
[Cancer Research 60, 733-740, February 1, 2000]
© 2000 American Association for Cancer Research
Basic Fibroblast Growth Factor Confers a Less Malignant Phenotype in MDA-MB-231 Human Breast Cancer Cells1
Reju M. Korah,
Vilayvanh Sysounthone,
Yosef Golowa and
Robert Wieder2
Division of Medical Oncology, University of Medicine and Dentistry of New Jersey-New Jersey Medical School, Newark, New Jersey 07103
 |
ABSTRACT
|
|---|
Basic fibroblast growth factor (FGF-2) expression is associated with a
more differentiated phenotype, earlier stage of disease, and a better
prognosis in breast cancer patients. To determine whether expression of
FGF-2 can cause a less malignant phenotype, we engineered MDA-MB-231
cells, a highly dedifferentiated, invasive breast cancer cell line, to
express different isoforms of FGF-2. Cells expressed either
cytoplasmic, nuclear, or a combination of both FGF-2 isoforms. Western
blots of 2 M NaCl washes and of conditioned medium
demonstrated that these cells did not export FGF-2. Cells expressing
FGF-2 had levels of fibroblast growth factor receptors equivalent with
those of control cells. Transformation was assayed by
anchorage-independent colony formation and tumor formation in athymic
mice. All of the constructs expressing various FGF-2 isoforms had a
6070% reduction in colony formation in soft agar, but only cells
expressing the Mr 18,000 FGF-2
isoform formed fewer and smaller tumors in mice. To determine potential
mechanisms responsible for a less malignant phenotype, experiments
measuring invasion in Matrigel, the secretion of matrix metalloprotease
activity and migration in a modified Boyden chamber and in a patch
wound motility assay were carried out. Cells expressing the
Mr 18,000 cytoplasmic FGF-2 moiety had a
45% decrease in invasion in Matrigel compared to vector-transfected
controls. Cells expressing Mr 18,000 FGF-2
had an increase in Mr 97,000 and
Mr 48,000 collagenase, demonstrating that
the decreased invasive potential was not due to a down-regulation of
gelatinolytic or caseinolytic matrix metalloproteinases. However,
motility was decreased in both assays, primarily in cells expressing
Mr 18,000 FGF-2, whereas exogenous
recombinant human FGF-2 had no effect. These studies demonstrate for
the first time that FGF-2 expression can cause a less malignant
phenotype in breast cancer cells, possibly as a result of decreased
motility and invasion.
 |
INTRODUCTION
|
|---|
The transformation of benign mammary ductal epithelial cells into
metastatic breast cancer requires the completion of a series of
distinct steps, each of which imparts the cells with a new phenotype.
These steps include, but are not limited to, the loss of polarity,
acquisition of unlimited growth potential, loss of intercellular
adhesion, acquisition of the capacity to bind to the basement membrane,
cleave and migrate through the basement membrane, form new blood
vessels, intravasate, exit the blood vessels at a metastatic site,
invade, form a new blood supply, and proliferate at a metastatic site
(1)
. Additional epigenetic phenomena play necessary roles.
One of the most important angiogenesis factors in breast cancer cells
is
FGF-2.3
As mammary epithelial cells dedifferentiate, they acquire the capacity
to export FGF-2 in a nonclassical manner. The extracellular FGF-2, in
turn, causes vascular endothelial cells to migrate and proliferate. As
breast cancer cells further dedifferentiate, they stop synthesizing
FGF-2. The loss of intracellular FGF-2 is associated with a more
malignant tendency in breast cancer in both premalignant and malignant
lesions. Breast cysts lined by flattened epithelial cells of low
malignant potential contain fluid with higher FGF-2 content than cysts
lined with premalignant metaplastic epithelial cells (2)
.
Less FGF-2 mRNA can be detected in breast cancer biopsies than in
nonmalignant breast biopsies (3
, 4)
, and
immunohistochemically detectable FGF-2 protein can be observed only in
benign myoepithelial remnants and basement membranes surrounding
tumors, and not in the malignant cells (5)
. Clinically,
low levels of FGF-2 in breast cancer are associated with a more
malignant phenotype (6)
, larger tumor size, later disease
stage (7)
, and worse overall and disease-free survival
(6
, 7)
.
Whereas these data demonstrate an association of FGF-2 with a more
differentiated phenotype in breast cancer, it has not been determined
whether FGF-2 can cause a more differentiated phenotype in breast
cancer, particularly in light of prior, extensive data in fibroblasts
that demonstrate FGF-2 to be a transforming factor. These prior data
demonstrate that expression of low levels of FGF-2 linked to a signal
peptide that permits classical secretion and autocrine stimulation of
the cells (8
, 9) , as well as expression of high levels of
intracellular unmodified FGF-2 (10
, 11)
; both result in
transformation of NIH 3T3 cells. Both intracellular and
autocrine signaling are required for transformation as demonstrated by
abrogation of focus formation by neutralizing antibody to FGF-2. In
these cells, overexpression and autocrine stimulation by FGF-2 is also
correlated with increased locomotion (12
, 13)
, increased
invasion in Matrigel, and increased levels of activity of interstitial
collagenases (14)
. Expression of FGF-2 also induces
increased colony formation in soft agar in SW13 adrenal carcinoma
(15)
and immortalized prostate cells (16)
.
However, although causing increased migration in benign glial cells
(17)
, expression of FGF-2 does not induce tumor formation
in these cells or in bladder carcinoma cells (18)
and is
not tumorigenic in a benign diploid rat mammary epithelial cell line
(19)
. These data would suggest that FGF-2 is not
tumorigenic in all cell types but may have alternate and divergent
roles in different cells. This supports a rationale for investigating a
paradoxic role for FGF-2 in the transformation of breast cancer cells.
Paradoxic roles for FGF-2 in breast cancer have already been
demonstrated with respect to proliferation (20, 21, 22)
and
cell death (23
, 24) . Based on all of the available
evidence, we hypothesize that the expression of FGF-2 can cause a more
differentiated phenotype in breast cancer cells. For our studies, we
selected MDA-MB-231 cells, a cell line that is a prototype for a highly
dedifferentiated breast cancer cell. These cells lack estrogen
receptor, have mutant p53, are highly invasive, and form tumors
in athymic mice. They also lack expression of intracellular FGF-2. We
transfected these cells with vectors coding for various isoforms of
FGF-2 with cytoplasmic and nuclear localizing capabilities, with a
rationale based on prior data suggesting different roles for the
different isoforms of FGF-2 in transformation and proliferation
(25, 26, 27)
. In this study, we demonstrate for the first time
that FGF-2 expression in breast cancer cells can reverse phenotypic
features of malignancy, including migration, invasion, and tumor
formation in vivo.
 |
MATERIALS AND METHODS
|
|---|
Cells and Culture Conditions.
