| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Imperial Cancer Research Fund [A. J. W. P. , K. J. T., H. G., G. C. S., J. F. S., J. E. V. W.] and MRC Human Genetics Unit [D. J. P.], Western General Hospital, Edinburgh EH4 2XU, United Kingdom, and Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom [A. S., J. G. S.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
RDA on DNA from malignant ovarian ascites led us to the identification of a homozygous deletion at 9p21 that encompassed the previously characterized tumor suppressor gene cluster p16, p15, and p19 (5 , 7 , 8) described in Ref. 9 . Here we describe the characterization of another homozygous deletion in DNA from the same patient, which we show maps to 16q23.2. This region shows allele imbalance and DNA loss in many tumor types including prostate cancer (10 , 11) , breast cancer (12, 13, 14, 15) , hepatocellular carcinoma (16) , and ovarian cancer (17) . Furthermore, the common aphidicolin-inducible fragile site FRA16D also maps to 16q23.2 (18) . There have been numerous reports of common fragile sites associated with chromosomal rearrangements in cancer, including translocations (11q) and deletions (3p; reviewed in Ref. 19 ). The most extensively characterized of these is FRA3B at 3p14.2. RDA identified a probe that was homozygously deleted in cancer cell lines (20) . This probe was subsequently mapped to a YAC and BAC contig in 3p14.2 and found to be within FHIT/FRA3B (6) .
It is thought that common fragile sites may be prone to breaks and deletions in dividing cells, thus providing a possible mechanism for the inactivation of any neighboring genes. If one of those neighboring genes acts as a tumor suppressor, then cells in which such a deletion occurs will have a selective growth advantage.
We demonstrate here the identification of a small region of homozygous deletion common to an ovarian tumor, a colon carcinoma cell line, and a small cell lung cancer cell line. We have constructed a complete physical and partial transcript map across the minimal deleted region and identified 11 distinct expressed sequences. These represent possible candidates as novel tumor suppressor genes involved in cancer development in several different tumor types.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Identification of a Homozygous Deletion.
RDA was carried out as described previously (9)
. Products
were cloned into pBSlox (24)
and sequenced as described
previously (9)
. Primers were designed to the sequences
using the programs PRIMER (Whitehead Institute for Biomedical Research)
and OLIGO 4.0 (Wojciech Rychlik) and are shown in Table 1
. The chromosomal location of the RDA products was determined by
screening a monochromosome hybrid mapping panel (HGMP-RC, Cambridge,
United Kingdom) and a cytogenetic breakpoint mapping panel by PCR
(David Callen, Adelaide Womens and Childrens Hospital, Adelaide,
Australia; Ref. 25
). PCR was carried out using standard
"touchdown" conditions [50 ng of template, 150 pg of each primer,
200 µM deoxynucleotide triphosphates, 1 unit of Taq
polymerase (ICRF Pic Taq), 1.5 mM
MgCl2, and 50 mM KCl],
unless otherwise stated. Reaction conditions 94°C for 3 min; (94°C
30 s; 65°C 30 s; 72°C 30 s) x 2; decrease
annealing temperature by 2°C every two cycles down to 55°C; (94°C
30 s; 55°C 30 s; 72°C 30 s) x 20; 72°C 2
min. Reactions were carried out on a Hybaid Omnigene or MJ
Tetrad thermocycler.
|
Generation of Markers.
YAC clones from the CEPH MegaYAC library
(26)
were identified from the Whitehead STS map and
obtained from David Callen, HGMP-RC, and the German Human Genome
Project Resource Center. DNA was prepared from YAC clones using a
Nucleon YAC miniprep kit, following the manufacturers instructions
(ScotLab Bioscience, Luton, United Kingdom). End clones were
obtained from PAC and YAC clones using degenerate oligo-primed PCR
exactly as described previously (27)
, using the primers
AATTTATCACTACGGAATTC and CCGATCTCAAGATTACGGAATTC for YAC clones.
Products were either directly sequenced after purification on 0.8%
agarose gel and DNA extraction (Prep-a-Gene; Bio-Rad) or subcloned into
pGemT-easy (Promega), followed by amplification and DNA preparation
using a Qiagen miniprep kit, before sequencing. All sequencing
reactions were carried out using an ABI PRISM dye terminator cycle
sequencing kit (Perkin-Elmer).
