| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrinology |
Departments of Medicine [M. M., R. N., E. P.], Molecular and Cellular Biology [M. M., N. L. W., D. J. L.], and Pathology [M. I.], Scott Department of Urology [S. M., R. S., L. M., Y. Z., D. D., A. E., J. E., D. J. L.], Baylor College of Medicine, and Veterans Affairs Medical Center [M. M., M. I.], Houston, Texas 77030
| ABSTRACT |
|---|
|
|
|---|
The overall number of mutations detected was 11 (8%). No mutations were detected in any of the 99 patients with stage B disease. Eleven mutations were detected in exons 28 in 8 of the 38 patients with stage D1 disease (all in group 2B). Simultaneous analysis of exon 2 of the progesterone receptor was carried out, and no SSCP changes were identified.
These data suggest that AR mutations are rare and presumably do not play a role in the initial phase of prostatic carcinogenesis. The presence of a significant number of AR mutations in metastatic disease indicates that mutations of this molecule may play a role in the most advanced phases of the natural history of this disease, either by facilitating growth or acquisition of the metastatic phenotype.
| INTRODUCTION |
|---|
|
|
|---|
Radical prostatectomy is the main curative treatment for men with organ-confined disease. Most men with non-organ-confined disease will undergo palliation with radiation or androgen ablation. Androgen ablation successfully shrinks primary and metastatic lesions by inducing apoptosis of androgen-dependent prostate cancer cells (4) in up to 80% of the cases (5) . Unfortunately, prostate cancer is a heterogeneous lesion and at the time of diagnosis may contain foci of both androgen-dependent and -independent cells (6) . Androgen-independent cells escape apoptosis induced by androgen ablation (7) and by many cytotoxic drugs. They continue to proliferate and metastasize, despite profound changes in the surrounding hormonal milieu, and represent the most direct threat to patient survival. There is evidence that the AR is expressed in all stages of prostate cancer evolution, including prostatic intraepithelial neoplasia (8) , primary (9 , 10) and metastatic (11 , 12) disease, both before and after androgen ablation therapy. Few prostate cancers are AR negative (13) , and thus, even the androgen-independent tumors express the AR protein.
In the wake of the earlier identification of "outlaw estrogen receptors" in breast cancer (14) , the possibility that point mutations in the AR may account for progression from androgen-dependent to androgen-independent growth has been a popular theory. Numerous investigators have used PCR-SSCP of DNA extracted from foci of prostate cancer to search for AR variants, both in clinically detectable disease and in latent prostate cancer.
A review of published data (Refs. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 ; reviewed in Ref. 37 ) shows that there is still considerable controversy in the field. A total of 581 cases of clinically detectable prostate cancer have been analyzed at the molecular level for the presence of AR mutations. To date, a total of 47 mutations (frequency, 8%) causing an amino acid change or addition have been detected. Interestingly, 22 of these mutations (46% of total) were reported by three groups from a total of 59 patients (frequency of mutations in these 59 patients, 37%; Refs. 21 , 26, and 34 ). The remaining 25 mutations were detected in 522 patients (frequency, 4.7%). Methodological variables and patient sampling may be responsible for these discrepancies in the literature. For instance, Tilley et al. (34) demonstrated that variables correlating with increased prevalence of AR mutations are the use of tumor-enriched DNA after microdissection of the sample and analysis of exon 1. Another potential methodological variable is the quality of DNA extracted from paraffin-embedded tissue, which according to some reports is not optimal and may account for an increased frequency of PCR infidelity (38) .
In view of the controversies still existing in the field, we have studied the molecular structure of the AR in a large series of specimens derived from stage B prostate cancers and from metastatic deposits to pelvic lymph nodes (stage D1). We have determined the importance of using microdissected versus nonmicrodissected specimens, of extracting DNA from fresh versus archival tissue, and of analyzing exon 1 to the overall incidence of detection of receptor mutations. We report a significant increase in AR mutations in metastatic (stage D1) compared with localized (stage B) prostate cancers.
| MATERIALS AND METHODS |
|---|
|
|
|---|
10 mg (group 1A), which were
isolated according to the procedure of Wheeler and Lebovitz
(39)
and contain at least 25% of cancer. The remaining 85
samples (group 1B) were snap frozen and extracted after ascertaining
the presence of at least 50% neoplastic tissue by frozen section
analysis, as described by Ittmann et al. (40)
.
