| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Tumor Biology and Metastasis Group, Section of Cancer Therapeutics, The Institute of Cancer Research, Sutton, Surrey, SM2 5NG [P. O-c., W. J. C., G. M. B., S. A. E.]; European Institute of Health and Medical Sciences, University of Surrey, Guildford, GU2 5XH [H. M.]; and Department of Head and Neck Surgery, Royal Marsden Hospital, London, SW3 6JJ [P. O-c., P. R-E.]; United Kingdom
| ABSTRACT |
|---|
|
|
|---|
,
betacellulin, heparin-binding EGF, and amphiregulin and measured
expression of gelatinases MMP-9 and MMP-2 in an established squamous
carcinoma cell line (Detroit-562) and in two cell lines newly derived
from patients with head and neck cancers (SIHN-005A and SIHN-006).
Incubation of the cell lines with EGF-like ligands up-regulated MMP-9
(but not MMP-2) expression as measured by semiquantitative reverse
transcription-PCR in a dose-dependent manner, with the effects being
most marked in cells with high EGFR levels and undetectable in cells
with low levels. Maximum stimulation was obtained in a concentration
range of 10100 nM. In addition, we confirmed by
zymography that gelatinolytic activity consistent with MMP-9
(Mr 92,000) was up-regulated in parallel with
increases in gene expression. Betacellulin (which binds both to EGFR
and c-erbB-4 receptors) consistently increased MMP-9
expression and activation to a significantly greater degree than the
other four ligands when tested at equimolar concentrations. In parallel
with MMP-9 up-regulation, all EGF-like ligands increased tumor cell
invasion through Matrigel in in vitro Transwell assays.
These activities were independent of ligand effects on cell
proliferation. Antagonist (ICR62) or agonist (ICR9) anti-EGFR
monoclonal antibodies, respectively, inhibited or potentiated MMP-9
activity and tumor cell invasion induced by all ligands. Furthermore, a
monoclonal antibody that neutralizes MMP-9 activity (Ab1) also
inhibited ligand-induced invasion of HNSCC. We confirmed that tumor
cell lines used in these studies (and a larger series not reported
here) generally expressed multiple c-erbB receptors and
ligands. These results indicate that autocrine or paracrine signaling
through EGFR potentiates the invasive potential of HNSCC via the
selective up-regulation and activation of MMP-9. Furthermore, ligands
such as betacellulin (which is commonly expressed in HNSCC), which can
bind to and activate other c-erbB receptors, may be
especially potent in this regard. | INTRODUCTION |
|---|
|
|
|---|
One such factor, the EGFR, is a Mr 170,000
transmembrane phosphoglycoprotein whose overexpression has been shown
to correlate with decreased disease-free survival and increased
metastasis in tumors including HNSCC (3, 4, 5)
. EGFR has at
least seven cognate ligands including EGF itself (6)
,
TGF-
(7)
, BTC (8)
, HB-EGF
(9)
, AR (10)
, and epiregulin
(11)
. Expression of EGF and TGF-
in HNSCC has been
documented by several groups (12
, 13)
; however expression
of the other major ligands (BTC, HB-EGF, AR, and epiregulin) has not
been explored.
Head and neck cancers are characterized by local invasiveness and a propensity for dissemination to cervical lymph nodes. Tumor invasion is a complex process that requires active interactions between the invading cell and the ECM and other stromal elements (14 , 15) . At least three coordinated processes are necessary for cell invasion: (a) changes in cell-cell and cell-matrix adhesion; (b) degradation of the ECM; and (c) cell migration. MMPs, a family of zinc-dependent endopeptidases, are key enzymes involved in these processes (16, 17, 18) . Two members of the MMP family, MMP-2 (gelatinase A) and MMP-9 (gelatinase B), have been shown to be highly expressed and strongly correlated with the malignant phenotype in HNSCC (19, 20, 21) . MMP-2 and MMP-9 substrates include ECM components and collagen type IV, a key component of endothelial basal laminae. Their up-regulation and activation may therefore be directly linked to HNSCC angiogenesis, invasion, and metastasis.
Increasing evidence suggests a correlation between EGFR activation and
some members of the MMP family in malignant keratinocytes (22
, 23)
. However, the mechanisms regulating gelatinase expression in
HNSCC are largely unknown. Previous studies demonstrated stimulation of
MMP-9 expression by EGF/TGF-
in keratinocytes (24)
,
colon cancer cells (25)
, and metastatic human breast
cancer cells (26)
. The relative contributions of EGF-like
ligands other than EGF and TGF-
to HNSCC gelatinase expression have
not been clearly defined. We therefore compared the effects of five
EGF-like ligands (EGF, TGF-
, BTC, HB-EGF, and AR) on gelatinase
expression and invasive capacity in human HNSCC cell lines expressing
different levels of EGFR.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, BTC, HB-EGF, or AR (0.1100
nM) in DMEM/0.1% BSA for the time periods indicated. In
the combined antibody experiment, mAbs (10100 nM) were
added at the same time as growth factors.
Flow Cytometric Analysis of EGFR, c-erbB-2,
c-erbB-3, and c-erbB-4 Expression.
Near-confluent cells were trypsinized, washed with ice-cold PBS, and
counted. Cells (1 x 106 cells/sample) were
incubated with 100 µl of mAb against EGFR (ICR62),
c-erbB-2 (ICR12), c-erbB-3 (Ab-5), and
c-erbB-4 (Ab-3) or rat/mouse IgG as a control for 1 h
at 4°C. After two washes with ice-cold PBS, cells were incubated for
1 h at 4°C with 100 µl of FITC-conjugated rabbit
F(ab')2 antirat IgG (Star17B) or antimouse IgG (Star9B;
Serotec, Oxford, United Kingdom). To compare the levels of
c-erbB receptors between these cell lines, pilot experiments
with a cell line expressing all four receptors (human T47D mammary
carcinoma) were carried out. The optimum concentrations of primary mAb
and FITC-conjugated IgG were found to be 50 nM and 5 µg,
respectively. Finally, cells were washed twice with PBS, resuspended in
1 ml of serum-free DMEM, and analyzed by using a FACScan (Becton
Dickinson).
Proliferation Assay.
The proliferation assay was carried out as described previously, with
some modification (28)
. Briefly, confluent cultures were
trypsinized, and 5 x 103 cells in 200 µl
of DMEM containing 10% FCS were plated per well of a 96-well plate.
After 18 h at 37°C, cells were washed, and 200-µl aliquots of
DMEM/0.5% FCS with ligands (0.01100 nM) and/or rat mAbs
were added to triplicate wells, and the cultures were incubated for 5
days at 37°C. Controls containing medium alone or control rat IgG
were included. Cells were then fixed with glutaraldehyde, washed,
air-dried, and stained with methylene blue. After adding 0.33
N HCl, the absorbance was measured at 620 nm in a Titertek
Multiscan. To determine the initial number of cells plated in each
experiment, an extra plate was set up and fixed after an 18-h
incubation at 37°C. Growth, as a percentage of control, was
determined from the following formula:
![]() |
Semiquantitative RT-PCR.
The semiquantitative RT-PCR assay was carried out as described
previously (30)
. Data regarding gene sequences were
obtained from GenBank. Primers for PCR were designed based on strict
criteria using the Primer Designer program version 2.0 (S&E Software,
PA). Sequences of PCR primer sets for MMP-2, MMP-9, and ß-actin were
as described previously (30)
. Sequences of PCR primer sets
of EGF, TGF-
, BTC, HB-EGF, and AR (in the 5'3' direction) were as
follows: (a) EGF, CACTTGGAACACTACCTCAG (forward) and
AGTGCACATTCCAGGAGCTT (reverse); (b) TGF-
,
CACACTCAGTTCTGCTTCCA (forward) and TAGGTGAACAGGAGTCCGTC (reverse);
(c) BTC, TTCACTGTGTGGTGGCAGAT (forward) and
ACAGCATGTGCAGACACCGA (reverse); (d) HB-EGF,
ATGAAGCTGCTGCCGTCGGT (forward) and CAGTGCTTGTGGCTTGGAGG (reverse); and
(e) AR, CTTCGAGAGCGGCGCACACT (forward) and
TATCAAGAGCGACAGCACCA (reverse).