Malignant human mammary epithelial cell line MDA-MB-231 was purchased
from the American Type Culture Collection (Rockville, MD). The cells
were cultured in standard medium consisting of DMEM, 2 mM
glutamine, 10% heat-inactivated FCS, 50 units/ml penicillin, and 50
µg/ml streptomycin (Gemini Bio-Products, Calabasa, CA).
Construction of FGF-2 Expression Vectors and Transfected Cells.
The FGF vector was constructed by subcloning a 1000-bp EcoRI
FGF-2 cDNA fragment (10)
into the EcoRI unique
cloning site of the pCI-neo (Promega, Madison, WI) expression vector 3'
to a CMV immediate early promoter. This vector contains a SV40
enhancer/early promoter-linked bacterial neomycin
phosphotransferase gene (Neo) downstream to the
EcoRI cloning site (Fig. 1)
. To construct
A, the FGF vector was cleaved with restriction
endonucleases SacII and ApaI, deleting 307 bases
that encompass the three CUG codons upstream of the ApaI
site located 11 bases 5' of the AUG classical start site of FGF-2. The
endonuclease-cleaved ends were treated with Klenow fragment and
religated. FGFval was constructed by creating a
transition mutation at position 364 to change codon AUG to GUG,
changing methionine to valine. A new 488-bp
ApaI-BalI fragment was created by PCR
amplification. The 5' primer was CGGCCGGGCCCCGCAGGGACCGTGGCA, which
includes the ApaI site and the new GUG site 17 bases
downstream. The 3' primer was GAGATTAGATGTGGCCATTAAAAT, which includes
the BalI site. This fragment was digested with
ApaI and BalI and used to replace the
ApaI/BalI fragment of FGF to make construct
FGFval coding for the
Mr 24,000,
Mr 22,000, and
Mr 21,500 moieties.
FGFval was cleaved with SacII,
deleting 208 bp and the 5' most CUG site, and religated to form the
construct
Sval coding for the
Mr 22,000 and the
Mr 21,500 FGF-2 proteins. The
constructs were all sequenced.
MDA-MB-231 cells were incubated at 1 x 105 cells/60-mm-diameter tissue culture dish in
standard medium. After 24 h, the cells were transfected with 2
µg of plasmid DNA of the various pCI-neo-based FGF-2 vectors using
LipofectAMINE (Life Technologies, Inc., Gaithersburg, MD). G418
(neomycin analogue; Gemini Bio-Products) was added 24 h later to a
concentration of 800 µg/ml, and the cells were selected for 1218
days until control, nontransfected cells were completely nonviable.
Both populations and clones were selected for evaluation, yielding
similar results. The data presented here are from selected populations.
Western Blots.
Western blots were performed as described previously (20
, 27)
using a mouse monoclonal antibody to human FGF-2 (Oncogene
Science, Cambridge, MA) and to FGF receptors 14 (Santa Cruz
Biotechnology, Inc., Santa Cruz, CA). All blots were carried out at
least twice. Cell lysates were prepared as described previously
(27)
. Extraction and measurement of extracellular
matrix-bound FGF-2 was carried out by 2 M NaCl wash and
10% trichloroacetic acid precipitation as described previously
(27)
. Exported FGF-2 was concentrated from 8 ml of
conditioned medium (DMEM/0.5% BSA, obtained after a 48-h coincubation
with a confluent cell monolayer) with 50 µl of heparin-Sepharose
beads (Pharmacia, Piscataway, NJ). Conditioned medium was incubated
with beads overnight at 4°C, washed twice for 1 h each with cold
0.5 M NaCl and 20 mM Tris-HCl (pH 7.4),
precipitated by centrifugation at 5000 rpm, and solubilized in 2x SDS
loading buffer.
Immunofluorescence.
FGF-2 was detected by immunofluorescence microscopy as described
previously (27)
, using a primary anti-FGF-2 mouse
monoclonal antibody (Ab-3; Oncogene Sciences, Cambridge, MA).
Fluorescence-tagged cells were visualized and photographed using an
Olympus BX40 fluorescence microscope and an Olympus PM20 photographic
system.
Cell Growth Kinetic Studies.
MDA-MB-231-derived cells were treated with 0.05% trypsin/0.53
mM EDTA (Life Technologies, Inc.) and incubated on 60-mm
dishes at an initial density of 4.3 x 104 cells/dish in 4 ml of standard medium, with
and without 0.5 ng/ml rhFGF-2 (R&D Systems, Minneapolis, MN). Cell
numbers were manually counted using 0.2% trypan blue exclusion.
Viability was consistently above 90%.
Patch Wound Technique of Scatter/Migration.
Cells were grown to confluence in 100-mm-diameter tissue culture dishes
in standard medium and analyzed using a modified classical scratch
wound method (28)
. The medium was removed, and cells were
gently scraped with a sterile razor blade to create four or five radial
areas of clearing. The plates were washed twice with PBS, medium or
medium containing rhFGF-2 was added, and the cells were permitted to
scatter/migrate past the razor-drawn line into the area of clearing for
24 h. They were then stained with methylene blue. Four
representative fields were photographed at x100 magnification, and the
number of cells per photographic field that had migrated into the clear
patch were counted. The experiment was repeated twice.
Transwell Migration.
The capacity of cells to migrate was assayed using a modified Boyden
chamber with ethylene terephthalate filters with 8-µm pores
(Becton Dickinson, Lincoln Park, NJ). MDA-MB-231 cells transfected with
the control vector were compared with cells expressing the
Mr 18,000 isoforms of FGF-2, either
alone (
A) or in combination with the high molecular weight forms
(FGF) or the high molecular weight forms alone
(FGFval). A total of 1.0 x 104 cells were incubated in the top chamber of
triplicate wells in 300 µl of serum-free medium consisting of
standard medium with 0.5% BSA replacing the FCS to measure
chemokinesis or in standard medium to measure nondirectional migration.
The cells were allowed to migrate for 4 h, and then they were
stained and counted. The bottom chamber also contained standard medium
with 10% FCS. The experiments was repeated four times.
Matrigel Invasion.
The invasive capacity was assayed in the same modified Boyden chambers
with ethylene terephthalate filters with 8 µm pores used for invasion
studies (29)
. A total of 105 cells
were mixed with 15 µl of Matrigel in standard medium and allowed to
invade for 8 h at 37°C to assess invasion. The bottom chamber
also contained standard medium. Cells were fixed in 4%
paraformaldehyde, stained with methylene blue, counted, and
photographed.
Matrix Metalloprotease Assays.
The release of matrix metalloproteases with gelatinolytic and
caseinolytic activities was assayed using 10% zymogram gelatin ready
gels and 12% zymogram casein ready gels (Bio-Rad, Hercules, CA)
according to the manufacturers instructions. A total of 50 µl of
conditioned medium (DMEM/0.5% BSA coincubated with confluent cell
monolayers for 48 h) was loaded per well.
Colony Formation in Soft Agar.
Colony formation in soft agar was determined in 0.3% Bacto Agar (Difco
Laboratories, Detroit, MI), 0.67x DMEM, and 6.7%
heat-inactivated FCS overlaying a preformed 0.6% agar layer. Plates
(35 mm in diameter) containing 1000 cells in agar were incubated at
37°C in 5% CO2, and colonies containing >30
cells were counted under the microscope at 12 ± 2 days
as reported previously (11)
.
In Vivo Xenograft Tumor Formation in Mice.
Five million freshly trypsinized semiconfluent cells were injected s.c.
over the scapulae of 6-week-old female NCr nu/nu or BALB/c athymic mice
(Taconic Farms, Germantown, NY) under an Institutional Animal Care and
Use Committee-approved protocol. Tumor sizes were measured weekly using
calipers, and volume was estimated using the formula length x width2/2 (cm3; Ref.
30
). After 10 weeks, tumors were excised and weighed.
Fresh tumors were minced in medium containing 0.01% collagenase
(Sigma, St. Louis, MO), and single cell suspensions were incubated the
following day in tissue culture with and without G418.
Neomycin-resistant cells were selected and used for detection of
intracellular and/or exported FGF-2, as described previously.
 |
RESULTS
|
|---|
Characterization of Transfected Cells.
Lysates were electrophoresed and analyzed by Western blot. Fig. 2A
demonstrates the expected pattern of FGF-2 expression:
(a) Mr 24,000,
Mr 22,000, and
Mr 18,000 species in the cells
transfected with the FGF vector; (b)
Mr 24,000 and
Mr 22,000 species in cells transfected
with the FGFval vector; (c) the
Mr 22,000 species in the cells
transfected with the
Sval vector; and
(d) the Mr 18,000 species
in the cells transfected with the
A vector. Low levels of expression
of Mr 18,000 FGF-2 species are also
noted in FGFval and
Sval
in addition to the predominant species, demonstrating background levels
of valine initiated protein from the mutant GUG codon
(31)
. Immunofluorescence photographs confirmed that the
FGF-2 species expressed in the various cell constructs were distributed
in the cells as expected. Cells expressing the FGF vector were positive
for FGF-2 staining in both the cytoplasm and the nucleus; cells
expressing the FGFval vector (and the
Sval vector; data not shown) stained primarily
in the nucleus, whereas cells expressing the
A vector stained
positively only in the cytoplasm (Fig. 2B)
. Because
Sval cells behaved similarly to
FGFval cells, they were not further
characterized. MDA-MB-231 cells transfected with the Neo vector did not
express FGF-2.

View larger version (83K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Western immunoblots of lysates (A), 2
M NaCl washes (C), and conditioned medium
(D) from MDA-MB-231 cells transfected with vectors
expressing various FGF-2 isoforms. rhFGF-2 was used as a control in all
of the Western blots. B, immunofluorescence
photomicrographs of MDA-MB-231 cells stained with antibody to FGF-2
demonstrating ubiquitous, nuclear, and cytoplasmic localization of FGF
species in cells transfected with the FGF, FGFval, and A
vectors, respectively. No staining was present in pCI-neo
(Neo)-transfected controls.
|
|
Cells were analyzed for the capacity to export FGF-2. We have
previously demonstrated that MCF-7 cells engineered to express FGF-2
are capable of exporting all of the isoforms (11
, 27)
.
These cells were used as positive controls in the NaCl wash and
conditioned medium Western blots and confirmed our published data
(11
, 27) . In contrast, MDA-MB-231 cells engineered to
express FGF-2 did not export FGF-2 to their extracellular milieu. FGF-2
was not detectable on Western blots of trichloroacetic
acid-precipitated 2 M NaCl washes of confluent
MDA-MB-231 cells expressing various FGF-2 constructs (Fig. 2C)
. Because MDA-MB-231 cells have a reduced quantity of
heparan sulfate proteoglycans compared with MCF-7 cells
(32)
, permitting any potential extracellular FGF-2 to
remain in solution in the conditioned medium, we also analyzed heparin
beads incubated with conditioned medium from the various cell
constructs by Western blot (Fig. 2D)
. These data also
demonstrated that at a level of sensitivity of much less than 0.2 ng/8
ml, FGF-2 was not detectable in the conditioned medium of the
MDA-MB-231 cell constructs. The conditioned medium from the MCF-7/FGF
construct was positive for FGF-2. To support the data demonstrating a
lack of extracellular FGF-2 in cells expressing the various FGF-2
isoforms, we confirmed that FGF receptors in the four cell types were
not down-regulated by stimulation from exported FGF-2. Western blots in
Fig. 3
demonstrate that the levels of FGF receptors 1 and 3 were unchanged in
the cells expressing any of the FGF-2 isoforms as compared to the
Neo-transfected cells. FGF receptor 2 levels were very low on Western
blots of MDA-MB-231 cells, and FGF receptor 4 levels were undetectable
(data not shown).

View larger version (75K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Western immunoblots of FGF receptors in the four cell
constructs. A total of 100 µg of protein from lysates from the four
cell constructs transfected with vectors expressing various FGF-2
isoforms and control vector were electrophoresed and analyzed by
Western blot with antibodies to FGF receptors 1 and 3 and developed
using a chemiluminescence detection system.
|
|
Proliferation.
The doubling time Tc of the
various cell constructs was calculated using the formula
Tc = 0.3T/log
A/A0, where A is
the number of cells at time T of proliferation, and
Ao is the number of cells at an
initial time point (33)
. The data depicted in Table 1
demonstrate that neither recombinant FGF-2 nor the expression of any of
the isoforms individually or in combination had a significant effect on
the doubling time of MDA-MB-231 cells. This was in contrast to the
effects observed in MCF-7 cells, which were growth-inhibited by both
endogenous overexpression and exogenous incubation with recombinant
FGF-2 (P < 0.05 for both compared with
control MCF-7 cells), as demonstrated previously (20
, 27)
.
Anchorage-independent Growth.
To determine whether FGF-2 inhibited anchorage-independent colony
formation, a hallmark in vitro characteristic of
transformation, the transfected cells were incubated in a soft agar
culture system, and colony formation was counted 12 ± 2
days later. Fig. 4
shows the results of a typical experiment demonstrating a significant
decrease in colony formation in soft agar by MDA-MB-231 cells
expressing FGF-2 isoforms that localized exclusively in the cytoplasm
(
A), exclusively in the nucleus (FGFval),
or a combination of the two (FGF). Neo-transfected control cells formed
620 ± 73 colonies, whereas FGF-transfected cells formed
265 ± 79 colonies,
FGFval-transfected cells formed 209 ± 61 colonies, and
A-transfected cells formed 179 ± 48 colonies (P < 0.001 for all cells
compared with Neo). The data demonstrate that expression of FGF-2
isoforms decreased in vitro colony formation by MDA-MB-231
cells, an effect that is not attributable to a decrease in
proliferative capacity.

View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Colony-forming capacity of MDA-MB-231 cells expressing the
various FGF-2 isoforms in 0.3% soft agar. One thousand cells per dish
were incubated for 12 ± 2 days at 37°C in 5%
CO2, and colonies of >30 cells were counted.
|
|
In Vivo Tumor Formation.
To determine whether the effects on the in vitro phenotype
translated to in vivo effects on tumorigenicity, a xenograft
tumor model in athymic mice was used. A total of 5 x 106 cells/mouse were injected s.c. into three
sets of athymic mice, and tumor formation was determined as outlined in
"Materials and Methods." Sets of five NCr nu/nu mice were injected
with all four cell constructs in two experiments, and sets of four
BALB/c nu/nu mice were injected with the Neo and the FGF cell
constructs in a third experiment. Table 2
demonstrates the results of a representative experiment with NCr nu/nu
mice and the efficiency of tumor formation calculated from all of the
experiments. In the experiment shown, the size of the tumors formed by
cells transfected with the
A vector was significantly smaller than
the size of tumors formed by cells transfected with the Neo vector.
Cell constructs expressing all of the FGF-2 isoforms (FGF) and cells
expressing only Mr 18,000 FGF-2 (
A)
had a lower rate of tumor formation than the Neo controls. In contrast,
all of the mice injected with cells expressing only the high molecular
weight FGF-2 isoforms (FGFval) formed tumors. The
results were similar, and the differences were highly significant
compared to the Neo controls (Students t test) when data
from the three sets of mice were combined.
The tumors were excised and minced, and cells were cultured to
confluence in 800 µg/ml G418. Western blots of cell lysates and
conditioned medium from confluent dishes were carried out to determine
whether they were still expressing FGF-2 after in vivo
passage and whether they had acquired a capacity to export FGF-2. Fig. 5
demonstrates that all of the cells from the experiment shown in Table 2
that continued to express FGF-2 after in vivo passage have
acquired the capacity to export FGF-2. One of the tumors formed with
A-transfected cells no longer expressed detectable FGF-2 by Western
blot. This was the larger of the two by far and essentially represented
a Neo-transfected cell. In another set of animals, three of five NCr
nu/nu mice injected with
A-expressing cells formed tumors, but none
of the cultured cells from these excised tumors expressed FGF-2 any
longer (data not shown). Thus, the rate of tumor formation by
A
cells in the two experiments carried out in NCr nu/nu mice was 13%
when the mice with the non-FGF-2-producing tumors were subtracted from
the denominator (the mean of 1 of 4 and 0 of 2). These data suggest
that there is a strong negative selective pressure in vivo
against cells expressing Mr 18,000
FGF-2 in MDA-MB-231 cells.

View larger version (77K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Western immunoblots of lysates and conditioned medium from
cells cultured and G418-selected from tumors excised from mice. Medium
conditioned by a 48-h coculture with confluent cultures of cells
obtained from excised tumors was incubated with heparin-Sepharose
beads, and the bound FGF-2 was assayed by Western blot along with
lysates from the cultured cells. The blots were stained with anti-FGF-2
antibody and developed using a chemiluminescence detection system. The
mouse number in which the particular Neo, FGF, HMW, or A tumors from
which the cells were cultured are indicated.
|
|
Invasion in Matrigel.
To further deduce the aspects of transformation affected by FGF-2
expression, we assayed invasive capacity in Matrigel using the modified
Boyden chamber assay. Fig. 6
demonstrates that expression of Mr
18,000 FGF-2 inhibited the invasive potential of MDA-MB-231 cells by
approximately 45%. The invasive potential was not modulated by
treatment with estradiol or rhFGF-2 (data not shown).

View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. Invasion of breast cancer cells expressing various FGF-2
isoforms in Matrigel-coated modified Boyden chambers with 8-µm pores.
MDA-MB-231 cells were incubated at 1.0 x 105 cells/chamber for 8 h. The filters were stained
with methylene blue and counted at x100 magnification.
|
|
Matrix Metalloprotease Production.
To determine whether the decrease in invasive potential was due to a
change in matrix metalloprotease production, conditioned media were
tested for levels of released metalloproteases in zymogen assays. Fig. 7
demonstrates that the level of gelatinase
(Mr 97,000 type IV collagenase)
activity in a gelatin/SDS polyacrylamide gel was increased in
MDA-MB-231 cells expressing all FGF-2 isoforms, with the greatest
increase in cells expressing Mr 18,000
FGF-2. Gelatinolytic activity also increased with the addition of
recombinant FGF-2. In a casein/SDS polyacrylamide gel, the level of
caseinolytic protease (Mr 72,000 type
IV collagenase) was also found to be elevated primarily in MDA-MB-231
cells expressing Mr 18,000 FGF-2 and
with recombinant FGF-2. These experiments demonstrate that the
decreased invasive potential in these cells was not due to a
down-regulation of gelatinolytic or caseinolytic matrix
metalloproteinases.

View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 7. Negative images of photographs taken of zymogen gels
electrophoresed with conditioned medium from the MDA-MB-231 cells
expressing the various FGF-2 isoforms. Fifty µl of conditioned medium
from each dish were electrophoresed in a 12% SDS polyacrylamide gel
containing 0.1% gelatin in the MMP-9 gel and 0.1% casein in the MMP-2
gel. The MMPs in the gel were activated after electrophoresis in a
37°C bath for 16 h, stained with Coomassie Blue, and
photographed.
|
|
Effects of FGF-2 Expression on Migration and Scatter.
The patch wound repair assay was used to determine the capacity
of cells to scatter and migrate randomly. Cells that have migrated past
the razor line (Fig. 8A)
in four or more random photographic fields were counted,
and the means and SDs were graphed (Fig. 8B)
. Fig. 8
shows
the results of a representative experiment and demonstrates that
MDA-MB-231 cells expressing the Mr
18,000 species of FGF-2 (
A-transfected cells) had significantly less
scatter at 24 h than vector-transfected controls
(P < 0.001). The differences between
vector-transfected cells and cells transfected with either FGF or
FGFval were not statistically significant. To
confirm that the observed effects were due to intracellular FGF-2 and
not autocrine signaling, the effects of rhFGF-2 were determined on
scatter migration. Fig. 8C
demonstrates that neither 1 nor
10 ng/ml FGF-2 inhibited migration of MDA-MB-231 cells in this assay.
These data demonstrate that the expression of the
Mr 18,000 FGF-2 species can decrease
scatter and random migration in MDA-MB-231 cells.

View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 8. Scatter/migration of MDA-MB-231 cells expressing the
various FGF-2 isoforms. A, photomicrographs (x250) of
representative fields of cells that scattered from confluent cultures
that were stained with methylene blue 24 h after a patch was
cleared by a razor blade (the arrow represents the
starting point). B, graphic representation of four
fields that were photographed and counted. Error bars,
SDs. C, scatter migration assay of Neo
vector-transfected MDA-MB-231 cells comparing the effects of expressing
Mr 18,000 FGF-2 with those of exogenous
recombinant FGF-2. D, migration of breast cancer cells
expressing various FGF-2 isoforms in a modified Boyden chamber with
8-µm pores. MDA-MB-231 cells were incubated at 1 x 104 cells/chamber for 4 h. The filters were stained
with methylene blue and counted at x100 magnification.
|
|
Migration was also assessed in modified Boyden chambers using 10%
serum in the lower chamber as a chemoattractant. Fig. 8D
demonstrates that MDA-MB-231 cells expressing the
Mr 18,000 isoforms of FGF-2, either
alone (
A) or in combination with the higher molecular weight forms
(FGF), were inhibited from migrating. Counting cells that migrated over
4 h demonstrated that for 625 ± 25 Neo-transfected
control cells that migrated, 450 ± 50 FGF-transfected
cells (P < 0.002) and 325 ± 25
A-transfected cells (P < 0.001)
migrated. Cells that were transfected with FGFval
did not have inhibited migratory capacity. The assays were repeated
with the same serum-containing standard medium in the upper and lower
chambers and yielded similar results of migration inhibition by
Mr 18,000 FGF-2. Addition of exogenous
rhFGF-2 or estradiol to the medium had no effect on the migratory
response of parental MDA-MB-231 cells or derivatives expressing various
isoforms of FGF-2 (data not shown).
 |
DISCUSSION
|
|---|
Experiments performed in this study demonstrate for the first time
that expression of FGF-2 in an estrogen receptor-negative breast cancer
cell line with mutated p53 induces a less malignant phenotype, both
in vitro and in vivo. Cells that express FGF-2
form fewer colonies in soft agar and form fewer and smaller tumors than
controls in athymic mice. The cells selected for this study, MDA-MB-231
cells, are highly dedifferentiated and are not capable of exporting
FGF-2. FGF-2 was not detected in either Western blots of conditioned
medium or 2 M NaCl washes of confluent layers of
FGF-2-expressing cells. FGF receptor levels were not altered in any of
the cells expressing the different FGF-2 isoforms. In addition,
extracellular rhFGF-2 had no effect on migration. These data, taken
together, suggest that the demonstrated phenotypic effects were due to
the intracellular effects of FGF-2.
Whereas the effects on colony formation were observed in cells
expressing all of the FGF-2 isotypes, the decrease in the efficiency of
in vivo tumor formation was only observed in cells
expressing the Mr 18,000
cytoplasm-localizing species. Cells expressing the high molecular
weight FGF-2 species (FGFval) were still capable
of expressing a low level of the Mr
18,000 FGF-2 species, probably due to background levels of valine tRNA
initiation at GUG (31)
. This level of expression was
probably sufficient to inhibit soft agar colony formation. Mechanisms
responsible for the intracytoplasmic FGF-2 signaling are not known.
The inhibition of tumor formation by
Mr 18,000 cytoplasmic FGF-2 was
profound. Because of the powerful negative selective advantage of cells
expressing Mr 18,000 FGF-2, a majority
of
A tumors, and, in particular, those that grew faster, did not
express detectable levels of FGF-2 after they were excised and
cultured. There was no such negative selective advantage in cells
expressing other forms of FGF-2. In fact, mice injected with cells
expressing HMW FGF-2 had a 100% rate of tumor formation. This
phenomenon may have been due to an acquired angiogenic phenotype in
these cells. All of the cells cultured from excised tumors under G418
selection that still expressed FGF-2 had acquired the ability to export
FGF-2. Although MDA-MB-231 cells engineered to express FGF-2 lack the
capacity to export these proteins during in vitro passage,
we have previously demonstrated that MCF-7 cells engineered to
overexpress FGF-2 are capable of exporting all of the isoforms of
FGF-2, in contrast to fibroblasts that only export
Mr 18,000 FGF-2 (27)
. The
export mechanism of FGF-2 is not understood, but data have demonstrated
an association with an energy-dependent mechanism (34)
involving the
1 subunit of
Na+,K+-ATPase
(35)
. The expression of this subunit is induced by
differentiation agents (36)
. We hypothesize that the shift
in the capacity of cells that formed tumors to export FGF-2 was due to
a selection mechanism for cells more capable of inducing angiogenesis.
Indeed, there was a distinct increase in the number of blood vessels
per high-power field in tumors formed by cells expressing HMW forms of
FGF-2 (data not shown), possibly providing the selective advantage able
to account for the 100% rate of tumor formation and continued
expression of FGF-2 in 100% of these cells. However, it appears that
Mr 18,000 FGF-2 is insufficient by
itself to induce the angiogenic effects. We postulate that the primary
function of the Mr 18,000 isoform of
FGF-2 was to inhibit intrinsic tumor growth in vivo.
The experiments that followed attempted to identify components of
tumorigenicity affected by FGF-2 that may be responsible for the
overall phenotype. We first studied an in vitro invasion
model. We demonstrated that, once again, it was the
cytoplasm-localizing FGF-2 isoform that was responsible for inhibiting
invasion, whereas other constructs did not have a consistent,
statistically significant effect. Invasion is a phenotype that results
from the accumulation of several effects, including induction of MMPs,
dissolution of the matrix by these MMPs, and a subsequent migration of
the cell into the hole they created in the matrix.
FGF-2 can cause an increased production and activity of MMPs
(37, 38, 39, 40, 41)
, which would not explain the decreased invasion
observed. Indeed, our results confirm that both intracellular and
exogenous recombinant Mr 18,000 FGF-2
caused an up-regulation in the activity of both gelatinolytic and
caseinolytic MMPs in these cells. The mechanism of decreased migration
in these cells is most likely not due to a decrease in MMP levels,
although an up-regulation of MMP inhibitors by FGF-2 cannot be excluded
(37
, 38)
. However, a dissociation between MMP-9/tissue
inhibitors of metalloproteases balance and migratory and
invasive capacity has been demonstrated (42)
. This
suggests that other components of invasion are implicated. We
investigated migration using several assays.
Using two assays and two conditions, one using a serum gradient
as a chemoattractant and another assaying for scatter migration, and
under two conditions, our data indicated that cells expressing
Mr 18,000 FGF-2 migrated slower than
controls, suggesting an intrinsic effect on the mechanism of migration
by intracellular FGF-2. The expression of all isoforms of FGF-2
(FGF cells) also had a small inhibitory effect on migration in the
transwell assay, whereas it had no effect on invasion through Matrigel
in the same chambers. This may be due to opposing effects of the
induced MMP-9 and the inhibitory effects of intracellular
Mr 18,000 FGF-2 on migration, although
there are too many unknown factors mediating the process to explain
small differences. Extracellular rhFGF-2 had no clear effect on the
scatter migration of these cells. Others have shown, however, that
extracellular FGF induces migration mediated through FGF receptors
(43
, 44)
through urokinase-type plasminogen activator and
urokinase-type plasminogen activator receptor as well as hepatocyte
growth factor intermediates (45)
through Src-mediated
pathways (46)
. In smooth muscle cells, FGF induces
motility on collagen by up-regulating integrins (47)
.
One potential mechanism for the decreased motility observed in these
cells may be an effect on adhesion. Cells adhere to their substratum
via cell surface integrins and form focal adhesion complexes
(48)
. Prior studies have demonstrated that recombinant
FGF-2 (49)
or FGF receptor-dependent autocrine signaling
by Mr 18,000 FGF-2 (50)
can cause an increase in both
and ß classes of integrins.
Motility depends on an ordered series of events that require cell
polarization, membrane extension into a lamellapodium, attachment of
the leading edge to the substratum, traction by stress fibers formed
from the leading edge, and release of the lagging end of the cell
(48)
. This cycle of adhesion and deadhesion is governed by
aggregation and activation of a number of proteins into focal adhesion
complexes at the membrane that serve as the initiation of downstream
signaling. Several studies have demonstrated that intermediate levels
of adherence are needed for optimal migration and that increasing or
decreasing adherence decreases the rate of cell migration
(51, 52, 53)
. One possible explanation of the observed effects
on migration is that expression of Mr
18,000 FGF-2 modifies the strength of adhesion of MDA-MB-231 cells to
its substratum. These effects and potential regulation of integrins and
the formation and activation of focal adhesion complexes by FGF-2 are
being investigated.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by Career Development Award
DAMD17-94-J-4463 from the United States Army Breast Cancer Research
Program (to R. W.) and Grant 24-99 from the Foundation of the
University of Medicine and Dentistry of New Jersey (to R. K.). 
2 To whom requests for reprints should be
addressed, at University of Medicine and Dentistry of New
Jersey-New Jersey Medical School, MSB I-594, 185 South Orange
Avenue, Newark, New Jersey 07103. Phone: (973) 972-4871; Fax: (973)
972-2384. 
3 The abbreviations used are: FGF-2, basic
fibroblast growth factor; rhFGF-2, recombinant human FGF-2; FGF,
fibroblast growth factor; CMV, cytomegalovirus; HMW, high molecular
weight; MMP, matrix metalloprotease. 
Received 6/ 9/99.
Accepted 11/24/99.
 |
REFERENCES
|
|---|
-
Meyer T., Hart I. R. Mechanisms of tumour metastasis. Eur. J. Cancer, 34: 214-221, 1998.
-
Lai L. C., Sirah A. K., Erbas H., Lennard T. W. J. Relationship between basic fibroblast growth factor and transforming growth factor-ß2 in breast cyst fluid. J. Clin. Endocrinol. Metab., 80: 711-714, 1995.[Abstract]
-
Luqmani Y. A., Graham M., Coombes R. C. Expression of basic fibroblast growth factor, FGFR1 and FGFR2 in normal and malignant human breast, and comparison with other normal tissues. Br. J. Cancer, 66: 273-280, 1992.[Medline]
-
Anandappa S. Y., Winstanley J. H. R., Leinster S., Green B., Rudland P. S., Barraclough R. Comparative expression of fibroblast growth factor mRNAs in benign and malignant breast disease. Br. J. Cancer, 69: 772-776, 1994.[Medline]
-
Gomm J. J., Smith J., Ryall G. K., Baille R., Turnbull L., Coombes R. C. Localization of basic fibroblast growth factor and transforming growth factor ß1 in the human mammary gland. Cancer Res., 51: 4685-4692, 1991.[Abstract/Free Full Text]
-
Yiangou C., Gomm J. J., Coope R. C., Law M., Luqmani Y. A., Shousha S., Coombes R. C., Johnston C. L. Fibroblast growth factor 2 in breast cancer: occurrence and prognostic significance. Br. J. Cancer, 75: 28-33, 1997.[Medline]
-
Colomer R., Aparicio J., Montero S., Guzman C., Larrodera L., Cortes-Funes H. Low levels of basic fibroblast growth factor (bFGF) are associated with a poor prognosis in human breast carcinoma. Br. J. Cancer, 76: 1215-1220, 1997.[Medline]
-
Rogelj S., Weinberg R. A., Fanning P., Klagsbbrun M. Basic fibroblast growth factor fused to a signal peptide transforms cells. Nature (Lond.), 331: 173-175, 1988.[Medline]
-
Blam S. B., Mitchell R., Tischer E., Rubin J. S., Silva M., Silver S., Fiddes J. C., Abraham J. A., Aaronson S. A. Addition of growth hormone secretion signal to basic fibroblast growth factor results in cell transformation and secretion of aberrant forms of the protein. Oncogene, 3: 129-136, 1988.[Medline]
-
Quarto N., Talarico D., Sommer A., Florkiewitz R., Basilico C., Rifkin D. B. Transformation by basic fibroblast growth factor requires high levels of expression: comparison with transformation by hst/K-fgf. Oncogene Res., 5: 101-110, 1989.[Medline]
-
Wieder R., Wang H., Shirke S., Wang Q., Menzel T., Feirt N., Jakubowski A. A., Gabrilove J. L. Low level expression of basic FGF upregulates Bcl-2 and delays apoptosis, but high intracellular levels are required to induce transformation in NIH 3T3 cells. Growth Factors, 15: 41-60, 1997.[Medline]
-
Mignatti P., Morimoto T., Rifkin D. B. Basic fibroblast growth factor released by single, isolated cell stimulates their migration in an autocrine manner. Proc. Natl. Acad. Sci. USA, 88: 11007-11011, 1991.[Abstract/Free Full Text]
-
Taylor W. R., Greenberg A. H., Turley E. A., Wright J. A. Cell motility, invasion, and malignancy induced by overexpression of K-FGF or bFGF. Exp. Cell Res., 204: 295-301, 1993.[Medline]
-
Gately S., Tsanaclis A. M. C., Takanao S., Klagsbrun M., Brem S. Cells transfected with the basic fibroblast growth factor gene fused to a signal sequence are invasive in vitro and in situ in the brain. Neurosurgery, 36: 780-788, 1995.[Medline]
-
Corin S. J., Chen L. C., Hamburger A. W. Enhancement of anchorage-independent growth of a human adrenal carcinoma cell line by endogenously produced basic fibroblast growth factor. Int. J. Cancer, 46: 516-521, 1990.[Medline]
-
Ropiquet F., Berthon P., Villette J-M., Le Brun G., Maitland N. J., Cussenot O., Fiet J. Constitutive expression of FGF2/bFGF in non-tumorigenic human prostatic epithelial cells results in the acquisition of a partial neoplastic phenotype. Int. J. Cancer, 72: 543-547, 1997.[Medline]
-
Holland E. C., Varmus H. E. Basic fibroblast growth factor induces cell migration and proliferation after glia-specific gene transfer in mice. Proc. Natl. Acad. Sci. USA, 95: 1218-1222, 1998.[Abstract/Free Full Text]
-
Jouanneau J., Plouet J., Moens G., Thiery J. P. FGF-2 and FGF-1 expressed in rat bladder carcinoma cells have similar angiogenic potential but different tumorigenic properties in vivo. Oncogene, 14: 671-676, 1997.[Medline]
-
Davies B. R., Fernig D. G., Barraclough R., Rudland P. S. Effect on tumorigenicity and metastasis of transfection of a diploid benign rat mammary epithelial cell line with DNA corresponding to the mRNA for basic fibroblast growth factor. Int. J. Cancer, 65: 104-111, 1996.[Medline]
-
Fenig E., Wieder R., Paglin S., Wang H., Persaud R., Haimovitz-Friedman A., Fuks Z., Yahalom J. Basic fibroblast growth factor confers growth inhibition and mitogen-activated protein kinase activation in human breast cancer cells. Clin. Cancer Res., 3: 135-142, 1997.[Abstract]
-
Wang H., Rubin M., Fenig E., DeBlasio T., Mendelsohn J., Yahalom J., Wieder R. Basic FGF causes growth arrest in MCF-7 human breast cancer cells while inducing both mitogenic and inhibitory G1 events. Cancer Res., 57: 1750-1757, 1997.[Abstract/Free Full Text]
-
Johnson M. R., Valentine C., Basilico C., Mansukhani A. FGF signaling activates STAT1 and p21 and inhibits the estrogen response and proliferation of MCF-7 cells. Oncogene, 16: 2647-2656, 1998.[Medline]
-
Wang Q., Maloof P., Wang H., Fenig E., Stein D., Nichols G., Denny T. N., Yahalom J., Wieder R. Basic fibroblast growth factor (bFGF) downregulates Bcl-2 and promotes apoptosis in MCF-7 human breast cancer cells. Exp. Cell Res., 238: 177-187, 1998.[Medline]
-
Maloof P., Wang Q., Wang H., Stein D., Denny T. N., Yahalom J., Wieder R. Overexpression of retrovirally transduced basic FGF in MCF-7 human breast cancer cells downregulates Bcl-2 and sensitizes cells to chemotherapy-induced apoptosis. Breast Cancer Res. Treat., 56: 153-167, 1999.[Medline]
-
Bugler B., Amalric F., Prats H. Alternative initiation of translation determines cytoplasmic or nuclear localization of basic fibroblast growth factor. Mol. Cell. Biol., 11: 573-577, 1991.[Abstract/Free Full Text]
-
Couderc B., Prats H., Bayard F., Amalric F. Potential oncogenic effects of basic fibroblast growth factor requires cooperation between CUG and AUG-initiated forms. Cell Regul., 2: 709-718, 1991.[Medline]
-
Wieder R., Fenig E., Wang H., Wang Q., Paglin S., Menzel T., Gabrilove J., Fuks Z., Yahalom J. Overexpression of basic fibroblast growth factor in MCF-7 human breast cancer cells: lack of correlation between inhibition of cell growth and MAP kinase activation. J. Cell. Physiol., 177: 411-425, 1998.[Medline]
-
Tamura M., Gu J., Matsumoto K., Parsons R., Yamada K. Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science (Washington DC), 280: 1614-1617, 1998.[Abstract/Free Full Text]
-
Lochter A., Srebrow A., Sympson C. J., Terracio N., Werb Z., Bissell M. J. Misregulation of stromelysin-1 expression in mouse mammary tumor cells accompanies acquisition of stromelysin-1-dependent invasive properties. J. Biol. Chem., 272: 5007-5015, 1997.[Abstract/Free Full Text]
-
Light B. J., Yu W-D., McElwain M. C., Russell D. M., Trump D. L., Johnson C. S. Potentiation of cisplatin tumor activity using a vitamin D analogue in a murine squamous cell carcinoma model system. Cancer Res., 57: 3759-3764, 1997.[Abstract/Free Full Text]
-
Drabkin H. J., Raj Bhandary U. L. Initiation of protein synthesis in mammalian cells with codons other than AUG and amino acids other than methionine. Mol. Cell. Biol., 18: 5140-5147, 1998.[Abstract/Free Full Text]
-
Delehedde M., Deudon E., Boilly B., Hondermarck H. Production of sulfated proteoglycans by human breast cancer cell lines: binding to fibroblast growth factor-2. J. Cell. Biochem., 64: 605-617, 1997.[Medline]
-
Wieder R. Selection of methods for measuring proliferation Studzinski G. eds. . Cell Growth, Differentiation and Senescence: A Practical Approach, : 1-32, Oxford University Press New York 1999.
-
Florkiewicz R. Z., Majack R. A., Buechler R. D., Florkiewicz E. Quantitative export of FGF-2 occurs through an alternative, energy-dependent, non-ER/Golgi pathway. J. Cell. Physiol., 162: 388-399, 1995.[Medline]
-
Florkiewicz R. Z., Anchin J., Baird A. The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+, K+-ATPase. J. Biol. Chem., 273: 544-551, 1998.[Abstract/Free Full Text]
-
Kester H. A., van der Leede B. M., van der Saag P. T., van der Burg B. Novel progesterone target genes identified by an improved differential display technique suggest that progestin-induced growth inhibition of breast cancer cells coincides with enhancement of differentiation. J. Biol. Chem., 272: 16637-16643, 1997.[Abstract/Free Full Text]
-
Miyagi N., Kato S., Terasaki M., Shigemori M., Morimatsu M. Fibroblast growth factor-2 and -9 regulate proliferation and production of matrix metalloproteinases in human gliomas. Int. J. Oncol., 12: 1085-1090, 1998.[Medline]
-
Pickering J. G., Ford C. M., Tang B., Chow L. H. Coordinated effects of fibroblast growth factor-2 on expression of fibrillar collagens, matrix metalloproteinases, and tissue inhibitors of matrix metalloproteinases by human vascular smooth muscle cells. Evidence for repressed collagen production and activated degradative capacity. Arterioscler. Thromb. Vasc. Biol., 17: 475-482, 1997.[Abstract/Free Full Text]
-
Miyake H., Hara I., Yoshimura K., Eto H., Arakawa S., Wada S., Chihara K., Kamidono S. Introduction of basic fibroblast growth factor gene into mouse renal cell carcinoma cell line enhances its metastatic potential. Cancer Res., 56: 2440-2445, 1996.[Abstract/Free Full Text]
-
Uria J. A., Balbin M., Lopez J. M., Alvarez J., Vizoso F., Takigawa M., Lopez-Otin C. Collagenase-3 (MMP-13) expression in chondrosarcoma cells and its regulation by basic fibroblast growth factor. Am. J. Pathol., 153: 91-101, 1998.[Abstract/Free Full Text]
-
Newberry E. P., Willis D., Latifi T., Bourdreaux J. M., Towler D. A. Fibroblast growth factor receptor signaling activates the human interstitial collagenase promoter via the bipartite Ets-Ap1 element. Mol. Endocrinol., 11: 1129-1144, 1997.[Abstract/Free Full Text]
-
Puyraimond A., Weitzman J. B., Babiole E., Menashi S. Examining the relationship between the gelatinolytic balance and the invasive capacity of endothelial cells. J. Cell Sci., 112: 1283-1290, 1999.[Abstract]
-
Osterhout D. J., Ebner S., Xu J., Ornitz D. M., Zazanis G. A., McKinnon R. D. Transplanted oligodendrocyte progenitor cells expressing a dominant negative FGF receptor transgene fail to migrate in vivo. J. Neurosci., 17: 9122-9132, 1997.[Abstract/Free Full Text]
-
Landgren E., Klint P., Yokote K., Claesson-Welsh L. Fibroblast growth factor receptor-1 mediates chemotaxis independently of direct SH2-domain protein binding. Oncogene, 17: 283-291, 1998.[Medline]
-
Cavallaro U., Wu Z., Di Palo A., Montesano R., Pepper M. S., Maier J. A., Soria M. R. FGF-2 stimulates migration of Kaposis sarcoma-like vascular cells by HGF-dependent relocalization of the urokinase receptor. FASEB J., 12: 1027-1034, 1998.[Abstract/Free Full Text]
-
LaVallee T. M., Prudovsky I. A., McMahon G. A., Hu X., Maciag T. Activation of the MAP kinase pathway by FGF-1 correlates with cell proliferation induction while activation of the Src pathway correlates with migration. J. Cell Biol., 141: 1647-1658, 1998.[Abstract/Free Full Text]
-
Pickering J. G., Uniyal S., Ford C. M., Chau T., Laurin M. A., Chow L. H., Ellis C. G., Fish J., Chan B. M. C. Fibroblast growth factor-2 potentiates vascular smooth muscle cell migration to platelet-derived growth factor: upregulation of
2ß1 integrin and disassembly of actin filaments. Circ. Res., 80: 627-637, 1997.[Abstract/Free Full Text]
-
Lauffenburger D. A., Horwitz A. F. Cell migration: a physically integrated molecular process. Cell, 84: 359-369, 1996.[Medline]
-
Klein S., Giancotti F. G., Presta M., Albelda S. M., Buck C. A., Rifkin D. B. Basic fibroblast growth factor modulates integrin expression in microvascular endothelial cells. Mol. Biol. Cell, 4: 973-982, 1993.[Abstract]
-
Klein S., Bikfalvi A., Birkenmeier T. M., Giancotti F. P., Rifkin D. B. Integrin regulation by endogenous expression of 18-kDa fibroblast growth factor-2. J. Biol. Chem., 271: 22583-22590, 1996.[Abstract/Free Full Text]
-
Keely P. J., Fong A. M., Zutter M. M., Santoro S. A. Alteration of collagen-dependent adhesion, motility, and morphogenesis by the expression of antisense
2 integrin mRNA in mammary cells. J. Cell Sci. (Washington DC), 108: 595-607, 1995.[Abstract]
-
DiMilla P. A., Stone J. A., Quinn J. A., Albeda S. M., Lauffenburger D. A. Maximal migration of human smooth muscle cells on fibronectin and type IV collagen occurs at an intermediate attachment strength. J. Cell Biol., 122: 729-737, 1993.[Abstract/Free Full Text]
-
Duband J. L., Dufour S., Yamada S. S., Yamada K. M., Thiery J. P. Neural crest cell locomotion induced by antibodies to ß1 integrins. A tool for studying the roles of substratum molecular avidity and density in migration. J. Cell Sci., 98: 517-532, 1991.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
A. Ramalingam, J. B. Duhadaway, E. Sutanto-Ward, Y. Wang, J. Dinchuk, M. Huang, P. S. Donover, J. Boulden, L. M. McNally, A. P. Soler, et al.
Bin3 Deletion Causes Cataracts and Increased Susceptibility to Lymphoma during Aging
Cancer Res.,
March 15, 2008;
68(6):
1683 - 1690.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-A. Herve, H. Buteau-Lozano, R. Vassy, I. Bieche, G. Velasco, M. Pla, G. Perret, S. Mourah, and M. Perrot-Applanat
Overexpression of Vascular Endothelial Growth Factor 189 in Breast Cancer Cells Leads to Delayed Tumor Uptake with Dilated Intratumoral Vessels
Am. J. Pathol.,
January 1, 2008;
172(1):
167 - 178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Xian, K. L. Schwertfeger, and J. M. Rosen
Distinct Roles of Fibroblast Growth Factor Receptor 1 and 2 in Regulating Cell Survival and Epithelial-Mesenchymal Transition
Mol. Endocrinol.,
April 1, 2007;
21(4):
987 - 1000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Calcabrini, J. M. Garcia-Martinez, L. Gonzalez, M. J. Tendero, M. T. A. Ortuno, P. Crateri, A. Lopez-Rivas, G. Arancia, P. Gonzalez-Porque, and J. Martin-Perez
Inhibition of proliferation and induction of apoptosis in human breast cancer cells by lauryl gallate
Carcinogenesis,
August 1, 2006;
27(8):
1699 - 1712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mabuchi, M. Ohmichi, Y. Nishio, T. Hayasaka, A. Kimura, T. Ohta, J. Kawagoe, K. Takahashi, N. Yada-Hashimoto, H. Seino-Noda, et al.
Inhibition of Inhibitor of Nuclear Factor-{kappa}B Phosphorylation Increases the Efficacy of Paclitaxel in in Vitro and in Vivo Ovarian Cancer Models
Clin. Cancer Res.,
November 15, 2004;
10(22):
7645 - 7654.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Korah, M. Boots, and R. Wieder
Integrin {alpha}5{beta}1 Promotes Survival of Growth-Arrested Breast Cancer Cells: An in Vitro Paradigm for Breast Cancer Dormancy in Bone Marrow
Cancer Res.,
July 1, 2004;
64(13):
4514 - 4522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mabuchi, M. Ohmichi, Y. Nishio, T. Hayasaka, A. Kimura, T. Ohta, M. Saito, J. Kawagoe, K. Takahashi, N. Yada-Hashimoto, et al.
Inhibition of NF{kappa}B Increases the Efficacy of Cisplatin in in Vitro and in Vivo Ovarian Cancer Models
J. Biol. Chem.,
May 28, 2004;
279(22):
23477 - 23485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Ruohola, T. P. Viitanen, E. M. Valve, J. A. Seppänen, N. T. Loponen, J. J. Keskitalo, P. T. Lakkakorpi, and P. L. Härkönen
Enhanced Invasion and Tumor Growth of Fibroblast Growth Factor 8b-overexpressing MCF-7 Human Breast Cancer Cells
Cancer Res.,
May 1, 2001;
61(10):
4229 - 4237.
[Abstract]
[Full Text]
|
 |
|