Cancer Research Meeting Calendar  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paige, A. J. W.
Right arrow Articles by Watson, J. E. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paige, A. J. W.
Right arrow Articles by Watson, J. E. V.
[Cancer Research 60, 1690-1697, March 15, 2000]
© 2000 American Association for Cancer Research


Molecular Biology and Genetics

A 700-kb Physical Map of a Region of 16q23.2 Homozygously Deleted in Multiple Cancers and Spanning the Common Fragile Site FRA16D1

Adam J. W. Paige, Karen J. Taylor, Aengus Stewart, John G. Sgouros, Hani Gabra, Grant C. Sellar, John F. Smyth, David J. Porteous and J. E. Vivienne Watson2

Imperial Cancer Research Fund [A. J. W. P. , K. J. T., H. G., G. C. S., J. F. S., J. E. V. W.] and MRC Human Genetics Unit [D. J. P.], Western General Hospital, Edinburgh EH4 2XU, United Kingdom, and Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom [A. S., J. G. S.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have identified a >600-kb region at 16q23.2 that is homozygously deleted from malignant ovarian ascites using representational difference analysis. Overlapping homozygous deletions were also observed in the colon carcinoma cell line HCT116 and a xenograft established from the small cell lung cancer cell line WX330. This region coincides with that described previously by others as showing loss of heterozygosity in prostate and breast cancers (C. Li et al., Genes Chromosomes Cancer, 24: 175–182, 1999; A. Latil et al., Cancer Res., 57: 1058–1062, 1997; K. Driouch et al., Genes Chromosomes Cancer, 19: 185–191, 1997; A. Iida et al., Br. J. Cancer, 75: 264–267, 1997). In addition, the minimally deleted region spans the common fragile site FRA16D. We have constructed a 700-kb physical map encompassing the deleted region. By fluorescence in situ hybridization of aphidicolin-induced metaphase chromosomes, we have preliminary data to suggest that P1-derived bacterial artificial chromosome clones from the contig lie on both sides of FRA16D. This is confirmed by extensive fluorescence in situ hybridization analysis of the region reported in the accompanying article (M. Mangelsdorf et al., Cancer Res., 60:1683–1689, 2000) and is consistent with an involvement of this common fragile site in the loss of 16q23.2 material in various cancer types. The minimally deleted region of approximately 210 kb has been characterized using our own markers and public domain markers. Eleven distinct expressed sequences mapped to the region, providing a basis for identifying the predicted tumor suppressor gene in this region.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Relatively few of the many tumor suppressor or growth suppressor genes identified to date have been shown to be involved in ovarian cancer. As a strategy directed toward the identification of novel tumor suppressor genes involved in the initialization or progression of ovarian cancer, we have performed RDA3 on DNA from the malignant and fibroblast cells of an ascites specimen obtained from a patient with ovarian cancer. First described by Lisitsyn et al. (1) , RDA allows the isolation of DNA that has been gained or lost from the tumor specimen, relative to the normal DNA from the same individual. Homozygous genomic DNA deletions in tumor cells are typically associated with the inactivation or loss of a gene involved in the control of cell growth or differentiation. Homozygous deletions are relatively rare, but where they have been identified, they have played an important role in the isolation of tumor suppressor genes including RB1, WT1, BRCA2, p16, and FHIT (2, 3, 4, 5, 6) .

RDA on DNA from malignant ovarian ascites led us to the identification of a homozygous deletion at 9p21 that encompassed the previously characterized tumor suppressor gene cluster p16, p15, and p19 (5 , 7 , 8) described in Ref. 9 . Here we describe the characterization of another homozygous deletion in DNA from the same patient, which we show maps to 16q23.2. This region shows allele imbalance and DNA loss in many tumor types including prostate cancer (10 , 11) , breast cancer (12, 13, 14, 15) , hepatocellular carcinoma (16) , and ovarian cancer (17) . Furthermore, the common aphidicolin-inducible fragile site FRA16D also maps to 16q23.2 (18) . There have been numerous reports of common fragile sites associated with chromosomal rearrangements in cancer, including translocations (11q) and deletions (3p; reviewed in Ref. 19 ). The most extensively characterized of these is FRA3B at 3p14.2. RDA identified a probe that was homozygously deleted in cancer cell lines (20) . This probe was subsequently mapped to a YAC and BAC contig in 3p14.2 and found to be within FHIT/FRA3B (6) .

It is thought that common fragile sites may be prone to breaks and deletions in dividing cells, thus providing a possible mechanism for the inactivation of any neighboring genes. If one of those neighboring genes acts as a tumor suppressor, then cells in which such a deletion occurs will have a selective growth advantage.

We demonstrate here the identification of a small region of homozygous deletion common to an ovarian tumor, a colon carcinoma cell line, and a small cell lung cancer cell line. We have constructed a complete physical and partial transcript map across the minimal deleted region and identified 11 distinct expressed sequences. These represent possible candidates as novel tumor suppressor genes involved in cancer development in several different tumor types.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PEO4 malignant and fibroblast cells were derived by differential trypsinization of cells in an ascites specimen obtained from a patient with ovarian cancer (9) . The PEO4 cell line was established from the same primary malignant ascitic cells (21) . WX330 is a xenograft of a cell line that had been established from a small cell lung carcinoma (22) . HCT116 is a colonic adenocarcinoma cell line described in Ref. 23 and was a gift from Susan Farrington (MRC HGU, Edinburgh, United Kingdom). FATO is a lymphoblastoid cell line from EBV-transformed normal male lymphocytes (a gift from Veronica van Heyningen, MRC HGU, Edinburgh, United Kingdom). Other tumor cell lines were obtained from a tumor bank (ICRF Clare Hall; American Type Culture Collection, Manassas, VA), and details are available on request. E-cadherin probes were provided by M. Bussemakers (University Hospital Nijmegen, Nijmegen, the Netherlands). All oligonucleotide primers for PCR were synthesized by Iain Goldsmith (ICRF Clare Hall).

Identification of a Homozygous Deletion.
RDA was carried out as described previously (9) . Products were cloned into pBSlox (24) and sequenced as described previously (9) . Primers were designed to the sequences using the programs PRIMER (Whitehead Institute for Biomedical Research) and OLIGO 4.0 (Wojciech Rychlik) and are shown in Table 1Citation . The chromosomal location of the RDA products was determined by screening a monochromosome hybrid mapping panel (HGMP-RC, Cambridge, United Kingdom) and a cytogenetic breakpoint mapping panel by PCR (David Callen, Adelaide Women’s and Children’s Hospital, Adelaide, Australia; Ref. 25 ). PCR was carried out using standard "touchdown" conditions [50 ng of template, 150 pg of each primer, 200 µM deoxynucleotide triphosphates, 1 unit of Taq polymerase (ICRF Pic Taq), 1.5 mM MgCl2, and 50 mM KCl], unless otherwise stated. Reaction conditions 94°C for 3 min; (94°C 30 s; 65°C 30 s; 72°C 30 s) x 2; decrease annealing temperature by 2°C every two cycles down to 55°C; (94°C 30 s; 55°C 30 s; 72°C 30 s) x 20; 72°C 2 min. Reactions were carried out on a Hybaid Omnigene or MJ Tetrad thermocycler.


View this table:
[in this window]
[in a new window]

 
Table 1 STS and EST markers mapped on the YAC and PAC contigs

All previously described markers and genes are shown with their GenBank accession number and their source. Primer sequences are given for novel STS and EST markers as are the method of their derivation and any homology to sequences in GenBank. Two markers were mapped as probes by hybridization, and the sequence is not available for these two markers.

 
Creation of PAC Contig.
RDA products were used as probes to screen human PAC libraries. RPCI-1 (P. Ioannou, Roswell Park Cancer Institute, Buffalo, NY) was obtained from the HGMP-RC and the Sanger Centre (Hinxton Hall, Cambridge, United Kingdom), and RPCI-6 (B. Zhao, Roswell Park Cancer Institute) was obtained from the German Human Genome Project Resource Center (Berlin, Germany). Probes were generated by PCR on DNA from the lymphoblastoid cell line FATO, followed by gel purification (Prep-a-Gene; Bio-Rad). Probe DNA was radiolabeled according to standard methods. DNA was obtained from PAC clones either by using a Qiagen midi DNA purification kit (Qiagen UK Ltd.) or by standard alkaline lysis (HGMP-RC). Clones were restriction enzyme-digested with NotI, EagI, BssHII, or SalI (Roche) following the manufacturer’s specifications. The fragments were separated by pulsed field gel electrophoresis using a Bio-Rad DRII apparatus, typically on a 1% agarose gel, with 5–20s pulse times at 6 V/cm for 20 h. DNA was immobilized onto MSI nylon membrane (Micron Separations Inc., Westborough, MA) by standard Southern transfer and cross-linked at 120 J in a Stratalinker (Stratagene). Membranes were hybridized with radiolabeled probes under standard conditions, and signal was detected by exposure to Kodak X-OMAT film overnight.

Generation of Markers.
YAC clones from the CEPH MegaYAC library (26) were identified from the Whitehead STS map and obtained from David Callen, HGMP-RC, and the German Human Genome Project Resource Center. DNA was prepared from YAC clones using a Nucleon YAC miniprep kit, following the manufacturer’s instructions (ScotLab Bioscience, Luton, United Kingdom). End clones were obtained from PAC and YAC clones using degenerate oligo-primed PCR exactly as described previously (27) , using the primers AATTTATCACTACGGAATTC and CCGATCTCAAGATTACGGAATTC for YAC clones. Products were either directly sequenced after purification on 0.8% agarose gel and DNA extraction (Prep-a-Gene; Bio-Rad) or subcloned into pGemT-easy (Promega), followed by amplification and DNA preparation using a Qiagen miniprep kit, before sequencing. All sequencing reactions were carried out using an ABI PRISM dye terminator cycle sequencing kit (Perkin-Elmer).

PAC 81N24 was exon-trapped using vector pSPL3 (Ref. 28 ; Life Technologies, Inc.). The protocol was carried out according to the manufacturer’s instructions, with advice and materials from Donny Black (Cancer Research Campaign Beatson Laboratories, Glasgow, United Kingdom). Final PCR products were cloned into pGemT (Promega) and sequenced as described above.

Inter-Alu PCR was carried out using the method described previously (29) . PCR was carried out using the following conditions: 95°C for 3 min, (95°C for 30 s, 58°C for 1 min, and 72°C for 1 min) x 30, 72°C for 5 min. Products were blunt-end filled with T4 DNA polymerase before being cloned into pBSlox and sequenced as described above. PCR primers for existing and novel markers were designed for unique sequences as described above.

STS and EST primers from across the PAC contig were used to screen a panel of 54 tumor cell lines to identify additional homozygous deletions of this region. DNA was extracted from tumor cell lines using a Nucleon BACC2 kit (Scotlab BioSciences). A subset of cell lines was digested with EcoRI, and the fragments were separated on a 0.8% gel and then transferred to a nylon membrane (MSI) by Southern blotting. The membrane was hybridized as described above with radiolabeled probes.

Shotgun Sequencing of PAC 81N24.
PAC DNA was sheared by sonication at an amplitude of 30 µm for 10 s. Fragments greater than 500 bp were size-selected by agarose gel electrophoresis and then purified (Prep-a-gene; Bio-Rad). DNA was then subcloned into pBSlox plasmid vector that had been linearized by digestion with SmaI and dephosphorylated with calf intestinal phosphatase (a gift from C. Boyd, MRC HGU; prepared by K. Millar, MRC HGU) exactly as described previously (24) . Clones were then plated out using blue-white color selection, and a Flexys colony picker (PBA Technologies) was used to pick 720 clones into 96-well trays. Clones were gridded onto inked nitrocellulose membranes for hybridization. Clones were stored in 20% glycerol at -70°C. This library had a mean insert size of 1 kb. A shotgun library with a mean insert of size 3 kb was also prepared in the same way from 81N24 DNA sheared by sonication at 30 µm for 3 s.

DNA from the clones in the 1-kb insert library was prepared using a 96-well tray miniprep method provided by Mark Vaudin4 or Qiagen BioRobot. DNA was checked by digestion with EcoRI/XhoI according to the manufacturer’s instructions and by separating the fragments by gel electrophoresis. Clones were sequenced in 96-well trays using an ABI PRISM rhodamine dye terminator kit on a Hybaid subambient Omnigene thermal cycler. Sequencing reactions were precipitated according to manufacturer’s instructions (Perkin-Elmer) and run on an ABI 377 machine (Graham Clark, ICRF London, London, United Kingdom; Agnes Gallacher, MRC HGU, Edinburgh, United Kingdom).

All sequences were prescreened using RepeatMasker5 and assembled into contigs using the Staden program Gap4 (Ref. 30 ; HGMP-RC). Homology searches were performed using BLAST against GenBank, European Molecular Biology Laboratory, dbEST, dbSTS, SwissProt/TREMBL, and Escherichia coli genomic databases.

Cytogenetic Mapping of PAC Clones.
Aphidicholin was used to induce fragile site expression in the lymphoblastoid cell line FATO according to the method described by Glover et al. (31) . Cells were harvested between 0.5 and 2 h after the addition of colcemid and then lysed and fixed according to standard methods (32) . One µg of each PAC was labeled with either digoxygenin-dUTP or biotin -16-dUTP according to the manufacturer’s instructions (Boehringer/Roche) and then cohybridized to metaphase chromosomes using standard techniques (32) .

Slides were viewed using a Zeiss Axioplan microscope with a charge-coupled device camera. Images were captured using IPLab SmartCapture software.

Screening of Candidate Genes.
Unique primers were obtained for each of the candidate genes MAF, CFR-1, KARS, HHCMA56, and Tradd from the GeneBridge4 database. Primers for ADTG were derived from the sequence for the cDNA clone in the GenBank (see Table 1Citation ). PCR buffer was as described above, using 2 mM MgCl2 for MAF, CFR-1, KARS, and HHCMA56; 1.5 mM MgCl2 for ADTG; and 3 mM MgCl2 for Tradd. Conditions for the reactions were touchdown from 62°C to 52°C for MAF, CFR-1, KARS, and HHCMA56; touchdown from 63°C to 53°C for ADTG; and touchdown from 62°C to 52°C for Tradd with an extra 10 cycles at 52°C. Degenerate PCR for cadherin family members was performed using the primers and method described in Ref. 33 on DNA from PAC clones and YAC clones and on the cell line FATO as a positive control. Products were separated on a 2.5% agarose gel and transferred to a nylon membrane (MSI) by Southern blot. Blots of digested PAC clones (described above) were hybridized with cadherin probe pSM13 (exons 7–13), and blots of degenerate PCR products were hybridized with cadherin probe pSM14 (exons 14–16; Ref. 34 ).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation of PAC and YAC Contig Spanning the Homozygous Deletions.
RDA identified five unique products of a total of six characterized that were deleted from the tumor but present in the fibroblast populations of the malignant ovarian ascites specimen. The products were cloned and sequenced as described previously, and unique primers were designed for each product. By performing PCR on a monochromosome hybrid panel, we were able to map the RDA products. The characterization and localization of one of these clones to 9p21 have been described previously (9) . PCR using primers derived from the other cloned products showed that all four of them mapped to chromosome 16. One of these clones gave a complex pattern by PCR and was not pursued further. The remaining three products were mapped by PCR on a cytogenetic breakpoint panel (Fig. 1)Citation . All three were shown to lie between CY113(D) and CY121, a distance estimated to be approximately 6 Mb, located at 16q23.2 (25) .



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Localization of a homozygous deletion on 16q. The RDA products were mapped to 16q23.2, a region containing the polymorphic markers D16S515, D16S518, D16S516, D16S504, and D16S507, which have been shown to exhibit LOH in a variety of tumor types (10 11 12 13 14 , 16) , and the common fragile site FRA16D. PCR screening of a cytogenetic breakpoint panel localized the RDA products to a ~6-Mb region between the CY113(D) and CY121 breakpoints. YAC clones positive for the RDA products were aligned into a contig of approximately 3 Mb containing D16S518 and D16S504, which encompassed the homozygous deletion. A PAC contig of 700 kb encompassing the minimal deletion was built up starting with PAC clones positive for the RDA products, followed by chromosome walking both proximally and distally.

 
STS and EST markers from the region listed on the chromosome 16 integrated map (25) were positioned on YAC clones identified as lying between the cytogenetic breakpoints and mapped relative to the deletion in the original ovarian tumor. The resulting YAC contig was approximately 3 Mb in length and extended between markers D16S518 and D16S504/D16S516 (see Fig. 1Citation ). YAC clone 801B6 fully encompassed the region of homozygous loss in PEO4, thus defining the maximum size of the deletion as 1.4 Mb.

A panel of tumor cell lines and xenografts was screened with markers from within the deletion (Table 1)Citation . Of 54 cell lines, only 2 others were shown to contain homozygous deletions: (a) WX330, a xenograft of a small cell lung cancer; and (b) HCT116, a colonic adenocarcinoma cell line. PCR screening and Southern hybridization of these cell lines with the markers AFMA336YG9 and 10102 revealed that neither was deleted in the colonic cell line (Fig. 2)Citation , and thus the region of homozygous loss in HCT116 was smaller than the deletions in the other two cell lines and was flanked by these markers. It is likely that the tumor suppressor gene is located within or close to this minimal deletion. Gastric adenocarcinoma cell line AGS, originally reported to have a homozygous deletion at 3p14.2 around FRA3B (35) , has been identified by Mangelsdorf et al. (36) as having an additional homozygous deletion at 16q23.2, around FRA16D. The AGS cell line was confirmed as having a deletion mapping within our contig, but it does not narrow down the minimal deleted region delineated by HCT116 (see Fig. 3Citation ).



View larger version (57K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Hybridization of probe 10102 on tumor cell lines. DNA from tumor cell lines was digested with EcoRI and subjected to electrophoresis through a 0.8% gel. The DNA was transferred by standard Southern blot to nylon membrane. Radiolabeled probe derived from a genomic clone from the 1-kb insert library and positive for the marker 10102 was hybridized to the membrane overnight under standard conditions. The blot was washed with 0.2x SSC, 0.1% SDS and exposed to film for 9 days. Lane 1, WX330; Lane 2, TR175; Lane 3, TR146; Lane 4, HCT116; Lane 5, HeLa; Lane 6, OVCAR3; Lane 7, PEO4; Lane 8, FATO.

 


View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Physical map of the 16q23.2 deletion interval. a, relative positions of EST markers (filled circles) and STS markers ({circ}) within the YAC and PAC contig. Solid filled circles (•) represent EST markers lying within the minimally deleted region. The extent of the FRA16D region is based on data presented by Mangelsdorf et al. (36) . b, PAC contig encompassing ~700 kb. PAC clones were obtained from the RPCI-1 library or, where indicated, the RPCI-6 library (see "Materials and Methods"). A scale bar with distances shown in kb is given, and the positions of EagI, BssHII, and SalI sites are indicated as E, B, and S, respectively. A BssHII site was identified in PAC 253H19 (B) but was not found to be present in any of the overlapping PAC clones and was presumed to be created due to a polymorphism in that clone. The PAC clones around this site were aligned with respect to the EagI and SalI sites and their STS content. c, YAC contig encompassing ~3 Mb. (Contig length is based on the insert sizes provided by the Whitehead Institute for Biomedical Research.) YAC clones were obtained from the CEPH MegaYAC library (Genethon). YACs are not shown to scale but are positioned with respect to the STS/EST map shown in a. d, depiction of the 16q23 chromosome region from a gastric adenocarcinoma cell line (AGS), a small cell lung carcinoma (WX330), an ovarian adenocarcinoma ascitic specimen (PEO4), and a colonic adenocarcinoma (HCT116). The extent of the homozygous deletions in the three tumors is shown by the unfilled, dashed bars, whereas the filled bars represent DNA that has been maintained. The deletion regions represent that which is homozygously deleted from both chromosomes in each tumor sample.

 
To analyze this region more extensively, we constructed a higher-resolution physical map across the HCT116 deletion using PAC clones. Three unique RDA products (RD30, RD53, and RD69) were used to screen the RPCI-1 human PAC library by hybridization and identified a total of seven PAC clones. To generate additional markers for physical mapping, inter-Alu PCR was performed on YAC clones 801B6 and 933H2, and two of the resulting products, Alu11 and Alu20 (see Table 1Citation ), were used to rescreen the RPCI-1 library and identify additional PAC clones. End sequences from a number of the PACs and YACs were obtained by degenerate oligo-primed PCR end cloning (see Table 1Citation ), and two of these markers, 7t7 and IM97, were used to isolate additional PAC clones from the RPCI-1 and RPCI-6 libraries, respectively. PCR primers designed from all of the end sequences and Alu PCR clones were also used to map the PAC clones to construct a contig map. The degree of overlap between the PACs was determined by restriction enzyme analysis. Digested PAC fragments were separated by pulsed field electrophoresis and hybridized with several of the markers in the region. The resulting contig containing 23 clones is ~700 kb in length and is shown in Fig. 3Citation . The EagI and BssHII restriction sites are shown. No NotI sites were found in any of the clones. A BssHII site was identified near the proximal end of PAC 253H19 but was not detectable in any of the overlapping clones and appears to be due to a polymorphism in this clone generating a novel restriction site. The PAC clones surrounding this polymorphic site were therefore placed in the contig on the basis of both EagI and SalI restriction data and their STS content.

The resulting PAC contig encompasses the minimal deletion as defined by the HCT116 cell line and defines this region of loss as being ~210 kb and flanked by the markers Alu20 and 10102 (see Fig. 3Citation ). Although the contig does not fully encompass the regions homozygously lost in two of the other cell lines, it does contain much of the deleted regions, including the PEO4 distal breakpoint and the WX330 proximal breakpoint. The contig also extends more than 200 kb proximally and distally of the minimal deletion and is thus likely to contain any tumor suppressor gene affected by the deletion.

We have identified 11 putative transcripts that map within the minimal deletion and an additional 9 transcripts that are immediately adjacent by using a variety of methods. Exon trapping performed on PAC clone 81N24 resulted in a single correctly spliced product in addition to a number of aberrant products involving rearrangement or cryptic splicing of the trap vector, pSPL3. The potential exon thus isolated (ETA1) was found to show homology to a known EST (see Table 1Citation ) and mapped back to the minimal deletion. Shotgun sequencing of PAC clone 81N24 has resulted in approximately 60% coverage of this clone that covers most of the minimal deletion. BLAST searching of genome databases with these sequences has led to the identification of six additional EST clones, 5.1A6, IM23, IM25, IM28, IM29, and IM30 (see Table 1Citation ). Several of the PAC and YAC end clones (4t7, 10sp6, 10t7, and IM97) also showed homology to known ESTs, as did one of the original RDA products, RD30 (see Table 1Citation ). The remaining expressed sequences shown in Fig. 2Citation were identified from previously published maps of chromosome 16: (a) 435E and 10102 were identified from the integrated chromosome 16 map (25) ; (b) IM1-11 were identified from the work of Bednarek et al. (37) ; and (c) IM17-22 were identified from the GeneBridge4 map. PCR primers were designed for each of these clones and used to map the ESTs onto the YAC/PAC contig.

Eleven of these ESTs lie within the minimal deletion and are therefore disrupted in all three cell lines, whereas an additional nine ESTs lie outside the minimal deletion but are within the regions of homozygous loss in WX330 and PEO4.

Exclusion of Candidate Genes.
Several potential tumor suppressor loci have been identified previously and mapped to either chromosome 16q or the region of conserved synteny on mouse chromosome 8 (38) . The MAF oncogene (39) , the human Golgi sialoglycoprotein CFR-1 (also known as MG160 or GLG1; Ref. 40 ), and the {gamma} adaptin gene (ADTG; Ref. 41 ) have all been mapped by FISH to 16q22–23. ESTs from cDNA clones showing homology to human lysyl tRNA synthetase (KARS; Ref. 42 ) and human oxidoreductase (HHCMA56) have been positioned on the GeneBridge4 map between the markers D16S515 and D16S422 at 16q23, and an additional candidate locus, Tradd, has been mapped to the mouse syntenic region on chromosome 8 (43) .

We screened DNA from our YAC contig and the deletion-containing cell lines for all six genes by PCR. All of the candidate genes were found to be present in all of the cell lines and therefore must lie outside the deleted regions (data not shown). In addition, all of the loci were found to lie outside of the YAC contig, with the exception of HHCMA56, which is contained within YAC clone 972D3 and therefore lies several hundred kilobases distal of the PAC contig and the minimally deleted region.

We also screened our PAC and YAC contig for sequences homologous to cadherin genes. Seven members of the gene family are already known to map to 16q; five are located proximal of 16q23, and two are located distally (Ref. 44 ; Fig. 1Citation ). Cadherins are a family of calcium-dependent cell-cell adhesion molecules that have been implicated previously in tumor and invasion suppression (45) ; therefore, a novel cadherin family member would represent a clear candidate as a tumor suppressor gene. We hybridized the PAC clones with a plasmid containing the highly conserved extracellular repeated domains of CDH1 derived from E-cadherin. In addition, we performed PCR on the YAC and PAC clones using primers degenerate for a conserved region of the cytoplasmic domain of the cadherin family and then hybridized a blot of the PCR products with a probe derived from the E-cadherin cytoplasmic domain. There was no evidence consistent with a cadherin gene being contained within the PAC or YAC contig by either method (data not shown).

Thus, we have excluded MAF, CFR-1, KARS, ADTG, HHCMA56, Tradd, and members of the cadherin gene family from lying within both the 700-kb PAC contig and a 1.4-Mb YAC encompassing the homozygous deletions observed in PEO4, HCT116, and WX330. It is therefore unlikely that any of these genes are involved in the evolution of these tumors. However, we do not exclude the possibility that the expression of one or more of these genes may be altered due to a long range position effect.

Analysis of FRA16D.
We mapped our PAC contig relative to the common fragile site FRA16D by performing FISH with clones 211O19, 81N24, 24K21, and 93A3 on metaphase chromosomes induced to display the common fragile sites through folate depletion and treatment with aphidicholin.

In the majority of spreads examined (28 of 30), there had been breakage at FRA16D in one of the chromatids, with telomeric fusion of the distal fragment to the intact chromatid (see Fig. 4Citation ). Signal from the PAC clones was seen at the very end of the distal fragment (Fig. 4, a and b)Citation . However, in a few cases (2 of 30 cases), signal from clones 211O19, 81N24, and 24K21 was observed spanning a region of constriction at FRA16D, suggesting that these clones lie very close but just distal to the fragile site region (an example is shown in Fig. 4cCitation ). Our markers 17Sp6 and Alu20, which lie less than 50 kb proximal of 81N24, have been mapped by Mangelsdorf et al. (36) on to their {lambda} clones {lambda}504 and {lambda}87. The extensive FISH analysis performed by Mangelsdorf et al. (36) shows that {lambda}504 and {lambda}87 lie within the most likely region for the fragile site, thus ratifying our location of the clones 81N24, 211O19, and 24K21 just distal to FRA16D and confirming that our PAC contig spans the fragile site region.



View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. FISH analysis of fragile chromosomes. PACs 211O19, 81N24, 24K21, and 93A3 were labeled with different antigens and cohybridized onto metaphase chromosomes that had been cultured in the presence of aphidicolin to induce common fragile sites. Each of the figure sections (a, b, and c) comprises of three versions of the same image viewed with different filters. The first (i) shows 4',6-diamidino-2-phenylindole staining of the chromosome, the second (ii) is specific for the signal from PAC 81N24, and the third (iii) is specific for the signal from PAC 24K21. An arrow on the 4',6-diamidino-2-phenylindole image indicates the fragile site. In a and b, the chromosome has broken at the fragile site, with telomeric fusion of the distal fragment to the intact chromatid. c shows a chromosome in which the fragile site can be seen as a region of constriction. In a and b, the PAC clones appear distal to the breakpoint, whereas in c, the clones appear to span the fragile site.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
RDA has enabled us to identify two homozygous deletions in the malignant ascites from a patient with ovarian cancer. The first deletion extended over approximately 2 Mb and encompassed the tumor suppressor genes p16, p15, and p19 on 9p21 (9) . The second deletion, described here, extends over a maximum of 1.4 Mb (a minimum of 600 kb) at 16q23.2.

We have identified additional overlapping homozygous deletions in tumors derived from two different tissue types: (a) a xenograft of a small cell lung carcinoma cell line WX330; and (b) the well-characterized colonic adenocarcinoma cell line HCT116. The deletion in HCT116 is wholly contained within the deletions of both the ovarian cancer and lung cancer and is approximately 210 kb in size. We propose that this region contains a novel tumor suppressor gene that is involved in the initiation or progression of tumor formation in epithelial ovarian cancer, small cell lung cancer, and colonic adenocarcinoma. The significance of this putative tumor suppressor gene may be relevant to an even wider range of cancers because high levels of LOH in this same region are observed in breast cancer, prostate cancer, and hepatocellular carcinoma. In addition, a homozygous deletion of the same region has been identified in a tumor cell line from a gastric adenocarcinoma (36) .

The construction of a YAC and PAC contig across the deletions has enabled us to characterize the deletions and to map 11 expressed sequences to the minimally deleted region. We have excluded six candidate genes mapped previously to either human chromosome 16q23 or the region of conserved synteny on mouse chromosome 8. We were also unable to detect any members of the cadherin gene family in our contig.

We have preliminary evidence suggesting that the contig spans the common fragile site FRA16D (Fig. 4)Citation , and this is substantiated by the data presented by Mangelsdorf et al. (36) . It is thought that fragile sites may be the targets of mutagens and carcinogens and may therefore be prone to rearrangement or breakage during the evolution of a tumor (46) ; indeed, translocation breakpoints at (14;16)(q32.3;23) observed in some cases of multiple myeloma have been shown to bracket FRA16D (47) .

The precise relationship of aphidicolin-inducible common fragile sites to tumorigenesis is still not understood. There are several common fragile sites that can be induced in the chromosomes of most individuals in vitro, including 3p14, 2q31, 6q26, 7q31.2, 16q23, and Xp22 (31) . However, unlike the rare fragile sites, they have not been associated with any discrete genomic structure. Two other common fragile sites have been shown to be associated with LOH or deletion in tumors, FRA3B (3p14.2) and FRA7G (7q31.2). Sequence analysis of these regions has failed to give a definitive explanation for the molecular basis of their observed fragility (48, 49, 50) , but hot spots for viral integration and sequence homologies with small polydispersed circular DNA have been suggested. Mathematical modeling of the sequence reveals unusual DNA structures, in particular, regions of high flexibility, which may affect replication, condensation, organization, and recombination of the chromosome (49 , 51) . Delays in DNA replication at common fragile sites due to the primary and secondary structure of their DNA could result in the breaks observed in vitro after culture with DNA polymerase inhibitors (52 , 53) . A similar mechanism of chromosomal breakage may occur in vivo during tumor development, when the normal checks of genome integrity may be deficient, thus providing a possible link between fragile sites and neoplasia. In our system, both PEO4 cells and one of the other deletion-containing tumor cell lines (HCT116) show genetic instability, but it appears that the instability has arisen in each cell line via a different mechanism. Invoking the hypothesis of Lengauer et al. (54) , PEO4 cells appear to have generalized chromosomal instability with aneuploidy and multiple rearranged chromosomes, as demonstrated by previous comparative genomic hybridization analysis (9) and FISH analysis (data not shown), whereas HCT116 cells show microsatellite instability, are near diploid, and do not show generalized genomic instability (55) . This suggests that breakage at common fragile sites is independent of the chromosomal instability or microsatellite instability status of the cell, and thus the mechanism causing rearrangement and loss of DNA at fragile sites requires further investigation. One hypothesis suggested by recent sequence analysis of deletions at FRA3B proposes that homologous recombination between repetitive elements is a mechanism for repair of breaks at common fragile sites and results in the deletion of intervening sequences (49) .

In this study, we have described the identification of three homozygous deletions around 16q23 in three different tumors. We propose that deletion of 16q23.2 has been selected for in these tumors due to the concomitant loss of function of a tumor suppressor gene located in this region. The frequently observed loss and rearrangement of 16q23 in many different tumors suggests that this novel tumor suppressor gene is important in several different cancers, including ovarian cancer. The characterization of a deletion in this region and the construction of a physical map across it have identified a number of independent transcripts, the starting point for identifying a novel tumor suppressor gene of relevance to a wide range of cancers.


    ACKNOWLEDGMENTS
 
We thank members of the molecular genetics section MRC HGU for materials and much helpful advice, in particular, Chris Boyd, Heather Davidson, and Kirsty Millar. We also thank Pat Malloy for help with FISH, Paul Perry for digital imaging, Graham Clark at ICRF Lincoln’s Inn Fields for sequencing, the Central Cell Services and oligonucleotide synthesis laboratories at ICRF Clare Hall, Marion Bussemakers for materials, Mark Hirst for valued discussion, Rob Richards and his group for sharing unpublished data, and Nick Hastie for continued support.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Imperial Cancer Research Fund and the United Kingdom Medical Research Council. Back

2 To whom requests for reprints should be addressed at, Imperial Cancer Research Fund Medical Oncology Unit, Western General Hospital, Crewe Road, Edinburgh, EH4 2XU, United Kingdom. Phone: 44-131-332-2471, ext. 2401; Fax: 44-131-332-8494; E-mail: watsonv{at}icrf.icnet.uk Back

3 The abbreviations used are: RDA, representational difference analysis; FISH, fluorescence in situ hybridization; LOH, loss of heterozygosity; PAC, P1-derived bacterial artificial chromosome; YAC, yeast artificial chromosome; EST, expressed sequence tag; STS, sequence tagged site; ICRF, Imperial Cancer Research Fund; HGMP-RC, Human Genome Mapping Project Resource Center; MRC HGU, Medical Research Council Human Genetics Unit; Mb, megabase. Back

4 Mark Vaudin, personal communication. Back

5 A. F. A. Smit and P. Green, unpublished observations. Back

Received 8/18/99. Accepted 1/19/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lisitsyn N., Lisitsyn N., Wigler M. Cloning the differences between two complex genomes. Science (Washington DC), 259: 946-951, 1993.[Abstract]
  2. Friend S., Bernards R., Roggel J., Weinberg R., Rapaport J., Albert D., Dryja T. A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature (Lond.), 323: 643-646, 1986.[Medline]
  3. Call K. M., Glaser T., Ito C. Y., Buckler A. J., Pelletier J., Haber D. A., Rose E. A., Kral A., Yeger H., Lewis W. H. Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms’ tumor locus. Cell, 60: 509-520, 1990.[Medline]
  4. Schutte M., da-Costa L. T., Hahn S. A., Moskaluk C., Hoque A. T., Rozenblum E., Weinstein C. L., Bittner M., Meltzer P. S., Trent J. M., Yeo C. J., Hruban R. H., Kern S. E. Identification by representational difference analysis of a homozygous deletion in pancreatic carcinoma that lies within the BRCA2 region. Proc. Natl. Acad. Sci. USA, 92: 5950-5954, 1995.[Abstract/Free Full Text]
  5. Kamb A., Gruis N. A., Weaver-Feldhaus J., Liu Q., Harshman K., Tavtigian S. V., Stockert E., Day R. R., Johnson B. E., Skolnick M. H. A cell cycle regulator potentially involved in genesis of many tumor types. Science (Washington DC), 264: 436-440, 1994.[Abstract/Free Full Text]
  6. Ohta M., Inoue H., Cotticelli M. G., Kastury K., Baffa R., Palazzo J., Siprashvili Z., Mori M., McCue P., Druck T., Croce C. M., Huebner K. The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell, 84: 587-597, 1996.[Medline]
  7. Hannon G. J., Beach D. p15INK4B is a potential effector of TGF-ß-induced cell cycle arrest. Nature (Lond.), 371: 257-261, 1994.[Medline]
  8. Quelle D. E., Zindy F., Ashmun R. A., Sherr C. J. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83: 993-1000, 1995.[Medline]
  9. Watson J. E. V., Gabra H., Taylor K. J., Rabiasz G. J., Morrison H., Perry P., Smyth J. F., Porteous D. J. Identification and characterization of a homozygous deletion found in ovarian ascites by representational difference analysis. Genome Res., 9: 226-233, 1999.[Abstract/Free Full Text]
  10. Li C., Berx G., Larsson C., Auer G., Aspenblad U., Pan Y., Sundelin B., Ekman P., Nordenskjold M., van Roy F., Bergerheim U. S. R. Distinct deleted regions on chromosome segment 16q23–24 associated with metastases in prostate cancer. Genes Chromosomes Cancer, 24: 175-182, 1999.[Medline]
  11. Latil A., Cussenot O., Fournier G., Driouch K., Lidereau R. Loss of heterozygosity at chromosome 16q in prostate adenocarcinoma: identification of three independent regions. Cancer Res., 57: 1058-1062, 1997.[Abstract/Free Full Text]
  12. Driouch K., Dorion-Bonnet F., Briffod M., Champeme M. H., Longy M., Lidereau R. Loss of heterozygosity on chromosome arm 16q in breast cancer metastases. Genes Chromosomes Cancer, 19: 185-191, 1997.[Medline]
  13. Iida A., Isobe R., Yoshimoto M., Kasumi F., Nakamura Y., Emi M. Localization of a breast cancer tumour-suppressor gene to a 3-cM interval within chromosomal region 16q22. Br. J. Cancer, 75: 264-267, 1997.[Medline]
  14. Chen T., Sahin A., Aldaz C. M. Deletion map of chromosome 16q in ductal carcinoma in situ of the breast: refining a putative tumor suppressor gene region. Cancer Res., 56: 5605-5609, 1996.[Abstract/Free Full Text]
  15. Roylance R., Gorman P., Harris W., Liebmann R., Barnes D., Hanby A., Sheer D. Comparative genomic hybridization of breast tumors stratified by histological grade reveals new insights into the biological progression of breast cancer. Cancer Res., 59: 1433-1436, 1999.[Abstract/Free Full Text]
  16. Chou Y-H., Chung K-C., Jeng L-B., Chen T-C., Liaw Y-F. Frequent allelic loss on chromosomes 4q and 16q associated with human hepatocellular carcinoma in Taiwan. Cancer Lett., 123: 1-6, 1998.[Medline]
  17. Iwabuchi H., Sakamoto M., Sakunaga H., Ma Y. Y., Carcangiu M. L., Pinkel D., Yang-Feng T. L., Gray J. W. Genetic analysis of benign, low-grade, and high-grade ovarian tumors. Cancer Res., 55: 6172-6180, 1995.[Abstract/Free Full Text]
  18. Doggett N. A., Breuning M. H., Callen D. F. Report of the fourth international workshop on human chromosome 16 mapping 1995. Cytogenet. Cell Genet., 72: 271-293, 1996.[Medline]
  19. Smith D. I., Huang H., Wang L. Common fragile sites and cancer. Int. J. Oncol., 12: 187-196, 1998.[Medline]
  20. Lisitsyn N. A., Lisitsina N. M., Dalbagni G., Barker P., Sanchez C. A., Gnarra J., Linehan W. M., Reid B. J., Wigler M. H. Comparative genomic analysis of tumors: detection of DNA losses and amplification. Proc. Natl. Acad. Sci. USA, 92: 151-155, 1995.[Abstract/Free Full Text]
  21. Wolf C., Hayward I., Lawrie S., Buckton K., McIntyre M., Adams D., Lewis A., Scott A., Smyth J. Cellular heterogeneity and drug resistance in two ovarian adenocarcinoma cell lines derived from a single patient. Int. J. Cancer, 39: 695-702, 1987.[Medline]
  22. Hay F. G., Duncan L. W., Leonard R. C. F. Establishment and characterisation of two new small cell lung cancer cell lines–one from a patient with previous familial retinoblastoma. Br. J. Cancer, 63: 43-45, 1991.
  23. Brattain M. G., Fine W. D., Khaled F. M., Thompson J., Brattain D. E. Heterogeneity of malignant cells from a human colonic carcinoma. Cancer Res., 41: 1751-1756, 1981.[Abstract/Free Full Text]
  24. Boyd A. C. Turbo cloning: a fast, efficient method for cloning PCR products and other blunt-ended DNA fragments into plasmids. Nucleic Acids Res., 21: 817-821, 1993.[Abstract/Free Full Text]
  25. Doggett N. A., Goodwin L. A., Tesmer J. G., Meincke L. J., Bruce D. C., Clark L. M., Altherr M. R., Ford A. A., Chi H. C., Marrone B. L., Longmire J. L., Lane S. A., Whitmore S. A., Lowenstein M. G., Sutherland R. D., Mundt M. O., Knill E. H., Bruno W. J., Macken C. A., Torney D. C., Wu J-R., Griffith J., Sutherland G. R., Deaven L. L., Callen D. F., Moyzis R. K. An integrated physical map of human chromosome 16. Nature (Lond.), 377: 335-365, 1995.[Medline]
  26. Chumakov I., Rigault P., Guillou S., Ougen P., Billaut A., Guasconi G., Gervy P., LeGall I., Soularue P., Grinas L. Continuum of overlapping clones spanning the entire human chromosome 21q. Nature (Lond.), 359: 380-387, 1992.[Medline]
  27. Wu C., Zhu S., Simpson S., de Jong P. J. DOP-vector PCR: a method for rapid isolation and sequencing of insert termini from PAC clones. Nucleic Acids Res., 24: 2614-2615, 1996.[Free Full Text]
  28. Church D. M., Stotler C. J., Rutter J. L., Murrell J. R., Trofatter J. A., Buckler A. J. Isolation of genes from complex sources of mammalian genomic DNA using exon amplification. Nat. Genet., 6: 98-105, 1994.[Medline]
  29. Nelson D. L., Ledbetter S. A., Corbo L., Victoria M. F., Ramirez-Solis R., Webster T. D., Ledbetter D. H., Caskey C. T. Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA, 86: 6686-6690, 1989.[Abstract/Free Full Text]
  30. Staden R. The Staden sequence analysis package. Mol. Biotechnol., 5: 233-241, 1996.[Medline]
  31. Glover T. W., Berger C., Coyle J., Echo B. DNA polymerase {alpha} inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. Hum. Genet., 67: 136-142, 1984.[Medline]
  32. Lichter, P., and Cremer, T. Chromosome analysis by non-isotopic in situ hybridization. In: D. E. Rooney and B. H. Czepulkowski (eds.), Human Cytogenetics: A Practical Approach, Ed. 1, Vol. 1, pp. 157–192. Oxford, United Kingdom: Oxford University Press, 1992.
  33. Suzuki S., Sano K., Tanihara H. Diversity of the cadherin family: evidence for eight new cadherins in nervous tissue. Cell Regul., 2: 261-270, 1991.[Medline]
  34. Bussemakers M. J., van Bokhoven A., Mees S. G., Kemler R., Schalken J. A. Molecular cloning and characterization of the human E-cadherin cDNA. Mol. Biol. Rep., 17: 123-128, 1993.[Medline]
  35. Kastury K., Baffa R., Druck T., Ohta M., Cotticelli M. G., Inoue H., Negrini M., Rugge M., Huang D., Croce C. M., Palazzo J., Huebner K. Potential gastrointestinal tumor suppressor locus at the 3p14.2 FRA3B site identified by homozygous deletions in tumor cell lines. Cancer Res., 56: 978-983, 1996.[Abstract/Free Full Text]
  36. Mangelsdorf M., Ried K., Woollatt E., Dayan S., Eyre H., Finnis M., Hobson L., Nancarrow J., Venter D., Baker E., Richards R. I. Chromosomal fragile site FRA16D and DNA instability in cancer. Cancer Res., 60: 1683-1689, 2000.[Abstract/Free Full Text]
  37. Bednarek A. K., Aldaz C. M. Characterization of transcripts from a commonly deleted area of chromosome 16 (q23.3–q24.1). Proc. Am. Assoc. Cancer Res., 39: 128 1998.
  38. Becker-Follmann J., Gaa A., Bausch E., Natt E., Scherer G., von Deimling O. High-resolution mapping of a linkage group on mouse chromosome 8 conserved on human chromosome 16Q. Mamm. Genome, 8: 172-177, 1997.[Medline]
  39. Yoshida M. C., Nishizawa M., Kataoka K., Goto N., Fujiwara K. T., Kawai S. Localization of the human MAF protooncogene on chromosome 16 to bands q22–q23. Cytogenet. Cell Genet., 58: 2003 1991.
  40. Mourelatos Z., Gonatas J. O., Cinato E., Gonatas N. K. Cloning and sequence analysis of the human MG160, a fibroblast growth factor and E-selectin binding membrane sialoglycoprotein of the Golgi apparatus. DNA Cell Biol., 15: 1121-1128, 1996.[Medline]
  41. Peyrard M., Parveneh S., Lagercrantz S., Ekman M., Fransson I., Sahlen S., Dumanski J. P. Cloning, expression pattern, and chromosomal assignment to 16q23 of the human {gamma}-adaptin gene (ADTG). Genomics, 50: 275-280, 1998.[Medline]
  42. Nomura N., Nagase T., Miyajima N., Sazuka T., Tanaka A., Sato S., Seki N., Kawarabayasi Y., Ishikawa K., Tabata S. Prediction of the coding sequences of unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041–KIAA0080) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res., 1: 223-229, 1994.[Abstract]
  43. Pan M. G., Xiong J., Copeland N. G., Gilbert D. J., Jenkins N. A., Goeddel D. V. Sequence, genomic organization, and chromosome localization of the mouse TRADD gene. J. Inflamm., 46: 168-175, 1995.[Medline]
  44. Kremmidiotis G., Baker E., Crawford J., Eyre H. J., Nahmias J., Callen D. F. Localization of human cadherin genes to chromosome regions exhibiting cancer-related loss of heterozygosity. Genomics, 49: 467-471, 1998.[Medline]
  45. Berx G., Cleton-Jansen A. M., Nollet F., de Leeuw W. J., van de Vijver M., Cornelisse C., van Roy F. E-cadherin is a tumour/invasion suppressor gene mutated in human lobular breast cancers. EMBO J., 14: 6107-6115, 1995.[Medline]
  46. Yunis J. J., Soreng A. L., Bowe A. E. Fragile sites are targets of diverse mutagens and carcinogens. Oncogene, 1: 59-69, 1987.[Medline]
  47. Chesi M., Bergsagel P. L., Shonukan O. O., Martelli M. L., Brents L. A., Chen T., Schrock E., Ried T., Kuehl W. M. Frequent dysregulation of the c-maf proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma. Blood, 91: 4457-4463, 1998.[Abstract/Free Full Text]
  48. Boldog F., Gemmill R. M., West J., Robinson M., Robinson L., Li E., Roche J., Todd S., Waggoner B., Lundstrom R., Jacobson J., Mullokandov M. R., Klinger H., Drabkin H. A. Chromosome 3p14 homozygous deletions and sequence analysis of FRA3B. Hum. Mol. Genet., 6: 193-203, 1997.[Abstract/Free Full Text]
  49. Mimori K., Druck T., Inoue H., Alder H., Berk L., Mori M., Huebner K., Croce C. M. Cancer-specific chromosome alterations in the constitutive fragile region FRA3B. Proc. Natl. Acad. Sci. USA, 96: 7456-7461, 1999.[Abstract/Free Full Text]
  50. Huang H., Qian J., Proffit J., Wilber K., Jenkins R., Smith D. I. FRA7G extends over a broad region: coincidence of human endogenous retroviral sequences (HERV-H) and small polydispersed circular DNAs (spcDNA) and fragile sites. Oncogene, 16: 2311-2319, 1998.[Medline]
  51. Mishmar D., Rahat A., Scherer S. W., Nyakatura G., Hinzmann B., Kohwi Y., Mandel-Gutfroind Y., Lee J. R., Drescher B., Sas D. E., Margalit H., Platzer M., Weiss A., Tsui L. C., Rosenthal A., Kerem B. Molecular characterization of a common fragile site (FRA7H) on human chromosome 7 by the cloning of a simian virus 40 integration site. Proc. Natl. Acad. Sci. USA, 95: 8141-8146, 1998.[Abstract/Free Full Text]
  52. Wang L., Darling J., Zhang J. S., Huang H., Liu W., Smith D. I. Allele-specific late replication and fragility of the most active common fragile site, FRA3B. Hum. Mol. Genet., 8: 431-437, 1999.[Abstract/Free Full Text]
  53. Le Beau M. M., Rassool F. V., Neilly M. E., Espinosa R., III, Glover T. W., Smith D. I., McKeithan T. W. Replication of a common fragile site, FRA3B, occurs late in S phase and is delayed further upon induction: implications for the mechanism of fragile site induction. Hum. Mol. Genet., 7: 755-761, 1998.[Abstract/Free Full Text]
  54. Lengauer C., Kinzler K. W., Vogelstein B. Genetic instabilities in human cancers. Nature (Lond.), 396: 643-649, 1998.[Medline]
  55. Lengauer C., Kinzler K. W., Vogelstein B. Genetic instability in colorectal cancers. Nature (Lond.), 386: 623-627, 1997.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
C. Gourley, A. J.W. Paige, K. J. Taylor, C. Ward, B. Kuske, J. Zhang, M. Sun, S. Janczar, D. J. Harrison, M. Muir, et al.
WWOX Gene Expression Abolishes Ovarian Cancer Tumorigenicity In vivo and Decreases Attachment to Fibronectin via Integrin {alpha}3
Cancer Res., June 1, 2009; 69(11): 4835 - 4842.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. W. Glover, M. F. Arlt, A. M. Casper, and S. G. Durkin
Mechanisms of common fragile site instability
Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R197 - R205.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Finnis, S. Dayan, L. Hobson, G. Chenevix-Trench, K. Friend, K. Ried, D. Venter, E. Woollatt, E. Baker, and R. I. Richards
Common chromosomal fragile site FRA16D mutation in cancer cells
Hum. Mol. Genet., May 15, 2005; 14(10): 1341 - 1349.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Musio, C. Montagna, T. Mariani, M. Tilenni, M. L. Focarelli, L. Brait, E. Indino, P. A. Benedetti, L. Chessa, A. Albertini, et al.
SMC1 involvement in fragile site expression
Hum. Mol. Genet., February 15, 2005; 14(4): 525 - 533.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. T. Barrett, A. Scheffer, A. Ben-Dor, N. Sampas, D. Lipson, R. Kincaid, P. Tsang, B. Curry, K. Baird, P. S. Meltzer, et al.
Comparative genomic hybridization using oligonucleotide microarrays and total genomic DNA
PNAS, December 21, 2004; 101(51): 17765 - 17770.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. I. Aqeilan, T. Kuroki, Y. Pekarsky, O. Albagha, F. Trapasso, R. Baffa, K. Huebner, P. Edmonds, and C. M. Croce
Loss of WWOX Expression in Gastric Carcinoma
Clin. Cancer Res., May 1, 2004; 10(9): 3053 - 3058.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Kuroki, S. Yendamuri, F. Trapasso, A. Matsuyama, R. I. Aqeilan, H. Alder, S. Rattan, R. Cesari, M. L. Nolli, N. N. Williams, et al.
The Tumor Suppressor Gene WWOX at FRA16D Is Involved in Pancreatic Carcinogenesis
Clin. Cancer Res., April 1, 2004; 10(7): 2459 - 2465.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Watanabe, Y. Hippo, H. Taniguchi, H. Iwanari, M. Yashiro, K. Hirakawa, T. Kodama, and H. Aburatani
An Opposing View on WWOX Protein Function as a Tumor Suppressor
Cancer Res., December 15, 2003; 63(24): 8629 - 8633.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. A. Jackson, A. V. Trevino, M. C. Herzig, T. S. Herman, and J. M. Woynarowski
Matrix attachment region (MAR) properties and abnormal expansion of AT island minisatellites in FRA16B fragile sites in leukemic CEM cells
Nucleic Acids Res., November 1, 2003; 31(21): 6354 - 6364.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Corbin, M. E. Neilly, R. Espinosa III, E. M. Davis, T. W. McKeithan, and M. M. Le Beau
Identification of Unstable Sequences within the Common Fragile Site at 3p14.2: Implications for the Mechanism of Deletions within Fragile Histidine Triad Gene/Common Fragile Site at 3p14.2 in Tumors
Cancer Res., June 1, 2002; 62(12): 3477 - 3484.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Kuroki, F. Trapasso, T. Shiraishi, H. Alder, K. Mimori, M. Mori, and C. M. Croce
Genetic Alterations of the Tumor Suppressor Gene WWOX in Esophageal Squamous Cell Carcinoma
Cancer Res., April 1, 2002; 62(8): 2258 - 2260.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. K. Bednarek, C. L. Keck-Waggoner, R. L. Daniel, K. J. Laflin, P. L. Bergsagel, K. Kiguchi, A. J. Brenner, and C. M. Aldaz
WWOX, the FRA16D Gene, Behaves as a Suppressor of Tumor Growth
Cancer Res., November 1, 2001; 61(22): 8068 - 8073.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. J. W. Paige, K. J. Taylor, C. Taylor, S. G. Hillier, S. Farrington, D. Scott, D. J. Porteous, J. F. Smyth, H. Gabra, and J. E. V. Watson
WWOX: A candidate tumor suppressor gene involved in multiple tumor types
PNAS, September 25, 2001; 98(20): 11417 - 11422.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Shiraishi, T. Druck, K. Mimori, J. Flomenberg, L. Berk, H. Alder, W. Miller, K. Huebner, and C. M. Croce
Sequence conservation at human and mouse orthologous common fragile regions, FRA3B/FHIT and Fra14A2/Fhit
PNAS, April 18, 2001; (2001) 91095898.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
E. C. Thorland, S. L. Myers, D. H. Persing, G. Sarkar, R. M. McGovern, B. S. Gostout, and D. I. Smith
Human Papillomavirus Type 16 Integrations in Cervical Tumors Frequently Occur in Common Fragile Sites
Cancer Res., November 1, 2000; 60(21): 5916 - 5921.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
K. Ried, M. Finnis, L. Hobson, M. Mangelsdorf, S. Dayan, J. K. Nancarrow, E. Woollatt, G. Kremmidiotis, A. Gardner, D. Venter, et al.
Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells
Hum. Mol. Genet., July 1, 2000; 9(11): 1651 - 1663.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. L. Paris, J. S. Witte, P. A. Kupelian, H. Levin, E. A. Klein, W. J. Catalona, and G. Casey
Identification and Fine Mapping of a Region Showing a High Frequency of Allelic Imbalance on Chromosome 16q23.2 That Corresponds to a Prostate Cancer Susceptibility Locus
Cancer Res., July 1, 2000; 60(13): 3645 - 3649.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Mangelsdorf, K. Ried, E. Woollatt, S. Dayan, H. Eyre, M. Finnis, L. Hobson, J. Nancarrow, D. Venter, E. Baker, et al.
Chromosomal Fragile Site FRA16D and DNA Instability in Cancer
Cancer Res., March 1, 2000; 60(6): 1683 - 1689.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
N.-S. Chang, N. Pratt, J. Heath, L. Schultz, D. Sleve, G. B. Carey, and N. Zevotek
Hyaluronidase Induction of a WW Domain-containing Oxidoreductase That Enhances Tumor Necrosis Factor Cytotoxicity
J. Biol. Chem., January 26, 2001; 276(5): 3361 - 3370.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Shiraishi, T. Druck, K. Mimori, J. Flomenberg, L. Berk, H. Alder, W. Miller, K. Huebner, and C. M. Croce
Sequence conservation at human and mouse orthologous common fragile regions, FRA3B/FHIT and Fra14A2/Fhit
PNAS, May 8, 2001; 98(10): 5722 - 5727.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paige, A. J. W.
Right arrow Articles by Watson, J. E. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paige, A. J. W.
Right arrow Articles by Watson, J. E. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online