High molecular weight genomic DNA was extracted from the powdered
samples of group 1A using 10 volumes of extraction buffer [10
mM Tris-Cl (pH 8.0), 0.1 M
EDTA (pH 8.0), 10 µg/ml RNase, and 0.5% SDS] for 1 h at
37°C. Proteinase K at a final concentration of 100 µg/ml was then
added and incubated at 50°C for 3 h. After three phenol
extractions, the aqueous phase was dialyzed in 50
mM Tris (pH 8.0) at 4°C for 24 h. One µg
of this highly purified material was used in each PCR reaction. We also studied 38 paraffin-embedded pelvic lymph nodes resected from patients with stage D prostate cancer (group 2). Of these, 8 were not microdissected and contained 2025% cancer (group 2A). Thirty were microdissected and contained 9095% cancer (group 2B). To enrich for tumor-derived DNA, specimens of group 2B were cut in three sections of 4, 25, and 4 µm. After H&E staining, a pathologist identified the region containing 100% cancer in the two 4-µm sections. The 25-µm region located between the two adjacent sections containing 100% cancer was microdissected and then deparaffinized in xylene and ethanol and precipitated by microcentrifugation at 4°C. Genomic DNA was extracted through digestion in a 100-µl volume [10 mM Tris (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.45% Tween 20, and 0.1 mg of proteinase K] at 65°C for 2 h, followed by denaturation of proteinase K at 95°C for 10 min. Depending on the final yield, 410 µl of genomic DNA were used in each PCR reaction.
PCR-SSCP.
PCR amplification of exons 28 was performed using a MJ Research
Thermal Cycler and the primers reported previously (41)
,
with the exception of exon 4, which was amplified using two sets of
overlapping primers to generate products within the acceptable range
that maintains SSCP sensitivity. The primers used for exon 4 were the
following: IV-S, TGATAAATTCAAGTCTCTCTTCCTT; IV-AS,
ACACACTACACCTGGCTCAATGGCTT; IVB-S, CAGTGTCACACATTGAAGGCTATGAA; and
IVB-AS, CACTAAATATGATCCCCCTTATCTC.
Eight sets of overlapping sense (S) and antisense (AS) primers were used to amplify exon 1. The coordinates of these oligonucleotides are derived from the sequence of Tilley et al. (2) . Primer E1-VIIIAS is derived from the region of intron 1 adjacent to the 3' of exon 1 (41) . The eight sets of primers are: E1-IS, 139TGGAAGATTCAGCCAAGCTCAAG161; E1-IAS, 417CTGCTGCTGCCTGGGGCTAGTCTC394; E1-IIS, 280AGGCACCCAGAGGCCGCGAGCGCAG304; E1-IIAS, 579GCTGGCGGCCACGGCGGCTCCAGG556; E1-IIIS, 514TCGGCCCTGGAGTGCCACCCCGAGA538; E1-IIIAS, 912CGCCTCCACACCCAGGCCCATGGA889; E1-IVS, 612GGACGAGGATGACTCAGCTGCCCCA636; E1-IVAS, 1113TAGCCCTTTGGTGTAACCTCCCTTG1089; E1-VS, 803CTCCCACTTCCTCCAAGGACAA824; E1-VAS, 1264AGCCAGTGGAAAGTTGTAGTAGTC1240; E1-VIS, 1207GCACTGGACGAGGCAGCTGCGTAC1230; E1-VIAS, 1506CCACACGGTCCATACAACTGGCC1483; E1-VIIS, 1401CGCGGGTGCAGCGGGACCCGGTTCT1425; E1-VIIAAS, 1660ACACATCAGGTGCGGTGAAGTCGCT1636; E1-VIIIS, 1578GGGAGCTGTAGCCCCCTACGGCTAC1602; and E1-VIIIAS, CGAAAGCGACATTTCTGGAAGGAAA. Exon 2 of the human PR was also amplified and used as a control using oligonucleotides: PR-S, GCATTTCAAGGCCGGATTCAGAAGC; and PR-AS, AGGAGCCTACCTTCCATTGCCC (42) .
Because the process of confirming the identification of point mutations used very stringent criteria and numerous PCR reactions (see below), there was insufficient genomic DNA available to analyze exon 1 of the AR gene in groups 1A, 2A, and 2B; however, we were able to analyze all eight exons in group 1B.