Conditioned Media Preparation.
Cells were seeded in 96-well plates at 5 x 104 cells/well in DMEM with 10% FCS. After 24 h, the
cells were washed twice with PBS, and medium was replaced with DMEM
containing 0.1% BSA. Forty-eight h later, cells were washed with
serum-free DMEM and incubated with 100 µl of DMEM/0.1% BSA with or
without ligands (0.1100 nM)/mAbs (10100 nM)
for 4872 h at 37°C. Conditioned media were collected, clarified by
cold centrifugation at 2000 rpm for 5 min, and stored at -70°C until
assays. Cells were trypsinized and counted in triplicate.
Quantitative Zymography.
Conditioned media were analyzed under nonreducing conditions and
separated in 11% SDS-polyacrylamide gels copolymerized with 0.1%
(w/v) gelatin to demonstrate gelatinolytic activity (MMP-2 and MMP-9)
as described previously (31)
. Duplicate gels were
incubated as controls in buffer containing 10 mM EDTA to
inhibit MMP activity. The gel was dried with a gel drier and scanned
three times using an Arcus scanner, and the intensity of the bands
(pixel unit) was measured by Quantiscan Image Analysis Software
(Cambridge, United Kingdom). Pilot studies using serial dilution of
standard MMP-2 and MMP-9 (Chemicon International) showed a good linear
correlation between the amount of loading MMPs and the measured
intensity in a range of 312.5 pg to 250 ng. Conditioned medium from the
TPA-treated HT-1080 fibrosarcoma cell line served as a positive control
and a standard for interexperimental variation.
Quantified in Vitro Invasion.
The in vitro invasion assay used the Trans-wells coated with
growth factor-reduced Matrigel matrix as described previously
(30)
. Data were expressed as the percentage invasion: the
ratio of cells invading through the Matrigel matrix-coated inserts
relative to the uncoated control inserts. A nonspecific rat or mouse
IgG was used as a control in antibody studies. Cells under the same
conditions were also set up in 24-well plates, stained with trypan
blue, and counted to assess cell numbers and viability.
Statistical Analysis.
All proliferation experiments were performed in triplicate, and values
are given as the means ± SE. For evaluation of
statistical differences, Students unpaired t test was
used. All experiments were performed at least twice, unless stated
otherwise.
| RESULTS |
|---|
|
|
|---|
|
, BTC, HB-EGF, and AR) in the three HNSCC cell
lines. We found that all cell lines consistently expressed TGF-
,
BTC, HB-EGF, and AR, although to different extents (Fig. 2)
|
|
to
tumors expressing EGFR (27)
, whereas mAb ICR62, which
binds to epitope C, has been shown under test to be the most effective
mAb for inhibiting the binding of the five EGF-like ligands to tumor
cells expressing EGFR (28)
. The effect of treatment with
different ligands in the presence or absence of mAbs on the growth of
Detroit-562 cells was examined. The results (Fig. 4)
, BTC, HB-EGF, or AR) were potentiated in
the presence of mAb ICR9 and were reversed in the presence of mAb
ICR62. The same agonist/antagonistic effects on growth were also found
in SIHN-005A and SIHN-006 (data not shown). These results confirm that
the effects of the five EGF-like ligands on cell proliferation are
mediated directly via the EGFR.
|
|
|
, Fig. 7B
|
|
-treated Detroit-562
cells with mAb ICR62 significantly reduced invasion in a dose-dependent
manner. With 100 nM ICR62, the stimulatory effect of
TGF-
was completely abolished (data not shown). We then examined the
inhibitory effects of ICR62 in combination with other EGF-like ligands.
In accordance with the effect on MMP-9 activity, 100 nM
ICR62 blocked the stimulatory effect of all five ligands (10
nM) on invasion, but the inhibitory effect was not
significant under basal conditions, where invasion was low. (Fig. 9A)
|
| DISCUSSION |
|---|
|
|
|---|
and
the cognate receptor EGFR compared with normal squamous epithelia
(12
, 13) . Previous studies have shown that high levels of
EGFR and TGF-
expression correlate with aggressive behavior,
increased metastasis, and decreased survival in human HNSCC (4
, 5)
. Using RT-PCR analysis, we demonstrated here for the first
time that mRNA of BTC, HB-EGF, and AR is also frequently expressed in
HNSCC cell lines (and also in tumor-associated fibroblasts; data not
shown). Thus, expression of all EGF-like ligands and their receptors
may play a direct role in expression of the metastatic phenotype in
HNSCC via autocrine or paracrine activation.
Recent attention has focused on a possible correlation between
erbB signaling and the expression of MMPs (23
, 35)
. MMPs assist tumor cell invasion and angiogenesis by
degrading either cell surface-associated molecules or the subjacent
matrix itself (17)
. In addition, MMPs may also release
active growth factors such as TGF-
and basic fibroblast growth
factor from cell-bound or ECM-sequestered precursors, further
potentiating EGFR autocrine/paracrine signaling pathways and
facilitating neoangiogenesis (36)
. Evidence supporting an
important role for gelatinases (MMP-2 and MMP-9) in the invasive
potential of malignant keratinocytes has been reported both in
vitro and in vivo (19
, 21
, 24)
. EGF and/or
TGF-
have been shown to enhance the invasive and metastatic
potential of various human cancer cells (37, 38, 39)
. Although
the induction of gelatinases by EGF/TGF-
has been reported
(23
, 25
, 26
, 40) , the role of other EGF-like ligands (BTC,
HB-EGF, and AR) remains unclear. Our study therefore aimed to define
the role of EGF-like ligands and their receptor in the regulation of
these specific MMPs in HNSCC.
Under basal growth conditions, the level of MMP-9 expression and tumor cell invasion was found to parallel the EGFR status of the cell lines. Upon blockade of EGFR signaling by antagonistic EGFR mAb (ICR62), the basal level of MMP-9 expression of SIHN-006 cells was reduced, but it was difficult to detect an effect in Detroit-562 cells, where the level of MMP-9 was already low. This implies that the autocrine loop between EGFR and its endogenous ligands is responsible, at least in part, for the expression and production of MMP-9 in some highly invasive head and neck cells. We also observed this strong correlation between EGFR status, MMP-9 expression, and invasive capacity in a larger series of HNSCC cells (30) .
Our unpublished
results4
and previous studies (4
, 5
, 12
, 13) showed that EGF-like
ligands can be derived not only from tumor cells but also from
connective tissue stromal cells. We found that concentrations of
EGF-like ligands as low as 1 nM induced secretion of
pro-MMP-9 with or without its active form in cell lines that have
moderate to high levels of EGFR. This induction of MMP-9 expression was
dose dependent (up to more than 40-fold at the optimal concentration of
some ligands). The effect of EGF, TGF-
, BTC, HB-EGF, and AR on MMP-9
secretion was specific for this enzyme because MMP-2 expression was not
affected with these ligands in any HNSCC cell line examined. This is
consistent with the differential transcriptional regulation of MMP-9
and MMP-2 genes due to the presence of different promoter elements on
the gelatinase genes (41)
. To the best of our knowledge,
this is the first demonstration that all five EGF-like ligands
up-regulate MMP-9 expression and that some ligands are more potent than
others. SIHN-005A cells, which express low levels of EGFR, did not
secrete MMP-9 in response to any ligands, suggesting that the MMP-9
induction effect by EGF-like ligands in HNSCC is critically dependent
on receptor density.
The concentration of EGF-like ligands required to up-regulate MMP-9 expression and enhance invasion was at least a log higher (in the nanomolar range) than that required to influence cell proliferation (picomolar range) in EGFR-overexpressing HNSCC cell lines. In addition, the proliferation of tumor cells with low levels of EGFR can be stimulated by EGF-like ligands in the absence of effects on MMP-9 expression or invasion (e.g., SIHN-005A). What is more, although the ligands had different (and sometime inhibitory) effects on proliferation, they uniformly stimulated MMP-9 proteolysis and invasion of cell lines overexpressing EGFR independently of mitogenic effects. These data provide evidence that ligand-induced MMP-9 induction and tumor cell invasion are separable from the mitogenic response and perhaps activate different pathways downstream of EGFR or induce different durations of response.
The EGFR is the prototype of the type I receptor tyrosine kinases, which include three additional members: (a) c-erbB-2/neu/HER2; (b) c-erbB-3; and (c) c-erbB-4 (35) . Abnormal expression of other erbB family members, apart from EGFR, has been shown in both HNSCC cell lines and clinical material (Refs. 42, 43, 44 and our results in the three cell lines used in this study). Some of the ligands that we examined bind to more than one erbB receptor and can activate receptors in trans via heterodimerization (45) . Our finding that BTC consistently was the most active ligand in inducing MMP-9 may be explained by these differential patterns of receptor activation. Indeed, BTC has been reported to bind with a high affinity to erbB-4 and to stimulate the tyrosine phosphorylation of both EGFR and erbB-4 (46) . Other possible explanations might be differences in the autocrine production of the ligands in each cell line and the differential binding efficiency of each ligand, leading to alternative endocytic routes of homo- and heterodimeric receptor complexes. We are currently exploring these possibilities.
In conclusion, our studies demonstrate for the first time that exposure of HNSCC cells overexpressing EGFR to five EGF-like ligands results in significant up-regulation of MMP-9 and that BTC produces the most potent effect. Furthermore, an inhibitory mAb directed against the external domain of human EGFR (ICR62) inhibited MMP-9 induction by all EGF-like ligands, whereas a mAb acting as an agonist (ICR9) further potentiated the ligand effects. Also, the autocrine production of MMP-9 was found to correlate with the EGFR status of HNSCC cells and was inhibited by ICR62 in at least one cell line. In addition, the observation that inhibition of MMP-9 activity impedes basal or ligand-mediated tumor cell invasion through a reconstituted basement membrane suggests that EGF-like ligands may play an important functional role in the process of HNSCC invasion by modulating expression of MMP-9. However, the incomplete inhibitory effect of anti-MMP-9 mAb suggests that other MMPs or other proteolytic enzymes (e.g., cathepsins, plasminogen activator) are also involved in the process of ligand-mediated invasion. Finally, these results add another potentially important therapeutic aspect to the use of mAbs against EGFR in terms of blocking the induction of specific members of the MMP family that play a major role in the process of invasion and metastasis.
| FOOTNOTES |
|---|
1 Supported by a grant (to P. O-c.) from the
Faculty of Medicine, Siriraj Hospital Medical School (Bangkok,
Thailand). ![]()
2 To whom requests for reprints should be
addressed, at the Institute of Cancer Research, McElwain Laboratories,
15 Cotswold Road, Sutton, Surrey, SM2 5NG, United Kingdom. Fax:
44-0181-643-0223; E-mail: suzan{at}icr.ac.uk ![]()
3 The abbreviations used are: HNSCC, head and neck
squamous cell carcinoma; EGF, epidermal growth factor; EGFR, EGF
receptor; TGF, transforming growth factor; BTC, betacellulin; MMP,
matrix metalloproteinase; HB-EGF, heparin-binding EGF-like growth
factor; AR, amphiregulin; mAb, monoclonal antibody; ECM, extracellular
matrix; SCC, squamous cell carcinoma; RT-PCR, reverse
transcription-PCR; TPA, tetradecanoyl phorbol acetate. ![]()
Received 6/ 2/99. Accepted 12/13/99.
| REFERENCES |
|---|
|
|
|---|
and survival in upper aerodigestive tract cancer. Anticancer Res., 16: 283-288, 1996.[Medline]
and EGFR protein in head and neck squamous cell carcinoma and patient survival. J. Natl. Cancer Inst., 90: 824-832, 1998.
characteristics of human oral carcinoma cell lines. Br. J. Cancer, 69: 8-15, 1994.[Medline]
This article has been cited by other articles:
![]() |
A. Liu, P. Garg, S. Yang, P. Gong, M. A. Pallero, D. S. Annis, Y. Liu, A. Passaniti, D. Mann, D. F. Mosher, et al. Epidermal Growth Factor-like Repeats of Thrombospondins Activate Phospholipase C{gamma} and Increase Epithelial Cell Migration through Indirect Epidermal Growth Factor Receptor Activation J. Biol. Chem., March 6, 2009; 284(10): 6389 - 6402. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, V. Patel, H. Miyazaki, J.S. Gutkind, and W.A. Yeudall Role for EPS8 in squamous carcinogenesis Carcinogenesis, January 1, 2009; 30(1): 165 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koyama, H. Naruo, Y. Yoshitomi, S. Munesue, S. Kiyono, Y. Kusano, K. Hashimoto, T. Yokoi, H. Nakanishi, S. Shimizu, et al. Matrix Metalloproteinase-9 Associated with Heparan Sulphate Chains of GPI-Anchored Cell Surface Proteoglycans Mediates Motility of Murine Colon Adenocarcinoma Cells J. Biochem., May 1, 2008; 143(5): 581 - 592. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Harari, G. W. Allen, and J. A. Bonner Biology of Interactions: Antiepidermal Growth Factor Receptor Agents J. Clin. Oncol., September 10, 2007; 25(26): 4057 - 4065. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Luangdilok, C. Box, L. Patterson, W. Court, K. Harrington, L. Pitkin, P. Rhys-Evans, P. O-charoenrat, and S. Eccles Syk Tyrosine Kinase Is Linked to Cell Motility and Progression in Squamous Cell Carcinomas of the Head and Neck Cancer Res., August 15, 2007; 67(16): 7907 - 7916. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. E. Willmarth and S. P. Ethier Autocrine and Juxtacrine Effects of Amphiregulin on the Proliferative, Invasive, and Migratory Properties of Normal and Neoplastic Human Mammary Epithelial Cells J. Biol. Chem., December 8, 2006; 281(49): 37728 - 37737. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W Yeh, J.-P. Rougier, J.-W. Park, Q.-Y. Duh, M. Wong, Z. Werb, and O. H Clark Differentiated thyroid cancer cell invasion is regulated through epidermal growth factor receptor-dependent activation of matrix metalloproteinase (MMP)-2/gelatinase A Endocr. Relat. Cancer, December 1, 2006; 13(4): 1173 - 1183. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Younes, Y. W. Park, Y. D. Yazici, M. Gu, A. A. Santillan, X. Nong, S. Kim, S. A. Jasser, A. K. El-Naggar, and J. N. Myers Concomitant inhibition of epidermal growth factor and vascular endothelial growth factor receptor tyrosine kinases reduces growth and metastasis of human salivary adenoid cystic carcinoma in an orthotopic nude mouse model. Mol. Cancer Ther., November 1, 2006; 5(11): 2696 - 2705. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sarkaria, P. O-charoenrat, S. G. Talbot, P. G. Reddy, I. Ngai, E. Maghami, K. N. Patel, B. Lee, Y. Yonekawa, M. Dudas, et al. Squamous Cell Carcinoma Related Oncogene/DCUN1D1 Is Highly Conserved and Activated by Amplification in Squamous Cell Carcinomas Cancer Res., October 1, 2006; 66(19): 9437 - 9444. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Eum, Y. W. Lee, B. Hennig, and M. Toborek Interplay between Epidermal Growth Factor Receptor and Janus Kinase 3 Regulates Polychlorinated Biphenyl-Induced Matrix Metalloproteinase-3 Expression and Transendothelial Migration of Tumor Cells Mol. Cancer Res., June 1, 2006; 4(6): 361 - 370. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q Qiu, M Yang, B K Tsang, and A Gruslin EGF-induced trophoblast secretion of MMP-9 and TIMP-1 involves activation of both PI3K and MAPK signalling pathways Reproduction, September 1, 2004; 128(3): 355 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Whitsett, C. J. Bachurski, K. C. Barnes, P. A. Bunn Jr., L. M. Case, D. N. Cook, D. Crooks, M. W. Duncan, L. Dwyer-Nield, R. C. Elston, et al. Functional Genomics of Lung Disease Am. J. Respir. Cell Mol. Biol., August 1, 2004; 31(2/S1): S1 - S81. [Full Text] [PDF] |
||||
![]() |
E. E.W. Cohen, M. W. Lingen, and E. E. Vokes The Expanding Role of Systemic Therapy in Head and Neck Cancer J. Clin. Oncol., May 1, 2004; 22(9): 1743 - 1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fieber, P. Baumann, R. Vallon, C. Termeer, J. C. Simon, M. Hofmann, P. Angel, P. Herrlich, and J. P. Sleeman Hyaluronan-oligosaccharide-induced transcription of metalloproteases J. Cell Sci., January 15, 2004; 117(2): 359 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Thomas, F. M. Coppelli, A. Wells, W. E. Gooding, J. Song, J. Kassis, S. D. Drenning, and J. R. Grandis Epidermal Growth Factor Receptor-stimulated Activation of Phospholipase C{gamma}-1 Promotes Invasion of Head and Neck Squamous Cell Carcinoma Cancer Res., September 1, 2003; 63(17): 5629 - 5635. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mendelsohn and J. Baselga Status of Epidermal Growth Factor Receptor Antagonists in the Biology and Treatment of Cancer J. Clin. Oncol., July 15, 2003; 21(14): 2787 - 2799. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z Liu and J Klominek Regulation of matrix metalloprotease activity in malignant mesothelioma cell lines by growth factors Thorax, March 1, 2003; 58(3): 198 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Su, Y.-Q. Wei, L. Tian, X. Zhao, L. Yang, Q.-M. He, Y. Wang, Y. Lu, Y. Wu, F. Liu, et al. Active Immunogene Therapy of Cancer with Vaccine On the Basis of Chicken Homologous Matrix Metalloproteinase-2 Cancer Res., February 1, 2003; 63(3): 600 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Andl, T. Mizushima, H. Nakagawa, K. Oyama, H. Harada, K. Chruma, M. Herlyn, and A. K. Rustgi Epidermal Growth Factor Receptor Mediates Increased Cell Proliferation, Migration, and Aggregation in Esophageal Keratinocytes in Vitro and in Vivo J. Biol. Chem., January 10, 2003; 278(3): 1824 - 1830. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gschwind, N. Prenzel, and A. Ullrich Lysophosphatidic Acid-induced Squamous Cell Carcinoma Cell Proliferation and Motility Involves Epidermal Growth Factor Receptor Signal Transactivation Cancer Res., November 1, 2002; 62(21): 6329 - 6336. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Choe, J. K. Park, L. Jouben-Steele, T. J. Kremen, L. M. Liau, H. V. Vinters, T. F. Cloughesy, and P. S. Mischel Active Matrix Metalloproteinase 9 Expression Is Associated with Primary Glioblastoma Subtype Clin. Cancer Res., September 1, 2002; 8(9): 2894 - 2901. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Salcedo, M. Martins-Green, B. Gertz, J. J. Oppenheim, and W. J. Murphy Combined Administration of Antibodies to Human Interleukin 8 and Epidermal Growth Factor Receptor Results in Increased Antimetastatic Effects on Human Breast Carcinoma Xenografts Clin. Cancer Res., August 1, 2002; 8(8): 2655 - 2665. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-M. Huang, J. Li, and P. M. Harari Molecular Inhibition of Angiogenesis and Metastatic Potential in Human Squamous Cell Carcinomas after Epidermal Growth Factor Receptor Blockade Mol. Cancer Ther., May 1, 2002; 1(7): 507 - 514. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aznavoorian, B. A. Moore, L. D. Alexander-Lister, S. L. Hallit, L. J. Windsor, and J. A. Engler Membrane Type I-Matrix Metalloproteinase-Mediated Degradation of Type I Collagen by Oral Squamous Cell Carcinoma Cells Cancer Res., August 1, 2001; 61(16): 6264 - 6275. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. O-charoenrat, P. H. Rhys-Evans, and S. A. Eccles Expression of Matrix Metalloproteinases and Their Inhibitors Correlates With Invasion and Metastasis in Squamous Cell Carcinoma of the Head and Neck Arch Otolaryngol Head Neck Surg, July 1, 2001; 127(7): 813 - 820. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |