basic fibroblast growth factor; rhFGF-2, recombinant human FGF-2; FGF, fibroblast growth factor; CMV, cytomegalovirus; HMW, high molecular weight; MMP, matrix metalloprotease. Back

Received 6/ 9/99. Accepted 11/24/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Meyer T., Hart I. R. Mechanisms of tumour metastasis. Eur. J. Cancer, 34: 214-221, 1998.
  2. Lai L. C., Sirah A. K., Erbas H., Lennard T. W. J. Relationship between basic fibroblast growth factor and transforming growth factor-ß2 in breast cyst fluid. J. Clin. Endocrinol. Metab., 80: 711-714, 1995.[Abstract]
  3. Luqmani Y. A., Graham M., Coombes R. C. Expression of basic fibroblast growth factor, FGFR1 and FGFR2 in normal and malignant human breast, and comparison with other normal tissues. Br. J. Cancer, 66: 273-280, 1992.[Medline]
  4. Anandappa S. Y., Winstanley J. H. R., Leinster S., Green B., Rudland P. S., Barraclough R. Comparative expression of fibroblast growth factor mRNAs in benign and malignant breast disease. Br. J. Cancer, 69: 772-776, 1994.[Medline]
  5. Gomm J. J., Smith J., Ryall G. K., Baille R., Turnbull L., Coombes R. C. Localization of basic fibroblast growth factor and transforming growth factor ß1 in the human mammary gland. Cancer Res., 51: 4685-4692, 1991.[Abstract/Free Full Text]
  6. Yiangou C., Gomm J. J., Coope R. C., Law M., Luqmani Y. A., Shousha S., Coombes R. C., Johnston C. L. Fibroblast growth factor 2 in breast cancer: occurrence and prognostic significance. Br. J. Cancer, 75: 28-33, 1997.[Medline]
  7. Colomer R., Aparicio J., Montero S., Guzman C., Larrodera L., Cortes-Funes H. Low levels of basic fibroblast growth factor (bFGF) are associated with a poor prognosis in human breast carcinoma. Br. J. Cancer, 76: 1215-1220, 1997.[Medline]
  8. Rogelj S., Weinberg R. A., Fanning P., Klagsbbrun M. Basic fibroblast growth factor fused to a signal peptide transforms cells. Nature (Lond.), 331: 173-175, 1988.[Medline]
  9. Blam S. B., Mitchell R., Tischer E., Rubin J. S., Silva M., Silver S., Fiddes J. C., Abraham J. A., Aaronson S. A. Addition of growth hormone secretion signal to basic fibroblast growth factor results in cell transformation and secretion of aberrant forms of the protein. Oncogene, 3: 129-136, 1988.[Medline]
  10. Quarto N., Talarico D., Sommer A., Florkiewitz R., Basilico C., Rifkin D. B. Transformation by basic fibroblast growth factor requires high levels of expression: comparison with transformation by hst/K-fgf. Oncogene Res., 5: 101-110, 1989.[Medline]
  11. Wieder R., Wang H., Shirke S., Wang Q., Menzel T., Feirt N., Jakubowski A. A., Gabrilove J. L. Low level expression of basic FGF upregulates Bcl-2 and delays apoptosis, but high intracellular levels are required to induce transformation in NIH 3T3 cells. Growth Factors, 15: 41-60, 1997.[Medline]
  12. Mignatti P., Morimoto T., Rifkin D. B. Basic fibroblast growth factor released by single, isolated cell stimulates their migration in an autocrine manner. Proc. Natl. Acad. Sci. USA, 88: 11007-11011, 1991.[Abstract/Free Full Text]
  13. Taylor W. R., Greenberg A. H., Turley E. A., Wright J. A. Cell motility, invasion, and malignancy induced by overexpression of K-FGF or bFGF. Exp. Cell Res., 204: 295-301, 1993.[Medline]
  14. Gately S., Tsanaclis A. M. C., Takanao S., Klagsbrun M., Brem S. Cells transfected with the basic fibroblast growth factor gene fused to a signal sequence are invasive in vitro and in situ in the brain. Neurosurgery, 36: 780-788, 1995.[Medline]
  15. Corin S. J., Chen L. C., Hamburger A. W. Enhancement of anchorage-independent growth of a human adrenal carcinoma cell line by endogenously produced basic fibroblast growth factor. Int. J. Cancer, 46: 516-521, 1990.[Medline]
  16. Ropiquet F., Berthon P., Villette J-M., Le Brun G., Maitland N. J., Cussenot O., Fiet J. Constitutive expression of FGF2/bFGF in non-tumorigenic human prostatic epithelial cells results in the acquisition of a partial neoplastic phenotype. Int. J. Cancer, 72: 543-547, 1997.[Medline]
  17. Holland E. C., Varmus H. E. Basic fibroblast growth factor induces cell migration and proliferation after glia-specific gene transfer in mice. Proc. Natl. Acad. Sci. USA, 95: 1218-1222, 1998.[Abstract/Free Full Text]
  18. Jouanneau J., Plouet J., Moens G., Thiery J. P. FGF-2 and FGF-1 expressed in rat bladder carcinoma cells have similar angiogenic potential but different tumorigenic properties in vivo. Oncogene, 14: 671-676, 1997.[Medline]
  19. Davies B. R., Fernig D. G., Barraclough R., Rudland P. S. Effect on tumorigenicity and metastasis of transfection of a diploid benign rat mammary epithelial cell line with DNA corresponding to the mRNA for basic fibroblast growth factor. Int. J. Cancer, 65: 104-111, 1996.[Medline]
  20. Fenig E., Wieder R., Paglin S., Wang H., Persaud R., Haimovitz-Friedman A., Fuks Z., Yahalom J. Basic fibroblast growth factor confers growth inhibition and mitogen-activated protein kinase activation in human breast cancer cells. Clin. Cancer Res., 3: 135-142, 1997.[Abstract]
  21. Wang H., Rubin M., Fenig E., DeBlasio T., Mendelsohn J., Yahalom J., Wieder R. Basic FGF causes growth arrest in MCF-7 human breast cancer cells while inducing both mitogenic and inhibitory G1 events. Cancer Res., 57: 1750-1757, 1997.[Abstract/Free Full Text]
  22. Johnson M. R., Valentine C., Basilico C., Mansukhani A. FGF signaling activates STAT1 and p21 and inhibits the estrogen response and proliferation of MCF-7 cells. Oncogene, 16: 2647-2656, 1998.[Medline]
  23. Wang Q., Maloof P., Wang H., Fenig E., Stein D., Nichols G., Denny T. N., Yahalom J., Wieder R. Basic fibroblast growth factor (bFGF) downregulates Bcl-2 and promotes apoptosis in MCF-7 human breast cancer cells. Exp. Cell Res., 238: 177-187, 1998.[Medline]
  24. Maloof P., Wang Q., Wang H., Stein D., Denny T. N., Yahalom J., Wieder R. Overexpression of retrovirally transduced basic FGF in MCF-7 human breast cancer cells downregulates Bcl-2 and sensitizes cells to chemotherapy-induced apoptosis. Breast Cancer Res. Treat., 56: 153-167, 1999.[Medline]
  25. Bugler B., Amalric F., Prats H. Alternative initiation of translation determines cytoplasmic or nuclear localization of basic fibroblast growth factor. Mol. Cell. Biol., 11: 573-577, 1991.[Abstract/Free Full Text]
  26. Couderc B., Prats H., Bayard F., Amalric F. Potential oncogenic effects of basic fibroblast growth factor requires cooperation between CUG and AUG-initiated forms. Cell Regul., 2: 709-718, 1991.[Medline]
  27. Wieder R., Fenig E., Wang H., Wang Q., Paglin S., Menzel T., Gabrilove J., Fuks Z., Yahalom J. Overexpression of basic fibroblast growth factor in MCF-7 human breast cancer cells: lack of correlation between inhibition of cell growth and MAP kinase activation. J. Cell. Physiol., 177: 411-425, 1998.[Medline]
  28. Tamura M., Gu J., Matsumoto K., Parsons R., Yamada K. Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science (Washington DC), 280: 1614-1617, 1998.[Abstract/Free Full Text]
  29. Lochter A., Srebrow A., Sympson C. J., Terracio N., Werb Z., Bissell M. J. Misregulation of stromelysin-1 expression in mouse mammary tumor cells accompanies acquisition of stromelysin-1-dependent invasive properties. J. Biol. Chem., 272: 5007-5015, 1997.[Abstract/Free Full Text]
  30. Light B. J., Yu W-D., McElwain M. C., Russell D. M., Trump D. L., Johnson C. S. Potentiation of cisplatin tumor activity using a vitamin D analogue in a murine squamous cell carcinoma model system. Cancer Res., 57: 3759-3764, 1997.[Abstract/Free Full Text]
  31. Drabkin H. J., Raj Bhandary U. L. Initiation of protein synthesis in mammalian cells with codons other than AUG and amino acids other than methionine. Mol. Cell. Biol., 18: 5140-5147, 1998.[Abstract/Free Full Text]
  32. Delehedde M., Deudon E., Boilly B., Hondermarck H. Production of sulfated proteoglycans by human breast cancer cell lines: binding to fibroblast growth factor-2. J. Cell. Biochem., 64: 605-617, 1997.[Medline]
  33. Wieder R. Selection of methods for measuring proliferation Studzinski G. eds. . Cell Growth, Differentiation and Senescence: A Practical Approach, : 1-32, Oxford University Press New York 1999.
  34. Florkiewicz R. Z., Majack R. A., Buechler R. D., Florkiewicz E. Quantitative export of FGF-2 occurs through an alternative, energy-dependent, non-ER/Golgi pathway. J. Cell. Physiol., 162: 388-399, 1995.[Medline]
  35. Florkiewicz R. Z., Anchin J., Baird A. The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+, K+-ATPase. J. Biol. Chem., 273: 544-551, 1998.[Abstract/Free Full Text]
  36. Kester H. A., van der Leede B. M., van der Saag P. T., van der Burg B. Novel progesterone target genes identified by an improved differential display technique suggest that progestin-induced growth inhibition of breast cancer cells coincides with enhancement of differentiation. J. Biol. Chem., 272: 16637-16643, 1997.[Abstract/Free Full Text]
  37. Miyagi N., Kato S., Terasaki M., Shigemori M., Morimatsu M. Fibroblast growth factor-2 and -9 regulate proliferation and production of matrix metalloproteinases in human gliomas. Int. J. Oncol., 12: 1085-1090, 1998.[Medline]
  38. Pickering J. G., Ford C. M., Tang B., Chow L. H. Coordinated effects of fibroblast growth factor-2 on expression of fibrillar collagens, matrix metalloproteinases, and tissue inhibitors of matrix metalloproteinases by human vascular smooth muscle cells. Evidence for repressed collagen production and activated degradative capacity. Arterioscler. Thromb. Vasc. Biol., 17: 475-482, 1997.[Abstract/Free Full Text]
  39. Miyake H., Hara I., Yoshimura K., Eto H., Arakawa S., Wada S., Chihara K., Kamidono S. Introduction of basic fibroblast growth factor gene into mouse renal cell carcinoma cell line enhances its metastatic potential. Cancer Res., 56: 2440-2445, 1996.[Abstract/Free Full Text]
  40. Uria J. A., Balbin M., Lopez J. M., Alvarez J., Vizoso F., Takigawa M., Lopez-Otin C. Collagenase-3 (MMP-13) expression in chondrosarcoma cells and its regulation by basic fibroblast growth factor. Am. J. Pathol., 153: 91-101, 1998.[Abstract/Free Full Text]
  41. Newberry E. P., Willis D., Latifi T., Bourdreaux J. M., Towler D. A. Fibroblast growth factor receptor signaling activates the human interstitial collagenase promoter via the bipartite Ets-Ap1 element. Mol. Endocrinol., 11: 1129-1144, 1997.[Abstract/Free Full Text]
  42. Puyraimond A., Weitzman J. B., Babiole E., Menashi S. Examining the relationship between the gelatinolytic balance and the invasive capacity of endothelial cells. J. Cell Sci., 112: 1283-1290, 1999.[Abstract]
  43. Osterhout D. J., Ebner S., Xu J., Ornitz D. M., Zazanis G. A., McKinnon R. D. Transplanted oligodendrocyte progenitor cells expressing a dominant negative FGF receptor transgene fail to migrate in vivo. J. Neurosci., 17: 9122-9132, 1997.[Abstract/Free Full Text]
  44. Landgren E., Klint P., Yokote K., Claesson-Welsh L. Fibroblast growth factor receptor-1 mediates chemotaxis independently of direct SH2-domain protein binding. Oncogene, 17: 283-291, 1998.[Medline]
  45. Cavallaro U., Wu Z., Di Palo A., Montesano R., Pepper M. S., Maier J. A., Soria M. R. FGF-2 stimulates migration of Kaposi’s sarcoma-like vascular cells by HGF-dependent relocalization of the urokinase receptor. FASEB J., 12: 1027-1034, 1998.[Abstract/Free Full Text]
  46. LaVallee T. M., Prudovsky I. A., McMahon G. A., Hu X., Maciag T. Activation of the MAP kinase pathway by FGF-1 correlates with cell proliferation induction while activation of the Src pathway correlates with migration. J. Cell Biol., 141: 1647-1658, 1998.[Abstract/Free Full Text]
  47. Pickering J. G., Uniyal S., Ford C. M., Chau T., Laurin M. A., Chow L. H., Ellis C. G., Fish J., Chan B. M. C. Fibroblast growth factor-2 potentiates vascular smooth muscle cell migration to platelet-derived growth factor: upregulation of {alpha}2ß1 integrin and disassembly of actin filaments. Circ. Res., 80: 627-637, 1997.[Abstract/Free Full Text]
  48. Lauffenburger D. A., Horwitz A. F. Cell migration: a physically integrated molecular process. Cell, 84: 359-369, 1996.[Medline]
  49. Klein S., Giancotti F. G., Presta M., Albelda S. M., Buck C. A., Rifkin D. B. Basic fibroblast growth factor modulates integrin expression in microvascular endothelial cells. Mol. Biol. Cell, 4: 973-982, 1993.[Abstract]
  50. Klein S., Bikfalvi A., Birkenmeier T. M., Giancotti F. P., Rifkin D. B. Integrin regulation by endogenous expression of 18-kDa fibroblast growth factor-2. J. Biol. Chem., 271: 22583-22590, 1996.[Abstract/Free Full Text]
  51. Keely P. J., Fong A. M., Zutter M. M., Santoro S. A. Alteration of collagen-dependent adhesion, motility, and morphogenesis by the expression of antisense {alpha}2 integrin mRNA in mammary cells. J. Cell Sci. (Washington DC), 108: 595-607, 1995.[Abstract]
  52. DiMilla P. A., Stone J. A., Quinn J. A., Albeda S. M., Lauffenburger D. A. Maximal migration of human smooth muscle cells on fibronectin and type IV collagen occurs at an intermediate attachment strength. J. Cell Biol., 122: 729-737, 1993.[Abstract/Free Full Text]
  53. Duband J. L., Dufour S., Yamada S. S., Yamada K. M., Thiery J. P. Neural crest cell locomotion induced by antibodies to ß1 integrins. A tool for studying the roles of substratum molecular avidity and density in migration. J. Cell Sci., 98: 517-532, 1991.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
A. Ramalingam, J. B. Duhadaway, E. Sutanto-Ward, Y. Wang, J. Dinchuk, M. Huang, P. S. Donover, J. Boulden, L. M. McNally, A. P. Soler, et al.
Bin3 Deletion Causes Cataracts and Increased Susceptibility to Lymphoma during Aging
Cancer Res., March 15, 2008; 68(6): 1683 - 1690.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M.-A. Herve, H. Buteau-Lozano, R. Vassy, I. Bieche, G. Velasco, M. Pla, G. Perret, S. Mourah, and M. Perrot-Applanat
Overexpression of Vascular Endothelial Growth Factor 189 in Breast Cancer Cells Leads to Delayed Tumor Uptake with Dilated Intratumoral Vessels
Am. J. Pathol., January 1, 2008; 172(1): 167 - 178.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
W. Xian, K. L. Schwertfeger, and J. M. Rosen
Distinct Roles of Fibroblast Growth Factor Receptor 1 and 2 in Regulating Cell Survival and Epithelial-Mesenchymal Transition
Mol. Endocrinol., April 1, 2007; 21(4): 987 - 1000.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Calcabrini, J. M. Garcia-Martinez, L. Gonzalez, M. J. Tendero, M. T. A. Ortuno, P. Crateri, A. Lopez-Rivas, G. Arancia, P. Gonzalez-Porque, and J. Martin-Perez
Inhibition of proliferation and induction of apoptosis in human breast cancer cells by lauryl gallate
Carcinogenesis, August 1, 2006; 27(8): 1699 - 1712.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Mabuchi, M. Ohmichi, Y. Nishio, T. Hayasaka, A. Kimura, T. Ohta, J. Kawagoe, K. Takahashi, N. Yada-Hashimoto, H. Seino-Noda, et al.
Inhibition of Inhibitor of Nuclear Factor-{kappa}B Phosphorylation Increases the Efficacy of Paclitaxel in in Vitro and in Vivo Ovarian Cancer Models
Clin. Cancer Res., November 15, 2004; 10(22): 7645 - 7654.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Korah, M. Boots, and R. Wieder
Integrin {alpha}5{beta}1 Promotes Survival of Growth-Arrested Breast Cancer Cells: An in Vitro Paradigm for Breast Cancer Dormancy in Bone Marrow
Cancer Res., July 1, 2004; 64(13): 4514 - 4522.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mabuchi, M. Ohmichi, Y. Nishio, T. Hayasaka, A. Kimura, T. Ohta, M. Saito, J. Kawagoe, K. Takahashi, N. Yada-Hashimoto, et al.
Inhibition of NF{kappa}B Increases the Efficacy of Cisplatin in in Vitro and in Vivo Ovarian Cancer Models
J. Biol. Chem., May 28, 2004; 279(22): 23477 - 23485.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. K. Ruohola, T. P. Viitanen, E. M. Valve, J. A. Seppänen, N. T. Loponen, J. J. Keskitalo, P. T. Lakkakorpi, and P. L. Härkönen
Enhanced Invasion and Tumor Growth of Fibroblast Growth Factor 8b-overexpressing MCF-7 Human Breast Cancer Cells
Cancer Res., May 1, 2001; 61(10): 4229 - 4237.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Korah, R. M.
Right arrow Articles by Wieder, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Korah, R. M.
Right arrow Articles by Wieder, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online