The PCR reaction involved denaturation at 100°C for 30 s, annealing and extension at 68°C for 90 s for 35 cycles using 2.5 units of Taqara (Pan Vera Corporation, Madison WI), and 1 µl of [32P]dCTP per reaction. The size and integrity of the PCR product and the absence of contamination in the negative control sample (in which no DNA was added) were confirmed on 2% agarose gels. SSCP analysis was performed according to the published procedures (43, 44, 45) . Briefly, 5 µl of PCR sample plus 20 µl of formamide loading dye (0.05% bromphenol blue, 0.05% xylene cyanol, 50 mM EDTA, and 20 mM NaOH in deionized formamide) were boiled for 10 min, snap-frozen in dry ice, and thawed. Six µl of the samples were electrophoresed on a 6% nondenaturing polyacrylamide gel at 400 V for 1424 h, depending on the fragment generated. A nondenatured wild-type AR control was run in parallel with the other denatured samples to determine the mobility of the double-stranded DNA. As an internal control, each gel was run with a positive and a negative control (i.e., a PCR product generated from the genomic DNA of patients with testicular feminization that were known to have a wild-type or mutated sequence in exons 28). This genomic DNA was used to optimize the SSCP conditions. For instance, in most cases a run of 1214 h was sufficient to detect the abnormal SSCP migration of the positive control; however, in the case of exons 3 and 7, a run of 2224 h was necessary. This genomic DNA was the generous gift of Dr. M. J. McPhaul (University of Texas Southwestern Medical Center, Dallas, TX). Each of the positive mutant AR controls used in these studies has been characterized and published (41 , 46, 47, 48, 49, 50, 51, 52, 53) . After electrophoresis, gels were dried and exposed to X-ray films for autoradiography at -80°C.
DNA Sequencing.
Stringent criteria were adopted to eliminate PCR artifacts. The
presence of a variant SSCP shift was confirmed in three independent PCR
reactions. These PCR products were divided into three aliquots, of
which one was run in the SSCP gel and one in an agarose gel to verify
the presence of the correct amplified product and the absence of
background in the negative control. The third aliquot was TA-subcloned
into the pCR2.1-TOPO plasmid (Invitrogen, Carlsbad, CA) and
dideoxy-sequenced (54)
in a denaturing polyacrylamide gel,
using the Sequenase 2.0 sequencing kit (United States Biochemical
Corp., Cleveland, OH). Each mutation was confirmed a minimum of three
times from multiple clones (up to 20) obtained from at least three
independent PCR amplifications. Sequencing was performed in both the
sense and antisense orientations.
Exon 1 of group 1B was analyzed by direct sequencing of the PCR product using an automated sequencer (Perkin-Elmer Sequencer 310). Sequence analysis was performed multiple times (up to 10) from the product of at least two PCR amplifications. Each reaction mix consisted of 3090 ng of the purified PCR product, 3.2 pmol of primer, and 4 µl of Big Dye Terminator dye mix (Perkin-Elmer Applied Biosystems, Foster City CA). PCR sequencing was performed at 96°C for 30 s, 50°C for 15 s, and 60°C for 4 min for a total of 25 cycles. The resulting DNA was then precipitated in ethanol, dissolved in 12 µl of formamide, and analyzed on the automatic sequencer. Computer analysis, and careful reading of the sequencer print out were used to distinguish mutations. All nucleotides of exon 1 were sequenced except the polyQ and polyG repeats. AR amino acid numbering reported in this study is based on an assumed length of 919 amino acids to be consistent with the AR mutation web site.4 To determine the sensitivity of our automated sequencing technique, we performed serial dilutions of mutant and wild-type genomic DNA [ranging from 1:1 to 1:1/10 (wild type:mutant)]. Each dilution was amplified and sequenced, and in each instance a mutation of the correct nucleotide was detected (not shown). These data indicate that direct sequencing identifies point mutations if they are present in 10% of the genomic DNA. Because previous pilot experiments in our laboratory have demonstrated that a mutation can correctly be identified by SSCP if it is present in 1015% of the genomic DNA, we conclude that direct sequencing is at least as sensitive as SSCP in detecting point mutations.
| RESULTS |
|---|
|
|
|---|
|
Metastatic Lesions (Groups 2A and 2B).
SSCP analysis of specimens from groups 2A and 2B showed 19 reproducible
shifts (in at least two separate PCR reactions) in the seven exons that
were analyzed (four shifts in group 2A and 15 in group 2B). Sequence
analysis revealed 11 mutations (all in group 2B), 10 missense and 1
nonsense mutations (Table 1)
. Each mutation was detected at least once in each of the three PCR
amplifications performed for each exon during the SSCP screening (Table 1)
. Fig. 2
shows the SSCP pattern of the mutations detected in patients 3 and 20.
Each of these mutations was a somatic event, because wild-type
sequences were also detected. Four of these mutations were detected in
patient 1 and involved exons 5 (A-748-T), 7 (S-865-P and Q-867-stop),
and 8 (Q-919-R). Because each exon was amplified individually from a
pool of DNA derived from many cells, it is impossible to know if these
mutations were present in the same AR molecule or even the same cell.
We consistently found two mutations in exon 7 of this patient. Because
they were never detected in the same template, they most likely
represent separate events that affected two individual AR molecules.
The remaining seven mutations were detected in seven different patients
and affected exons 2 (in four cases), 3, 5, and 7.
|
|
| DISCUSSION |
|---|
|
|
|---|
30% of the samples (55)
. This
result is in agreement with several studies by other groups and
indicates that this DNA was indeed enriched with tumor DNA. Because a
large amount of genomic DNA was available for group 1B, we were able
expand our analysis to exon 1. Sequence analysis demonstrated
conclusively that no amino acid changes were present in this group of
patients, although a somatic polymorphism was detected. On the basis of the studies performed with groups 1A and 1B, which represent almost 50% of all published stage B cases that have been analyzed for AR mutations, we conclude that AR mutations are quite rare in patients with clinically localized disease and usually do not play a role in the initial phases of prostatic carcinogenesis. These conclusions are largely based on the use of SSCP or direct sequencing as screening techniques to detect mutations, and both these procedures are sensitive if a mutation is present in at least 1015% of the genomic DNA. Thus, it could be argued that techniques more sensitive could alter the apparent frequency of mutations detected. In agreement with our findings, previous studies of other authors have detected AR mutations only in 2.1% of patients with stage B disease (15, 16, 17, 18 , 22, 23, 24 , 29 , 32 , 33 , 35) . Thus, we believe that AR mutations are exceptionally rare in this early phase of the natural history of prostate cancer.
Metastatic Disease.
In view of the controversies existing in the field, we investigated
patients with metastatic prostate cancer. We microdissected metastatic
tissue obtained from patients who were unexpectedly found to have
non-organ-confined disease on the frozen sections of the regional lymph
nodes analyzed at the time of radical prostatectomy. Analysis of these
cancers, all obtained before implementation of androgen ablation,
demonstrated that AR mutations occur in metastatic prostate cancer in
contrast to stage B disease. A total of 11 mutations was detected in
this group of 38 patients. Because four of these 11 mutations were in
the same patient, AR variants were present in 8 patients of 38 screened
(i.e., 21%). We were unable to analyze exon 1 in this group
of patients, and a previous report (34)
has identified a
significant number of AR mutations in exon 1. Thus, the exact
prevalence of AR mutations in stage D1 prostate cancer may be even
higher than that established by our study.
Because no SSCP abnormalities were found in exon 2 of the PR, we conclude that the relatively high prevalence of mutations in stage D1 disease is not attributable to generalized genetic instability, and that specific mechanisms selecting these mutations may be involved. Because the patients described in this report were analyzed prior to initiation of hormonal therapy, our findings also support the hypothesis that cells with mutant AR can preexist androgen-ablative treatments. The presence of AR mutations in metastatic deposits obtained from patients with stage D1 disease confirms previous reports by Taplin et al. (26 , 27) in stage D2 and suggests that AR mutations may play an active role in promoting the metastatic phenotype.
| Characteristics of the Various Mutations Detected |
|---|
|
|
|---|
Mutation Q-867-stop has never been described before. However, previous investigators have studied the transcriptional activity of AR molecules containing premature stop codons in regions surrounding Q-867. Because these mutants [W-796-stop (46) and S-853-stop (53) ] were both transcriptionally silent, we predict by analogy that also Q-867 is an AR mutation causing loss of transcriptional activity.
| Role Played by the Different Methodological Variables |
|---|
|
|
|---|
An additional variable may be the analysis of exon 1. Tilley et al. (34) have identified the majority of their mutations in this segment of AR. Many investigators have neglected analysis of exon 1 for different reasons. It is difficult to obtain sufficient DNA to perform 16 PCR amplifications. In addition, many authors have been influenced by the molecular analysis of AR in patients with androgen resistance syndromes, where the majority of the mutations were identified in exons 28. We were unable to study the incidence of mutations in exon 1 of groups 1A, 2A, and 2B; however, no mutations were detected in exon 1 of group 1B. Again, this may simply reflect the low prevalence of AR mutations in prostate cancer at this early stage.
A final methodological variable that may have overinflated the number of mutations in other series is the use of DNA derived from paraffin-embedded tissue. As noted above, a large number of base changes were detected only in archival tissue, suggesting that the process of paraffin embedment has detrimental effects on the quality of genomic DNA. However, one could argue that the absence of SSCP variants in exon 2 of PR in paraffin-embedded tissue should rule out artifact as the cause of these irreproducible base changes. This issue has been investigated in a concomitant investigation,5 where we have performed parallel sequence analysis of DNA coming from paraffin-embedded and frozen tissue without SSCP bandshifts. This analysis demonstrated that irreproducible base changes are uniquely present in DNA derived from paraffin-embedded tissue. Thus, our experience suggests that extreme care should be placed in interpreting data derived from genomic DNA extracted from paraffin-embedded tissue. Nonetheless, our stringent criterion for identification of mutations (i.e., a high percentage of a single mutation by sequencing multiple independent PCR reactions) rules out the possibility that the difference we observed between stages B and D1 disease is a function of differences in the tissue processing.
| Conclusions |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by Grants CA68615 from the National
Cancer Institute, CaP CURE, and the Baylor Specialized Programs of
Research Excellence on Prostate Cancer. ![]()
2 To whom requests for reprints should be
addressed, at Baylor College of Medicine, Veterans Affairs Medical
Center, 2002 Holcombe Boulevard, Houston, TX 77030. E-mail: marcelli{at}bcm.tmc.edu ![]()
3 The abbreviations used are: AR, androgen
receptor; SSCP, single-stranded conformational polymorphism; PR,
progesterone receptor. ![]()
4 Internet address:
http://www.mcgill.ca/androgendb/data.htm. ![]()
5 D. J. Lamb, N. L. Weigel, and M. Marcelli,
manuscript in preparation. ![]()
Received 8/16/99. Accepted 12/15/99.
| REFERENCES |
|---|
|
|
|---|
18)) in the androgen receptor gene in human prostate cancer. Biochem. Biophys. Res. Commun., 198: 74-80, 1994.[Medline]
-reductase 2 deficiency. J. Clin. Investig., 90: 799-809, 1992.
Cys) results from a combination of decreased messenger ribonucleic acid levels and impairment of receptor function. J. Clin. Endocrinol. Metab., 73: 318-325, 1991.This article has been cited by other articles:
![]() |
K. K. Waltering, M. A. Helenius, B. Sahu, V. Manni, M. J. Linja, O. A. Janne, and T. Visakorpi Increased Expression of Androgen Receptor Sensitizes Prostate Cancer Cells to Low Levels of Androgens Cancer Res., October 15, 2009; 69(20): 8141 - 8149. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Malinowska, H. Neuwirt, I. T Cavarretta, J. Bektic, H. Steiner, H. Dietrich, P. L Moser, D. Fuchs, A. Hobisch, and Z. Culig Interleukin-6 stimulation of growth of prostate cancer in vitro and in vivo through activation of the androgen receptor Endocr. Relat. Cancer, March 1, 2009; 16(1): 155 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. O'Mahony, M. P. Steinkamp, M. A. Albertelli, M. Brogley, H. Rehman, and D. M. Robins Profiling Human Androgen Receptor Mutations Reveals Treatment Effects in a Mouse Model of Prostate Cancer Mol. Cancer Res., November 1, 2008; 6(11): 1691 - 1701. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Martinez, R. J. Jasavala, I. Hinkson, L. D. Fitzgerald, J. S. Trimmer, H.-J. Kung, and M. E. Wright RNA Editing of Androgen Receptor Gene Transcripts in Prostate Cancer Cells J. Biol. Chem., October 31, 2008; 283(44): 29938 - 29949. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Vasaitis, A. Belosay, A. Schayowitz, A. Khandelwal, P. Chopra, L. K. Gediya, Z. Guo, H.-B. Fang, V. C.O. Njar, and A. M.H. Brodie Androgen receptor inactivation contributes to antitumor efficacy of 17{alpha}-hydroxylase/17,20-lyase inhibitor 3{beta}-hydroxy-17-(1H-benzimidazole-1-yl)androsta-5,16-diene in prostate cancer Mol. Cancer Ther., August 1, 2008; 7(8): 2348 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-L. Hsieh, C. Cai, A. Giwa, A. Bivins, S.-Y. Chen, D. Sabry, K. Govardhan, and L. Shemshedini Expression of a hyperactive androgen receptor leads to androgen-independent growth of prostate cancer cells J. Mol. Endocrinol., July 1, 2008; 41(1): 13 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Maitland and A. T. Collins Prostate Cancer Stem Cells: A New Target for Therapy J. Clin. Oncol., June 10, 2008; 26(17): 2862 - 2870. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. G.-W. Wong, T. Nitkunan, I. Oinuma, C. Zhou, V. Blanc, R. S. D. Brown, S. R. J. Bott, J. Nariculam, G. Box, P. Munson, et al. Plexin-B1 mutations in prostate cancer PNAS, November 27, 2007; 104(48): 19040 - 19045. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Z. Lu, S. E. Wardell, K. L. Burnstein, D. Defranco, P. J. Fuller, V. Giguere, R. B. Hochberg, L. McKay, J.-M. Renoir, N. L. Weigel, et al. International Union of Pharmacology. LXV. The Pharmacology and Classification of the Nuclear Receptor Superfamily: Glucocorticoid, Mineralocorticoid, Progesterone, and Androgen Receptors Pharmacol. Rev., December 1, 2006; 58(4): 782 - 797. [Full Text] [PDF] |
||||
![]() |
Y. B. Wetherill, J. K. Hess-Wilson, C. E.S. Comstock, S. A. Shah, C. R. Buncher, L. Sallans, P. A. Limbach, S. Schwemberger, G. F. Babcock, and K. E. Knudsen Bisphenol A facilitates bypass of androgen ablation therapy in prostate cancer Mol. Cancer Ther., December 1, 2006; 5(12): 3181 - 3190. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Berger, D. I. Lin, M. Nieto, E. Sicinska, L. A. Garraway, H. Adams, S. Signoretti, W. C. Hahn, and M. Loda Androgen-Dependent Regulation of Her-2/neu in Prostate Cancer Cells Cancer Res., June 1, 2006; 66(11): 5723 - 5728. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Pienta and D. Bradley Mechanisms underlying the development of androgen-independent prostate cancer. Clin. Cancer Res., March 15, 2006; 12(6): 1665 - 1671. [Full Text] [PDF] |
||||
![]() |
B. He, R. T. Gampe Jr., A. T. Hnat, J. L. Faggart, J. T. Minges, F. S. French, and E. M. Wilson Probing the Functional Link between Androgen Receptor Coactivator and Ligand-binding Sites in Prostate Cancer and Androgen Insensitivity J. Biol. Chem., March 10, 2006; 281(10): 6648 - 6663. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zheng, C. Cai, J. Omwancha, S.-Y. Chen, T. Baslan, and L. Shemshedini SUMO-3 Enhances Androgen Receptor Transcriptional Activity through a Sumoylation-independent Mechanism in Prostate Cancer Cells J. Biol. Chem., February 17, 2006; 281(7): 4002 - 4012. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Duff and I. J. McEwan Mutation of Histidine 874 in the Androgen Receptor Ligand-Binding Domain Leads to Promiscuous Ligand Activation and Altered p160 Coactivator Interactions Mol. Endocrinol., December 1, 2005; 19(12): 2943 - 2954. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida, H. Kinoshita, T. Segawa, E. Nakamura, T. Inoue, Y. Shimizu, T. Kamoto, and O. Ogawa Antiandrogen Bicalutamide Promotes Tumor Growth in a Novel Androgen-Dependent Prostate Cancer Xenograft Model Derived from a Bicalutamide-Treated Patient Cancer Res., November 1, 2005; 65(21): 9611 - 9616. [Abstract] [Full Text] [PDF] |
||||
![]() |
K-M Rau, H-Y Kang, T-L Cha, S A Miller, and M-C Hung The mechanisms and managements of hormone-therapy resistance in breast and prostate cancers Endocr. Relat. Cancer, September 1, 2005; 12(3): 511 - 532. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z Culig, H Steiner, G Bartsch, and A Hobisch Mechanisms of endocrine therapy-responsive and -unresponsive prostate tumours Endocr. Relat. Cancer, June 1, 2005; 12(2): 229 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Pajonk, A. van Ophoven, and W. H. McBride Hyperthermia-Induced Proteasome Inhibition and Loss of Androgen Receptor Expression in Human Prostate Cancer Cells Cancer Res., June 1, 2005; 65(11): 4836 - 4843. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pandini, R. Mineo, F. Frasca, C. T. Roberts Jr., M. Marcelli, R. Vigneri, and A. Belfiore Androgens Up-regulate the Insulin-like Growth Factor-I Receptor in Prostate Cancer Cells Cancer Res., March 1, 2005; 65(5): 1849 - 1857. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Larson, Y. Ding, L. S-C. Cheng, C. Lundberg, V. Gagalang, G. Rivas, L. Geller, J. Weitzel, D. MacDonald, J. Archambeau, et al. Genetic Linkage of Prostate Cancer Risk to the Chromosome 3 Region Bearing FHIT Cancer Res., February 1, 2005; 65(3): 805 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. B. Wetherill, N. L. Fisher, A. Staubach, M. Danielsen, R. W. de Vere White, and K. E. Knudsen Xenoestrogen Action in Prostate Cancer: Pleiotropic Effects Dependent on Androgen Receptor Status Cancer Res., January 1, 2005; 65(1): 54 - 65. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Unni, S. Sun, B. Nan, M. J. McPhaul, B. Cheskis, M. A. Mancini, and M. Marcelli Changes in Androgen Receptor Nongenotropic Signaling Correlate with Transition of LNCaP Cells to Androgen Independence Cancer Res., October 1, 2004; 64(19): 7156 - 7168. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Foley, D. Hollywood, and M. Lawler Molecular pathology of prostate cancer: the key to identifying new biomarkers of disease Endocr. Relat. Cancer, September 1, 2004; 11(3): 477 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. N. Papandreou and C. J. Logothetis Bortezomib as a Potential Treatment for Prostate Cancer Cancer Res., August 1, 2004; 64(15): 5036 - 5043. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Heinlein and C. Chang Androgen Receptor in Prostate Cancer Endocr. Rev., April 1, 2004; 25(2): 276 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Gregory, X. Fei, L. A. Ponguta, B. He, H. M. Bill, F. S. French, and E. M. Wilson Epidermal Growth Factor Increases Coactivation of the Androgen Receptor in Recurrent Prostate Cancer J. Biol. Chem., February 20, 2004; 279(8): 7119 - 7130. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Lee and C. Chang Expression and Degradation of Androgen Receptor: Mechanism and Clinical Implication J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4043 - 4054. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Nelson, A. M. De Marzo, and W. B. Isaacs Prostate Cancer N. Engl. J. Med., July 24, 2003; 349(4): 366 - 381. [Full Text] [PDF] |
||||
![]() |
M.-E. Taplin, B. Rajeshkumar, S. Halabi, C. P. Werner, B. A. Woda, J. Picus, W. Stadler, D. F. Hayes, P. W. Kantoff, N. J. Vogelzang, et al. Androgen Receptor Mutations in Androgen-Independent Prostate Cancer: Cancer and Leukemia Group B Study 9663 J. Clin. Oncol., July 15, 2003; 21(14): 2673 - 2678. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. de la Taille, M. A. Rubin, M.-W. Chen, F. Vacherot, S. G.-D. de Medina, M. Burchardt, R. Buttyan, and D. Chopin {beta}-Catenin-related Anomalies in Apoptosis-resistant and Hormone-refractory Prostate Cancer Cells Clin. Cancer Res., May 1, 2003; 9(5): 1801 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-N. Song, R. Herrell, S. Byers, S. Shah, E. M. Wilson, and E. P. Gelmann {beta}-Catenin Binds to the Activation Function 2 Region of the Androgen Receptor and Modulates the Effects of the N-Terminal Domain and TIF2 on Ligand-Dependent Transcription Mol. Cell. Biol., March 1, 2003; 23(5): 1674 - 1687. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Lamb, E. Puxeddu, N. Malik, D. L. Stenoien, R. Nigam, G. Y. Saleh, M. Mancini, N. L. Weigel, and M. Marcelli Molecular Analysis of the Androgen Receptor in Ten Prostate Cancer Specimens Obtained Before and After Androgen Ablation J Androl, March 1, 2003; 24(2): 215 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Santamaria, P. L. Fernandez, X. Farre, P. Benedit, J. Reventos, J. Morote, R. Paciucci, and T. M. Thomson PTOV-1, a Novel Protein Overexpressed in Prostate Cancer, Shuttles between the Cytoplasm and the Nucleus and Promotes Entry into the S Phase of the Cell Division Cycle Am. J. Pathol., March 1, 2003; 162(3): 897 - 905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.R. Maduro, R. Casella, E. Kim, N. Levy, C. Niederberger, L.I. Lipshultz, and D.J. Lamb Microsatellite instability and defects in mismatch repair proteins: a new aetiology for Sertoli cell-only syndrome Mol. Hum. Reprod., February 1, 2003; 9(2): 61 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hara, J.-i. Miyazaki, H. Araki, M. Yamaoka, N. Kanzaki, M. Kusaka, and M. Miyamoto Novel Mutations of Androgen Receptor: A Possible Mechanism of Bicalutamide Withdrawal Syndrome Cancer Res., January 1, 2003; 63(1): 149 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Comuzzi, L. Lambrinidis, H. Rogatsch, S. Godoy-Tundidor, N. Knezevic, I. Krhen, Z. Marekovic, G. Bartsch, H. Klocker, A. Hobisch, et al. The Transcriptional Co-Activator cAMP Response Element-Binding Protein-Binding Protein Is Expressed in Prostate Cancer and Enhances Androgen- and Anti-Androgen-Induced Androgen Receptor Function Am. J. Pathol., January 1, 2003; 162(1): 233 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. James, I. U. Agoulnik, J. M. Harris, G. Buchanan, W. D. Tilley, M. Marcelli, D. J. Lamb, and N. L. Weigel A Novel Androgen Receptor Mutant, A748T, Exhibits Hormone Concentration-Dependent Defects in Nuclear Accumulation and Activity Despite Normal Hormone-Binding Affinity Mol. Endocrinol., December 1, 2002; 16(12): 2692 - 2705. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Tepper, D. L. Boucher, P. E. Ryan, A.-H. Ma, L. Xia, L.-F. Lee, T. G. Pretlow, and H.-J. Kung Characterization of a Novel Androgen Receptor Mutation in a Relapsed CWR22 Prostate Cancer Xenograft and Cell Line Cancer Res., November 15, 2002; 62(22): 6606 - 6614. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Gelmann Molecular Biology of the Androgen Receptor J. Clin. Oncol., July 1, 2002; 20(13): 3001 - 3015. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dai, R. Shen, M. Sumitomo, R. Stahl, D. Navarro, M. C. Gershengorn, and D. M. Nanus Synergistic Activation of the Androgen Receptor by Bombesin and Low-Dose Androgen Clin. Cancer Res., July 1, 2002; 8(7): 2399 - 2405. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-Q. Huang, J. Li, and J. Wong AR Possesses an Intrinsic Hormone-Independent Transcriptional Activity Mol. Endocrinol., May 1, 2002; 16(5): 924 - 937. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Krishnan, X.-Y. Zhao, S. Swami, L. Brive, D. M. Peehl, K. R. Ely, and D. Feldman A Glucocorticoid-Responsive Mutant Androgen Receptor Exhibits Unique Ligand Specificity: Therapeutic Implications for Androgen-Independent Prostate Cancer Endocrinology, May 1, 2002; 143(5): 1889 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Heinlein and C. Chang Androgen Receptor (AR) Coregulators: An Overview Endocr. Rev., April 1, 2002; 23(2): 175 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Chang and D. P. McDonnell Evaluation of Ligand-Dependent Changes in AR Structure Using Peptide Probes Mol. Endocrinol., April 1, 2002; 16(4): 647 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Shi, A.-H. Ma, L. Xia, H.-J. Kung, and R. W. de Vere White Functional Analysis of 44 Mutant Androgen Receptors from Human Prostate Cancer Cancer Res., March 1, 2002; 62(5): 1496 - 1502. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Chang, P. J. Walther, and D. P. McDonnell Glucocorticoids Manifest Androgenic Activity in a Cell Line Derived from a Metastatic Prostate Cancer Cancer Res., December 1, 2001; 61(24): 8712 - 8717. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Nwosu, J. Carpten, J. M. Trent, and R. Sheridan Heterogeneity of genetic alterations in prostate cancer: evidence of the complex nature of the disease Hum. Mol. Genet., October 1, 2001; 10(20): 2313 - 2318. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Taplin and S.-M. Ho The Endocrinology of Prostate Cancer J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3467 - 3477. [Full Text] [PDF] |
||||
![]() |
G. Buchanan, N. M. Greenberg, H. I. Scher, J. M. Harris, V. R. Marshall, and W. D. Tilley Collocation of Androgen Receptor Gene Mutations in Prostate Cancer Clin. Cancer Res., May 1, 2001; 7(5): 1273 - 1281. [Abstract] [Full Text] |
||||
![]() |
S. F. Shariat, S. Desai, W. Song, T. Khan, J. Zhao, C. Nguyen, B. A. Foster, N. Greenberg, D. M. Spencer, and K. M. Slawin Adenovirus-mediated Transfer of Inducible Caspases: A Novel "Death Switch" Gene Therapeutic Approach to Prostate Cancer Cancer Res., March 1, 2001; 61(6): 2562 - 2571. [Abstract] [Full Text] |
||||
![]() |
B. Lin, J. T. White, C. Ferguson, S. Wang, R. Vessella, R. Bumgarner, L. D. True, L. Hood, and P. S. Nelson Prostate Short-Chain Dehydrogenase Reductase 1 (PSDR1): A New Member of the Short-Chain Steroid Dehydrogenase/Reductase Family Highly Expressed in Normal and Neoplastic Prostate Epithelium Cancer Res., February 1, 2001; 61(4): 1611 - 1618. [Abstract] [Full Text] |
||||
![]() |
F. Yeung, X. Li, J. Ellett, J. Trapman, C. Kao, and L. W. K. Chung Regions of Prostate-specific Antigen (PSA) Promoter Confer Androgen-independent Expression of PSA in Prostate Cancer Cells J. Biol. Chem., December 22, 2000; 275(52): 40846 - 40855. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Chipuk, S. C. Cornelius, N. J. Pultz, J. S. Jorgensen, M. J. Bonham, S.-J. Kim, and D. Danielpour The Androgen Receptor Represses Transforming Growth Factor-beta Signaling through Interaction with Smad3 J. Biol. Chem., January 4, 2002; 277(2): 1240 - 1248. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |