| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Corixa Corporation, Seattle, Washington 98104 [J. X., J. A. S., X. Z., S. J. S., R. L. H., M. M., T. S. V., S. G. R.]; ImmGenics Pharmaceuticals Inc., Vancouver, British Columbia, V67 123 Canada [K. B. L.]; Department of Infectious Disease, Federal University of Bahia, Salvador, Bahia, Brazil [R. B.]; and Department of Pathobiology, University of Washington, Seattle, Washington 98195 [S. G. R.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Numerous approaches have been used to dissect the genetic composition of prostate and prostate cancer. Methods used to identify overexpressed genes include EST sequencing (14 , 15) , serial analysis of gene expression (16 , 17) , and differential display PCR (18) . However, none of these techniques provides a complete, systematic, and reliable comparison of gene expression between tissue types. Expression cloning using cancer patient serum (19) or T-cell lines or clones (20) from patients has identified a panel of genes that may be immunologically relevant, although none have yet been validated, and the process is not very efficient. We have analyzed the genetic composition of prostate and prostate cancer by combining a cDNA library subtraction method (21) and a microarray high throughput screening procedure (22) . Here we report the discovery of three prostate tissue- and/or cancer-specific genes using these approaches.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
cDNA Library Subtraction.
cDNA library subtraction was performed using the protocol described by
Hara et al. (21)
, with modifications. Briefly,
cDNA libraries were first constructed with the Superscript Plasmid
System for cDNA Synthesis and Plasmid Cloning Kit (Life Technologies,
Inc.) using poly(A)+ RNA from prostate tumors,
normal prostate tissue, and normal pancreatic tissue. The control cDNA
library (70–150 µg; driver) was digested with EcoRI,
NotI, and SfuI, followed by filling in with the
DNA polymerase Klenow fragment. Driver DNA was labeled with Photoprobe
biotin (Vector Laboratories) and dissolved in 23 µl of
H2O. To prepare prostate (tracer) DNA, cDNA
libraries of normal or tumor prostate were digested with
BamHI and XhoI, phenol chloroform-extracted,
passed through Chroma spin-400 columns (Clontech),
ethanol-precipitated, and dissolved in 5 µl of
H2O. Tracer DNA was mixed with 15 µl of driver
DNA and 20 µl of 2x hybridization buffer [1.5
M NaCl, 10 mM EDTA, 50
mM HEPES (pH 7.5), and 0.2% SDS], overlaid with
mineral oil, heat-denatured, and incubated at 68°C for 20 h. The
reaction mixture was then incubated with streptavidin and extracted
with phenol/chloroform four times. This hybridization process was
repeated with an additional 8 µl of driver DNA at 68°C for 2 h. Subtracted cDNA was ligated into the chloramphenicol-resistant pBC
SK+ (Stratagene) and transformed into ElectroMax
Escherichia coli DH10B cells by electroporation to generate
a tracer-specific subtracted cDNA library.
Library PCR.
Library DNA (50 ng) was used as a template for PCR amplification of
human ß-actin at 18, 23, 28, and 33 cycles. PCR products were run on
a 1% agarose gel and stained with ethidium bromide. Primers used for
ß-actin were as follows: (a) 5' primer,
5'-ACCCCGTGCTGCTGACC; and (b) 3' primer,
5'-AGGAAGGAAGGCTGGAAGAGT.
Colony Hybridization and Northern Blot Analysis.
For colony hybridization, lifts were prepared with randomly picked
colonies from subtracted libraries using 132 mm Hybond-N filters
(Amersham Pharmacia Biotech). For Northern blot analysis, 10 µg of
total RNA were run out on formaldehyde denaturing gel, transferred to
Hybond-N membrane, cross-linked, stained with methylene blue, and
photographed. Radioactive 32P-labeled cDNA probes
were prepared using a Ready-To-Go DNA labeling kit (Amersham). Filters
were prehybridized in hybridization solution [1% BSA, 1
mM EDTA, 0.5 M NaHPO4 (pH
7.2), and 7% SDS] for 30 min at 65°C and replaced with fresh
hybridization solution containing radioactive cDNA probe and hybridized
overnight at 65°C. Washes were also carried out at 65°C with
wash solution 1x SCP (0.1 M NaCl, 30 mM
Na2HPO4, 1 mM EDTA, 1%
N-lauroylsarcosine).
Microarray.
mRNA expression of cDNA clones from subtracted libraries was determined
using a high throughput microarray approach (22)
.
Colonies that were negative from prescreening were randomly picked from
subtracted libraries and PCR-amplified for 30 cycles with
vector-specific primers according to a protocol suggested by Incyte.
PCR products were then arrayed onto glass slides using Incyte patented
chemistry. The arrayed cDNA clones were hybridized with a 1:1 mixture
of Cy3- or Cy5-labeled first-strand cDNAs generated from
poly(A)+ RNA from various tissues, including both
normal and tumor tissues, using the protocol provided by Incyte. The
fluorescence intensity was scanned, and data were analyzed using Incyte
GEMTOOLS software. Results were also analyzed by normalizing
fluorescence intensities between experiments using a subset of cDNA
clones. This enabled us to compare data between different experiments.
Quantitative Real-Time PCR (TaqMan).
Total RNA was treated with DNase I (Ambion) in the presence of RNasin
(Promega) to remove DNA contamination before cDNA synthesis. cDNA was
synthesized with oligodeoxythymidylic acid primer (Boehringer
Mannheim) and Superscript II reverse transcriptase (Life
Technologies, Inc.). Real-time PCR (TaqMan) analysis was performed on a
Perkin-Elmer/Applied Biosystems 7700 Prism. Matching primers and
fluorescence probes (see below) were designed for each of the genes
(P503S, P504S, and P510S) according to the
Primer Express program provided by Perkin-Elmer/Applied Biosystems.
Primer and probe concentrations were optimized with a pool of cDNAs
from prostate tumors. For P503S and P504S, both
forward and reverse primers were 900 nM. For
P510S, both forward and reverse primers were 300
nM. In all cases, the final probe concentration
was 160 nM. The PCR reaction was performed in 25
µl with dATP, dCTP, and dGTP at 0.2 mM
and dUTP at 0.4 mM; 0.625 unit of Amplitaq Gold;
0.25 unit of Amperase uracil-N-glycosylase
(Perkin-Elmer/Applied Biosystems); 5 mM
MgCl2; trace amounts of glycerol, gelatin, and
Tween 20 (Sigma); and 2 µl of cDNA template. ß-Actin primers and
probes were obtained from Perkin-Elmer/Applied Biosystems.
The following primers and probes were used: (a) P503S, TGCCCTCGTGACGTTCTTCT (forward primer), TCTTTCTTGATGGCAGGCACTAC (reverse primer), and CACCACAATGGCTGAGCACTTCCTGA (probe); (b) P504S, AAATGGTTATCATTAGGGCTTTTGA (forward primer), TTCC-TTTTTCACTAGAACCCATTCA (reverse primer), and TATCAAGC-AAACTGGAAGGCAGAATAACTACCATAATT (probe); and (c) P510S, TTGAACAGCTACTACGGTCAATGTATT (forward primer), GCAG-AGAGCAACCGATGTTTT (reverse primer), and TTGAGTGAAGCCTTAAAAAGCACACACCACA (probe).
To quantitate the amount of specific mRNA in the samples, a standard curve was generated for each run using the plasmid containing the gene of interest (dilutions ranging from 20 to 2 x 106 copies). In addition, a standard curve was generated for ß-actin ranging from 200 fg to 2 ng. This enabled standardization of the initial RNA content of a tissue relative to the amount of ß-actin.
Bioinformatic Analysis.
Protein localization was predicted by the PSORT algorithm using the
amino acid sequences of P503S, P504S, and
P510S.
Protein Expression, mAb Generation, and Immunohistochemistry
Staining.
Truncated P503S (amino acid 113–241) was cloned into
pET32b (Novagen) and expressed in E. coli as thioredoxin
fusion proteins with a histidine tag. P503S was purified by
nickel chromatography, digested with thrombin, and further purified by
reverse-phase chromatography. Full-length P504S was cloned
into pTrcHisC (Invitrogen) and expressed in E. coli with a
histidine tag. The protein was purified by nickel chromatography,
followed by ion exchange chromatography. Rabbit mAbs were generated
from rabbits immunized with P503S and P504S
protein by ImmGenics using the previously published protocol
(23)
. Immunohistochemistry was performed on
formalin-fixed, paraffin-embedded tissues by QualTek Molecular
Laboratories using rabbit mAbs raised against P503S and
P504S protein.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Subtraction one was done by subtracting prostate tumor (Gleason
score = 7; 25 ng/ml PSA) with normal pancreas.
Subtraction two was done by subtracting prostate tumor with normal
prostate. Subtraction three was done by subtracting normal prostate
with normal pancreas. Subtractions four and five were designed to
enrich less abundant genes by spiking several abundant sequences
identified from previous subtractions (e.g., PSA) into the
driver. Subtraction four was also performed with a pool of three
prostate tumors (tumor 1, Gleason score = 7, 100 ng/ml
PSA; tumor 2, Gleason score = 8, 35 ng/ml PSA; tumor 3,
Gleason score = 7, 59 ng/ml PSA) that differed from
those used for previous subtractions. Normal pancreas was used in
several subtractions as the driver control because both prostate and
pancreas are secretory organs with glandular structures. Use of
pancreas as a driver control should be effective in eliminating
genes shared by both tissues.
|
shows subtraction one, where several discrete bands are
seen. Sequence analysis of this library showed abundant clones to be
PSA, HGK-1, CCOII, and TCR germ-line 
chain that comigrate with the
enriched bands. Less abundant tissue- and/or cancer-specific genes were
enriched in the subtraction five library (Fig. 1B)
, where
the three most abundant species were depleted by spiking them into the
driver. Several discrete bands are seen in the subtraction five library
(Fig. 1B
, Lane 4). Abundant clones that comigrate
with the enriched bands are tumor expression enhanced gene
(TEEG), autonomously replicating sequence (ARS),
a novel gene described in another
study,4
and the two genes P503S and P504S.
Lanes 2 and 3 in Fig. 1B
are
nonsubtracted prostate tumor and normal pancreas library in which a
smear was seen.
|
. In nonsubtracted libraries, ß-actin-specific PCR product is visible
by eighteenth cycle of amplification and becomes saturated at 28–33
cycles. Subtracted libraries require a higher number of amplification
cycles for ß-actin to be detected, indicating that ß-actin is
preferentially depleted in subtracted cDNA libraries. Depletion of
ß-actin is more significant in the subtraction one, two, and three
libraries, suggesting that these three subtractions are more complete.
|
chain, and sequence 3 from patent number 5565323) to
eliminate redundant cDNA clones. A total of 500 prescreen negative
clones, including P503S and P504S, were selected,
and their mRNA expression levels were determined by microarray
analysis. Clones showing overexpression in normal and/or tumor prostate
tissues were sequenced to determine their identity.
Fig. 3
shows mRNA expression levels determined by microarray for
P503S, P504S, and another gene, P510S,
which was identified through microarray screening. P503S is
overexpressed in prostate tumors, BPH, and normal prostate. It is also
expressed in normal colon and is slightly elevated in normal kidney and
bladder. Other normal tissues tested had low or undetectable levels of
P503S expression. P504S is overexpressed in about
30% of prostate tumors and is low to undetectable in normal tissues
tested, including normal prostate, suggesting that P504S is
a prostate cancer-specific gene. P510S is primarily
overexpressed in a subset of prostate tumors and BPH, whereas the
expression levels in nonprostate normal tissues are low to
undetectable. Although microarray is a rapid and effective way to
screen hundreds to thousands of clones in parallel, expression values
may be compressed due to the limitation of detection sensitivity for
rare message and the saturation of signal for highly abundant genes.
Therefore, other independent methods are necessary to give a more
accurate assessment of mRNA expression levels.
|
. It was undetectable in other normal tissues tested including liver,
pancreas, skeletal muscle, brain, stomach, testis, small intestine, and
bone marrow. P504S was overexpressed in 50% (two of four)
of prostate tumors and was low or undetectable in other tissues tested,
including normal prostate. P510S was expressed in 50% of
normal and tumor prostate tissues but was absent from other tissues
tested. Therefore, Northern blot analysis confirmed the expression
patterns observed with the microarray approach, supporting the use of
microarray as a valid high throughput screening approach.
|
. Using real-time PCR (TaqMan), P503S is highly expressed in
prostate tumors and normal prostate, as well as in a subset of other
tumors (breast tumors, ovarian tumors, and colon tumors but not lung
tumors). It was also expressed by normal kidney and stomach but
detected at a very low level in other normal tissues. P504S
is overexpressed in about 60% (four of seven) of prostate tumors. With
the exception of normal liver that shows a low level of message, other
normal tissues including normal prostate show little expression of
P504S. P510S was overexpressed in three of eight prostate
tumors tested. It was expressed at lower levels in two other prostate
tumors and two of seven normal prostate tissues. Other normal tissues
did not have detectable P510S message. Thus, quantitative
PCR confirmed the results obtained by microarray and Northern blot.
|
, whereas P504S mAb stained prostate tumors but not BPH.
Immunohistochemistry also indicated that P503S staining was
cell surface and cytoplasmic, whereas P504S showed strong
granular cytoplasmic staining.
|
-methylcacyl-CoA racemase (GenBank accession number 4204097).
Although P504S is predicted to be a type Ib plasma membrane
protein with one transmembrane span and no signal sequence, the rat
homologue has been shown to be expressed in the cytosol and
mitochondria (25)
. P510S has been identified as
human ABC transporter MOAT-B (GenBank accession number 3335173). It is
predicted to be a plasma membrane protein with nine potential
transmembrane spans with no NH2-terminal signal
sequence. |
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Vasmatzis et al. (15)
have reported the
discovery of three genes specifically expressed in human prostate by
using an electronic subtraction approach with EST databases. Three of
the five most abundant genes discovered by electronic subtraction, PSA,
HGK-1, and the TCR chain C region gene, are also abundantly present
in our subtracted libraries. This indicates that the two approaches
could generate similar but not identical results. It is postulated that
the reasons for not identifying prostate-secreted seminal plasma
protein and prostatic acid phosphatase gene in our experiment
are as follows: (a) tumor samples used in our studies did
not contain these two genes at high levels; and (b) normal
pancreas may also express these genes or their homologues at some
level; therefore, they were eliminated by subtraction process.
Electronic subtraction is a rapid and powerful approach to identify
potential differentially expressed genes; however, as the authors
pointed out, it has some disadvantages. The biggest limitation is that
it depends on the availability of EST sequences. The incompleteness of
the EST database and the random nature of EST clones may cause the
specificity determined by electronic subtraction to be false positive
or false negative. Information regarding specificity is especially
unreliable when gene expression is low. Furthermore, the algorithm the
authors used can generate false EST clusters because one cluster can
contain several different genes, and one gene can have several
clusters. This may also cause specificity information to be inaccurate.
Therefore, information obtained by electronic subtraction needs to be
confirmed by experimental approaches.
The cDNA library subtraction approach described here systematically compares cDNAs from two different tissue types and preferentially depletes sequences common in both tissue types, thereby enriching sequences specific for one tissue type. This procedure eliminates the problems associated with electronic subtraction such as incompleteness of the EST database and false clustering. We have also performed additional subtractions that incorporated the following modifications to the procedure: (a) pooling and using more tumor samples to identify cancer-associated genes present only in a small subpopulation of cancer patients; (b) adjusting the driver:tracer ratio to identify less abundant genes and reduce the redundancy of subtracted libraries; and (c) using a pool of normal tissues as drivers, especially the ones that share similar cellular components with prostate tumor to eliminate nonspecific clones more efficiently; subtractions performed in this manner generated results similar to those reported herein. Alternative subtraction approaches, such as PCR-based subtraction (Clontech), have also been used to identify less abundant genes.
Tissue and cancer specificity is one of the key requirements for a marker to be used for diagnosis and therapy. We have shown that genes identified by subtraction and microarray approaches can prime human immunological responses, including both humoral and cell-mediated responses.5 Therefore, these genes can be used as potential vaccine candidates for cancer immunotherapy. Our approaches provide alternative methods for cancer antigen identification. This is extremely important for cancers other than melanoma, where cancer immunogenicity is weak, and it is difficult to use immunological approaches for cancer antigen identification.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by National Cancer Institute
Grant CA80518. 
2 To whom requests for reprints should be
addressed, at Corixa Corporation, 1124 Columbia Street, Suite 200,
Seattle, WA 98104. Phone: (206) 754-5798; Fax: (206) 754-5917.
3 The abbreviations used are: PSA,
prostate-specific antigen; BPH, benign prostate hyperplasia; EST,
expressed sequence tag; HGK-1, human glandular kallikrein 1; mAb,
monoclonal antibody; poly(A)+ RNA, polyadenylated RNA; TCR,
T-cell receptor; CCOII, cytochrome c oxidase subunit
II.
4 J. Xu, J. A. Stolk, M. Kalos, E. Zasloff, A.
Zhang, R. L. Houghton, and S. G. Reed. Identification and
characterization of prostein, a novel prostate-specific antigen,
manuscript in preparation.
5 E. Zasloff, R. Friedman, A. G. Spies, K.
Grabstein, and M. Kalos. Generation of prostein-specific CD8 and CD4
cell responses by in vitro priming with dendritic cells
infected with viruses that express prostein, manuscript in
preparation.
Received 9/ 1/99. Accepted 1/19/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
in a mast cell-derived interleukin-4-dependent cell line. Blood, 84: 189-199, 1994.This article has been cited by other articles:
|
|
 |
|
  K. TAKAHARA, H. AZUMA, T. SAKAMOTO, S. KIYAMA, T. INAMOTO, N. IBUKI, T. NISHIDA, H. NOMI, T. UBAI, N. SEGAWA, et al. Conversion of Prostate Cancer from Hormone Independency to Dependency Due to AMACR Inhibition: Involvement of Increased AR Expression and Decreased IGF1 Expression Anticancer Res, July 1, 2009; 29(7): 2497 - 2505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. P. Mello, E. F. Abrantes, C. H. Torres, A. Machado-Lima, R. d. S. Fonseca, D. M. Carraro, R. R. Brentani, L. F. L. Reis, and H. Brentani No-match ORESTES explored as tumor markers Nucleic Acids Res., May 1, 2009; 37(8): 2607 - 2617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Cho-Vega, S. Tsavachidis, K.-A. Do, J. Nakagawa, L. J. Medeiros, and T. J. McDonnell Dicarbonyl/L-Xylulose Reductase: A Potential Biomarker Identified by Laser-Capture Microdissection-Micro Serial Analysis of Gene Expression of Human Prostate Adenocarcinoma Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2615 - 2622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Li Chen, Zhiwei Wang, Xi Zhan, D.-C. Li, Y.-Y. Zhu, and Jianwei Zhu Association of NET-1 Gene Expression With Human Hepatocellular Carcinoma International Journal of Surgical Pathology, October 1, 2007; 15(4): 346 - 353. [Abstract] [PDF]
|
|
|
|
 |
|
 J. R. Pollack A Perspective on DNA Microarrays in Pathology Research and Practice Am. J. Pathol., August 1, 2007; 171(2): 375 - 385. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Stewart, N. Fleshner, H. Cole, and J. Sweet Comparison of annexin II, p63 and {alpha}-methylacyl-CoA racemase immunoreactivity in prostatic tissue: a tissue microarray study J. Clin. Pathol., July 1, 2007; 60(7): 773 - 780. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Xu, S. Cheepala, E. McCauley, K. Coombes, L. Xiao, S. M. Fischer, and J. L. Clifford Chemoprevention of Skin Carcinogenesis by Phenylretinamides: Retinoid Receptor-Independent Tumor Suppression Clin. Cancer Res., February 1, 2006; 12(3): 969 - 979. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. R. Nambiar, S. R. Boutin, R. Raja, and D. W. Rosenberg Global Gene Expression Profiling: A Complement to Conventional Histopathologic Analysis of Neoplasia Vet. Pathol., November 1, 2005; 42(6): 735 - 752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Konishi, M. Nakamura, E. Ishida, K. Shimada, E. Mitsui, R. Yoshikawa, H. Yamamoto, and K. Tsujikawa High Expression of a New Marker PCA-1 in Human Prostate Carcinoma Clin. Cancer Res., July 15, 2005; 11(14): 5090 - 5097. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Rubin, T. A. Bismar, O. Andren, L. Mucci, R. Kim, R. Shen, D. Ghosh, J. T. Wei, A. M. Chinnaiyan, H.-O. Adami, et al. Decreased {alpha}-Methylacyl CoA Racemase Expression in Localized Prostate Cancer is Associated with an Increased Rate of Biochemical Recurrence and Cancer-Specific Death Cancer Epidemiol. Biomarkers Prev., June 1, 2005; 14(6): 1424 - 1432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Kortesidis, A. Zannettino, S. Isenmann, S. Shi, T. Lapidot, and S. Gronthos Stromal-derived factor-1 promotes the growth, survival, and development of human bone marrow stromal stem cells Blood, May 15, 2005; 105(10): 3793 - 3801. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. N. Schuetz, Q. Yin-Goen, M. B. Amin, C. S. Moreno, C. Cohen, C. D. Hornsby, W. L. Yang, J. A. Petros, M. M. Issa, J. G. Pattaras, et al. Molecular Classification of Renal Tumors by Gene Expression Profiling J. Mol. Diagn., May 1, 2005; 7(2): 206 - 218. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Liu, P. S. Rudland, D. R. Sibson, A. Platt-Higgins, and R. Barraclough Human Homologue of Cement Gland Protein, a Novel Metastasis Inducer Associated with Breast Carcinomas Cancer Res., May 1, 2005; 65(9): 3796 - 3805. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Foley, D. Hollywood, and M. Lawler Molecular pathology of prostate cancer: the key to identifying new biomarkers of disease Endocr. Relat. Cancer, September 1, 2004; 11(3): 477 - 488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sreekumar, B. Laxman, D. R. Rhodes, S. Bhagavathula, J. Harwood, D. Giacherio, D. Ghosh, M. G. Sanda, M. A. Rubin, and A. M. Chinnaiyan Humoral Immune Response to {alpha}-Methylacyl-CoA Racemase and Prostate Cancer J Natl Cancer Inst, June 2, 2004; 96(11): 834 - 843. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Rubin, M. P. Zerkowski, R. L. Camp, R. Kuefer, M. D. Hofer, A. M. Chinnaiyan, and D. L. Rimm Quantitative Determination of Expression of the Prostate Cancer Protein {alpha}-Methylacyl-CoA Racemase Using Automated Quantitative Analysis (AQUA): A Novel Paradigm for Automated and Continuous Biomarker Measurements Am. J. Pathol., March 1, 2004; 164(3): 831 - 840. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Amatschek, U. Koenig, H. Auer, P. Steinlein, M. Pacher, A. Gruenfelder, G. Dekan, S. Vogl, E. Kubista, K.-H. Heider, et al. Tissue-Wide Expression Profiling Using cDNA Subtraction and Microarrays to Identify Tumor-Specific Genes Cancer Res., February 1, 2004; 64(3): 844 - 856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A J Evans {alpha}-Methylacyl CoA racemase (P504S): overview and potential uses in diagnostic pathology as applied to prostate needle biopsies J. Clin. Pathol., December 1, 2003; 56(12): 892 - 897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zha, S. Ferdinandusse, S. Denis, R. J. Wanders, C. M. Ewing, J. Luo, A. M. De Marzo, and W. B. Isaacs {alpha}-Methylacyl-CoA Racemase as an Androgen-Independent Growth Modifier in Prostate Cancer Cancer Res., November 1, 2003; 63(21): 7365 - 7376. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Mobley, I. Leav, P. Zielie, C. Wotkowitz, J. Evans, Y.-W. Lam, B. S. L'Esperance, Z. Jiang, and S.-M. Ho Branched Fatty Acids in Dairy and Beef Products Markedly Enhance {alpha}-Methylacyl-CoA Racemase Expression in Prostate Cancer Cells in Vitro Cancer Epidemiol. Biomarkers Prev., August 1, 2003; 12(8): 775 - 783. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.A. Schulz, M. Burchardt, and M.V. Cronauer Molecular biology of prostate cancer Mol. Hum. Reprod., August 1, 2003; 9(8): 437 - 448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. L. Shen-Ong, Y. Feng, and D. A. Troyer Expression Profiling Identifies a Novel {alpha}-Methylacyl-CoA Racemase Exon with Fumarate Hydratase Homology Cancer Res., June 15, 2003; 63(12): 3296 - 3301. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, X. Li, and F. H. Sarkar Gene Expression Profiles of I3C- and DIM-Treated PC3 Human Prostate Cancer Cells Determined by cDNA Microarray Analysis J. Nutr., April 1, 2003; 133(4): 1011 - 1019. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Santamaria, P. L. Fernandez, X. Farre, P. Benedit, J. Reventos, J. Morote, R. Paciucci, and T. M. Thomson PTOV-1, a Novel Protein Overexpressed in Prostate Cancer, Shuttles between the Cytoplasm and the Nucleus and Promotes Entry into the S Phase of the Cell Division Cycle Am. J. Pathol., March 1, 2003; 162(3): 897 - 905. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li and F. H. Sarkar Gene Expression Profiles of Genistein-Treated PC3 Prostate Cancer Cells J. Nutr., December 1, 2002; 132(12): 3623 - 3631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Zheng, B.-l. Chang, D. A. Faith, J. R. Johnson, S. D. Isaacs, G. A. Hawkins, A. Turner, K. E. Wiley, E. R. Bleecker, P. C. Walsh, et al. Sequence Variants of {alpha}-Methylacyl-CoA Racemase Are Associated with Prostate Cancer Risk Cancer Res., November 15, 2002; 62(22): 6485 - 6488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Dennis, J. K. Vass, E. C. Wit, W. N. Keith, and K. A. Oien Identification from Public Data of Molecular Markers of Adenocarcinoma Characteristic of the Site of Origin Cancer Res., November 1, 2002; 62(21): 5999 - 6005. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Karan, D. L. Kelly, A. Rizzino, M.-F. Lin, and S. K. Batra Expression profile of differentially-regulated genes during progression of androgen-independent growth in human prostate cancer cells Carcinogenesis, June 1, 2002; 23(6): 967 - 976. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. W. Asmann, F. Kosari, K. Wang, J. C. Cheville, and G. Vasmatzis Identification of Differentially Expressed Genes in Normal and Malignant Prostate by Electronic Profiling of Expressed Sequence Tags Cancer Res., June 1, 2002; 62(11): 3308 - 3314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Xu, F. M. Selaru, J. Yin, T. T. Zou, V. Shustova, Y. Mori, F. Sato, T. C. Liu, A. Olaru, S. Wang, et al. Artificial Neural Networks and Gene Filtering Distinguish Between Global Gene Expression Profiles of Barrett's Esophagus and Esophageal Cancer Cancer Res., June 1, 2002; 62(12): 3493 - 3497. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Luo, S. Zha, W. R. Gage, T. A. Dunn, J. L. Hicks, C. J. Bennett, C. M. Ewing, E. A. Platz, S. Ferdinandusse, R. J. Wanders, et al. {alpha}-Methylacyl-CoA Racemase: A New Molecular Marker for Prostate Cancer Cancer Res., April 1, 2002; 62(8): 2220 - 2226. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Rosenow, R. M. Saxena, M. Durst, and T. R. Gingeras Prokaryotic RNA preparation methods useful for high density array analysis: comparison of two approaches Nucleic Acids Res., November 15, 2001; 29(22): e112 - e112. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. C. King and A. A. Sinha Gene Expression Profile Analysis by DNA Microarrays: Promise and Pitfalls JAMA, November 14, 2001; 286(18): 2280 - 2288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Masui, R. Hosotani, S. Tsuji, Y. Miyamoto, S. Yasuda, J. Ida, S. Nakajima, M. Kawaguchi, H. Kobayashi, M. Koizumi, et al. Expression of METH-1 and METH-2 in Pancreatic Cancer Clin. Cancer Res., November 1, 2001; 7(11): 3437 - 3443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Y. Xiao, H. L. Wang, J. Hart, D. Fleming, and M. R. Beard cDNA Arrays and Immunohistochemistry Identification of CD10/CALLA Expression in Hepatocellular Carcinoma Am. J. Pathol., October 1, 2001; 159(4): 1415 - 1421. [Abstract] [Full Text]
|
|
|
|
|
|
A. V. Lichtenstein, O.'g. I. Serdjuk, T. I. Sukhova, H. S. Melkonyan, and S. R. Umansky Selective 'stencil'-aided pre-PCR cleavage of wild-type sequences as a novel approach to detection of mutant K-RAS Nucleic Acids Res., September 1, 2001; 29(17): e90 - e90. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Yang, G. E. Holt, M. P. Velders, E. D. Kwon, and W. M. Kast Murine Six-Transmembrane Epithelial Antigen of the Prostate, Prostate Stem Cell Antigen, and Prostate-specific Membrane Antigen: Prostate-specific Cell-Surface Antigens Highly Expressed in Prostate Cancer of Transgenic Adenocarcinoma Mouse Prostate Mice Cancer Res., August 1, 2001; 61(15): 5857 - 5860. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Luo, D. J. Duggan, Y. Chen, J. Sauvageot, C. M. Ewing, M. L. Bittner, J. M. Trent, and W. B. Isaacs Human Prostate Cancer and Benign Prostatic Hyperplasia: Molecular Dissection by Gene Expression Profiling Cancer Res., June 1, 2001; 61(12): 4683 - 4688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Xu, M. Kalos, J. A. Stolk, E. J. Zasloff, X. Zhang, R. L. Houghton, A. M. Filho, M. Nolasco, R. Badaró, and S. G. Reed Identification and Characterization of Prostein, a Novel Prostate-specific Protein Cancer Res., February 1, 2001; 61(4): 1563 - 1568. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. D. Wolfgang, M. Essand, J. J. Vincent, B. Lee, and I. Pastan TARP: A nuclear protein expressed in prostate and breast cancer cells derived from an alternate reading frame of the T cell receptor gamma chain locus PNAS, August 15, 2000; 97(17): 9437 - 9442. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