PAC 81N24 was exon-trapped using vector pSPL3 (Ref. 28 ; Life Technologies, Inc.). The protocol was carried out according to the manufacturers instructions, with advice and materials from Donny Black (Cancer Research Campaign Beatson Laboratories, Glasgow, United Kingdom). Final PCR products were cloned into pGemT (Promega) and sequenced as described above.
Inter-Alu PCR was carried out using the method described previously (29) . PCR was carried out using the following conditions: 95°C for 3 min, (95°C for 30 s, 58°C for 1 min, and 72°C for 1 min) x 30, 72°C for 5 min. Products were blunt-end filled with T4 DNA polymerase before being cloned into pBSlox and sequenced as described above. PCR primers for existing and novel markers were designed for unique sequences as described above.
STS and EST primers from across the PAC contig were used to screen a panel of 54 tumor cell lines to identify additional homozygous deletions of this region. DNA was extracted from tumor cell lines using a Nucleon BACC2 kit (Scotlab BioSciences). A subset of cell lines was digested with EcoRI, and the fragments were separated on a 0.8% gel and then transferred to a nylon membrane (MSI) by Southern blotting. The membrane was hybridized as described above with radiolabeled probes.
Shotgun Sequencing of PAC 81N24.
PAC DNA was sheared by sonication at an amplitude of 30 µm for
10 s. Fragments greater than 500 bp were size-selected by agarose
gel electrophoresis and then purified (Prep-a-gene; Bio-Rad). DNA was
then subcloned into pBSlox plasmid vector that had been linearized by
digestion with SmaI and dephosphorylated with calf
intestinal phosphatase (a gift from C. Boyd, MRC HGU; prepared by K.
Millar, MRC HGU) exactly as described previously (24)
.
Clones were then plated out using blue-white color selection, and a
Flexys colony picker (PBA Technologies) was used to pick 720 clones
into 96-well trays. Clones were gridded onto inked nitrocellulose
membranes for hybridization. Clones were stored in 20% glycerol at
-70°C. This library had a mean insert size of 1 kb. A shotgun
library with a mean insert of size 3 kb was also prepared in the same
way from 81N24 DNA sheared by sonication at 30 µm for 3 s.
DNA from the clones in the 1-kb insert library was prepared using a 96-well tray miniprep method provided by Mark Vaudin4 or Qiagen BioRobot. DNA was checked by digestion with EcoRI/XhoI according to the manufacturers instructions and by separating the fragments by gel electrophoresis. Clones were sequenced in 96-well trays using an ABI PRISM rhodamine dye terminator kit on a Hybaid subambient Omnigene thermal cycler. Sequencing reactions were precipitated according to manufacturers instructions (Perkin-Elmer) and run on an ABI 377 machine (Graham Clark, ICRF London, London, United Kingdom; Agnes Gallacher, MRC HGU, Edinburgh, United Kingdom).
All sequences were prescreened using RepeatMasker5 and assembled into contigs using the Staden program Gap4 (Ref. 30 ; HGMP-RC). Homology searches were performed using BLAST against GenBank, European Molecular Biology Laboratory, dbEST, dbSTS, SwissProt/TREMBL, and Escherichia coli genomic databases.
Cytogenetic Mapping of PAC Clones.
Aphidicholin was used to induce fragile site expression in the
lymphoblastoid cell line FATO according to the method described by
Glover et al. (31)
. Cells were harvested
between 0.5 and 2 h after the addition of colcemid and then lysed
and fixed according to standard methods (32)
. One µg of
each PAC was labeled with either digoxygenin-dUTP or biotin -16-dUTP
according to the manufacturers instructions (Boehringer/Roche) and
then cohybridized to metaphase chromosomes using standard techniques
(32)
.
Slides were viewed using a Zeiss Axioplan microscope with a charge-coupled device camera. Images were captured using IPLab SmartCapture software.
Screening of Candidate Genes.
Unique primers were obtained for each of the candidate genes MAF,
CFR-1, KARS, HHCMA56, and Tradd from the GeneBridge4
database. Primers for ADTG were derived from the sequence
for the cDNA clone in the GenBank (see Table 1
). PCR buffer was as
described above, using 2 mM
MgCl2 for MAF, CFR-1, KARS, and
HHCMA56; 1.5 mM
MgCl2 for ADTG; and 3
mM MgCl2 for
Tradd. Conditions for the reactions were touchdown from
62°C to 52°C for MAF, CFR-1, KARS, and
HHCMA56; touchdown from 63°C to 53°C for
ADTG; and touchdown from 62°C to 52°C for
Tradd with an extra 10 cycles at 52°C. Degenerate PCR for
cadherin family members was performed using the primers and method
described in Ref. 33
on DNA from PAC clones and YAC clones
and on the cell line FATO as a positive control. Products were
separated on a 2.5% agarose gel and transferred to a nylon membrane
(MSI) by Southern blot. Blots of digested PAC clones (described above)
were hybridized with cadherin probe pSM13 (exons 713), and blots of
degenerate PCR products were hybridized with cadherin probe pSM14
(exons 1416; Ref. 34
).
| RESULTS |
|---|
|
|
|---|
|
A panel of tumor cell lines and xenografts was screened with markers
from within the deletion (Table 1)
. Of 54 cell lines, only 2 others
were shown to contain homozygous deletions: (a) WX330, a
xenograft of a small cell lung cancer; and (b) HCT116, a
colonic adenocarcinoma cell line. PCR screening and Southern
hybridization of these cell lines with the markers AFMA336YG9 and 10102
revealed that neither was deleted in the colonic cell line (Fig. 2)
, and thus the region of homozygous loss in HCT116 was smaller than the
deletions in the other two cell lines and was flanked by these markers.
It is likely that the tumor suppressor gene is located within or close
to this minimal deletion. Gastric adenocarcinoma cell line AGS,
originally reported to have a homozygous deletion at 3p14.2 around
FRA3B (35)
, has been identified by Mangelsdorf et
al. (36)
as having an additional homozygous
deletion at 16q23.2, around FRA16D. The AGS cell line was confirmed as
having a deletion mapping within our contig, but it does not narrow
down the minimal deleted region delineated by HCT116 (see Fig. 3
).
|
|
700 kb in length and is shown in Fig. 3
The resulting PAC contig encompasses the minimal deletion as defined by
the HCT116 cell line and defines this region of loss as being
210 kb
and flanked by the markers Alu20 and 10102 (see Fig. 3
). Although the
contig does not fully encompass the regions homozygously lost in two of
the other cell lines, it does contain much of the deleted regions,
including the PEO4 distal breakpoint and the WX330 proximal breakpoint.
The contig also extends more than 200 kb proximally and distally of the
minimal deletion and is thus likely to contain any tumor suppressor
gene affected by the deletion.
We have identified 11 putative transcripts that map within the minimal
deletion and an additional 9 transcripts that are immediately adjacent
by using a variety of methods. Exon trapping performed on PAC clone
81N24 resulted in a single correctly spliced product in addition to a
number of aberrant products involving rearrangement or cryptic splicing
of the trap vector, pSPL3. The potential exon thus isolated (ETA1) was
found to show homology to a known EST (see Table 1
) and mapped back to
the minimal deletion. Shotgun sequencing of PAC clone 81N24 has
resulted in approximately 60% coverage of this clone that covers most
of the minimal deletion. BLAST searching of genome databases with these
sequences has led to the identification of six additional EST clones,
5.1A6, IM23, IM25, IM28, IM29, and IM30 (see Table 1
). Several of the
PAC and YAC end clones (4t7, 10sp6, 10t7, and IM97) also showed
homology to known ESTs, as did one of the original RDA products, RD30
(see Table 1
). The remaining expressed sequences shown in Fig. 2
were
identified from previously published maps of chromosome 16:
(a) 435E and 10102 were identified from the integrated
chromosome 16 map (25)
; (b) IM1-11 were
identified from the work of Bednarek et al.
(37)
; and (c) IM17-22 were identified from the
GeneBridge4 map. PCR primers were designed for each of these clones and
used to map the ESTs onto the YAC/PAC contig.
Eleven of these ESTs lie within the minimal deletion and are therefore disrupted in all three cell lines, whereas an additional nine ESTs lie outside the minimal deletion but are within the regions of homozygous loss in WX330 and PEO4.
Exclusion of Candidate Genes.
Several potential tumor suppressor loci have been identified previously
and mapped to either chromosome 16q or the region of conserved synteny
on mouse chromosome 8 (38)
. The MAF oncogene
(39)
, the human Golgi sialoglycoprotein
CFR-1 (also known as MG160 or
GLG1; Ref. 40
), and the
adaptin gene
(ADTG; Ref. 41
) have all been mapped by FISH to
16q2223. ESTs from cDNA clones showing homology to human lysyl tRNA
synthetase (KARS; Ref. 42
) and human
oxidoreductase (HHCMA56) have been positioned on the
GeneBridge4 map between the markers D16S515 and D16S422 at 16q23, and
an additional candidate locus, Tradd, has been mapped to the
mouse syntenic region on chromosome 8 (43)
.
We screened DNA from our YAC contig and the deletion-containing cell lines for all six genes by PCR. All of the candidate genes were found to be present in all of the cell lines and therefore must lie outside the deleted regions (data not shown). In addition, all of the loci were found to lie outside of the YAC contig, with the exception of HHCMA56, which is contained within YAC clone 972D3 and therefore lies several hundred kilobases distal of the PAC contig and the minimally deleted region.
We also screened our PAC and YAC contig for sequences homologous to
cadherin genes. Seven members of the gene family are already known to
map to 16q; five are located proximal of 16q23, and two are located
distally (Ref. 44
; Fig. 1
). Cadherins are a family of
calcium-dependent cell-cell adhesion molecules that have been
implicated previously in tumor and invasion suppression
(45)
; therefore, a novel cadherin family member would
represent a clear candidate as a tumor suppressor gene. We hybridized
the PAC clones with a plasmid containing the highly conserved
extracellular repeated domains of CDH1 derived from E-cadherin. In
addition, we performed PCR on the YAC and PAC clones using primers
degenerate for a conserved region of the cytoplasmic domain of the
cadherin family and then hybridized a blot of the PCR products with a
probe derived from the E-cadherin cytoplasmic domain. There was no
evidence consistent with a cadherin gene being contained within the PAC
or YAC contig by either method (data not shown).
Thus, we have excluded MAF, CFR-1, KARS, ADTG, HHCMA56, Tradd, and members of the cadherin gene family from lying within both the 700-kb PAC contig and a 1.4-Mb YAC encompassing the homozygous deletions observed in PEO4, HCT116, and WX330. It is therefore unlikely that any of these genes are involved in the evolution of these tumors. However, we do not exclude the possibility that the expression of one or more of these genes may be altered due to a long range position effect.
Analysis of FRA16D.
We mapped our PAC contig relative to the common fragile site FRA16D by
performing FISH with clones 211O19, 81N24, 24K21, and 93A3 on metaphase
chromosomes induced to display the common fragile sites through folate
depletion and treatment with aphidicholin.
In the majority of spreads examined (28 of 30), there had been breakage
at FRA16D in one of the chromatids, with telomeric fusion of the distal
fragment to the intact chromatid (see Fig. 4
). Signal from the PAC clones was seen at the very end of the distal
fragment (Fig. 4, a and b)
. However, in a few
cases (2 of 30 cases), signal from clones 211O19, 81N24, and 24K21
was observed spanning a region of constriction at FRA16D, suggesting
that these clones lie very close but just distal to the fragile site
region (an example is shown in Fig. 4c
). Our markers 17Sp6
and Alu20, which lie less than 50 kb proximal of 81N24, have been
mapped by Mangelsdorf et al. (36)
on to their
clones
504 and
87. The extensive FISH analysis performed by
Mangelsdorf et al. (36)
shows that
504 and
87 lie within the most likely region for the fragile
site, thus ratifying our location of the clones 81N24, 211O19, and
24K21 just distal to FRA16D and confirming that our PAC contig spans
the fragile site region.
|
| DISCUSSION |
|---|
|
|
|---|
We have identified additional overlapping homozygous deletions in tumors derived from two different tissue types: (a) a xenograft of a small cell lung carcinoma cell line WX330; and (b) the well-characterized colonic adenocarcinoma cell line HCT116. The deletion in HCT116 is wholly contained within the deletions of both the ovarian cancer and lung cancer and is approximately 210 kb in size. We propose that this region contains a novel tumor suppressor gene that is involved in the initiation or progression of tumor formation in epithelial ovarian cancer, small cell lung cancer, and colonic adenocarcinoma. The significance of this putative tumor suppressor gene may be relevant to an even wider range of cancers because high levels of LOH in this same region are observed in breast cancer, prostate cancer, and hepatocellular carcinoma. In addition, a homozygous deletion of the same region has been identified in a tumor cell line from a gastric adenocarcinoma (36) .
The construction of a YAC and PAC contig across the deletions has enabled us to characterize the deletions and to map 11 expressed sequences to the minimally deleted region. We have excluded six candidate genes mapped previously to either human chromosome 16q23 or the region of conserved synteny on mouse chromosome 8. We were also unable to detect any members of the cadherin gene family in our contig.
We have preliminary evidence suggesting that the contig spans the
common fragile site FRA16D (Fig. 4)
, and this is substantiated by the
data presented by Mangelsdorf et al. (36)
. It
is thought that fragile sites may be the targets of mutagens and
carcinogens and may therefore be prone to rearrangement or breakage
during the evolution of a tumor (46)
; indeed,
translocation breakpoints at (14;16)(q32.3;23) observed in some cases
of multiple myeloma have been shown to bracket FRA16D
(47)
.
The precise relationship of aphidicolin-inducible common fragile sites to tumorigenesis is still not understood. There are several common fragile sites that can be induced in the chromosomes of most individuals in vitro, including 3p14, 2q31, 6q26, 7q31.2, 16q23, and Xp22 (31) . However, unlike the rare fragile sites, they have not been associated with any discrete genomic structure. Two other common fragile sites have been shown to be associated with LOH or deletion in tumors, FRA3B (3p14.2) and FRA7G (7q31.2). Sequence analysis of these regions has failed to give a definitive explanation for the molecular basis of their observed fragility (48, 49, 50) , but hot spots for viral integration and sequence homologies with small polydispersed circular DNA have been suggested. Mathematical modeling of the sequence reveals unusual DNA structures, in particular, regions of high flexibility, which may affect replication, condensation, organization, and recombination of the chromosome (49 , 51) . Delays in DNA replication at common fragile sites due to the primary and secondary structure of their DNA could result in the breaks observed in vitro after culture with DNA polymerase inhibitors (52 , 53) . A similar mechanism of chromosomal breakage may occur in vivo during tumor development, when the normal checks of genome integrity may be deficient, thus providing a possible link between fragile sites and neoplasia. In our system, both PEO4 cells and one of the other deletion-containing tumor cell lines (HCT116) show genetic instability, but it appears that the instability has arisen in each cell line via a different mechanism. Invoking the hypothesis of Lengauer et al. (54) , PEO4 cells appear to have generalized chromosomal instability with aneuploidy and multiple rearranged chromosomes, as demonstrated by previous comparative genomic hybridization analysis (9) and FISH analysis (data not shown), whereas HCT116 cells show microsatellite instability, are near diploid, and do not show generalized genomic instability (55) . This suggests that breakage at common fragile sites is independent of the chromosomal instability or microsatellite instability status of the cell, and thus the mechanism causing rearrangement and loss of DNA at fragile sites requires further investigation. One hypothesis suggested by recent sequence analysis of deletions at FRA3B proposes that homologous recombination between repetitive elements is a mechanism for repair of breaks at common fragile sites and results in the deletion of intervening sequences (49) .
In this study, we have described the identification of three homozygous deletions around 16q23 in three different tumors. We propose that deletion of 16q23.2 has been selected for in these tumors due to the concomitant loss of function of a tumor suppressor gene located in this region. The frequently observed loss and rearrangement of 16q23 in many different tumors suggests that this novel tumor suppressor gene is important in several different cancers, including ovarian cancer. The characterization of a deletion in this region and the construction of a physical map across it have identified a number of independent transcripts, the starting point for identifying a novel tumor suppressor gene of relevance to a wide range of cancers.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by the Imperial Cancer Research Fund
and the United Kingdom Medical Research Council. ![]()
2 To whom requests for reprints should be
addressed at, Imperial Cancer Research Fund Medical Oncology Unit,
Western General Hospital, Crewe Road, Edinburgh, EH4 2XU, United
Kingdom. Phone: 44-131-332-2471, ext. 2401; Fax: 44-131-332-8494;
E-mail: watsonv{at}icrf.icnet.uk ![]()
3 The abbreviations used are: RDA,
representational difference analysis; FISH, fluorescence in
situ hybridization; LOH, loss of heterozygosity; PAC,
P1-derived bacterial artificial chromosome; YAC, yeast artificial
chromosome; EST, expressed sequence tag; STS, sequence tagged site;
ICRF, Imperial Cancer Research Fund; HGMP-RC, Human Genome Mapping
Project Resource Center; MRC HGU, Medical Research Council Human
Genetics Unit; Mb, megabase. ![]()
4 Mark Vaudin, personal communication. ![]()
5 A. F. A. Smit and P. Green,
unpublished observations. ![]()
Received 8/18/99. Accepted 1/19/00.
| REFERENCES |
|---|
|
|
|---|
inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. Hum. Genet., 67: 136-142, 1984.[Medline]
-adaptin gene (ADTG). Genomics, 50: 275-280, 1998.[Medline]
This article has been cited by other articles:
![]() |
C. Gourley, A. J.W. Paige, K. J. Taylor, C. Ward, B. Kuske, J. Zhang, M. Sun, S. Janczar, D. J. Harrison, M. Muir, et al. WWOX Gene Expression Abolishes Ovarian Cancer Tumorigenicity In vivo and Decreases Attachment to Fibronectin via Integrin {alpha}3 Cancer Res., June 1, 2009; 69(11): 4835 - 4842. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. W. Glover, M. F. Arlt, A. M. Casper, and S. G. Durkin Mechanisms of common fragile site instability Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R197 - R205. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Finnis, S. Dayan, L. Hobson, G. Chenevix-Trench, K. Friend, K. Ried, D. Venter, E. Woollatt, E. Baker, and R. I. Richards Common chromosomal fragile site FRA16D mutation in cancer cells Hum. Mol. Genet., May 15, 2005; 14(10): 1341 - 1349. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Musio, C. Montagna, T. Mariani, M. Tilenni, M. L. Focarelli, L. Brait, E. Indino, P. A. Benedetti, L. Chessa, A. Albertini, et al. SMC1 involvement in fragile site expression Hum. Mol. Genet., February 15, 2005; 14(4): 525 - 533. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Barrett, A. Scheffer, A. Ben-Dor, N. Sampas, D. Lipson, R. Kincaid, P. Tsang, B. Curry, K. Baird, P. S. Meltzer, et al. Comparative genomic hybridization using oligonucleotide microarrays and total genomic DNA PNAS, December 21, 2004; 101(51): 17765 - 17770. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. I. Aqeilan, T. Kuroki, Y. Pekarsky, O. Albagha, F. Trapasso, R. Baffa, K. Huebner, P. Edmonds, and C. M. Croce Loss of WWOX Expression in Gastric Carcinoma Clin. Cancer Res., May 1, 2004; 10(9): 3053 - 3058. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kuroki, S. Yendamuri, F. Trapasso, A. Matsuyama, R. I. Aqeilan, H. Alder, S. Rattan, R. Cesari, M. L. Nolli, N. N. Williams, et al. The Tumor Suppressor Gene WWOX at FRA16D Is Involved in Pancreatic Carcinogenesis Clin. Cancer Res., April 1, 2004; 10(7): 2459 - 2465. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Watanabe, Y. Hippo, H. Taniguchi, H. Iwanari, M. Yashiro, K. Hirakawa, T. Kodama, and H. Aburatani An Opposing View on WWOX Protein Function as a Tumor Suppressor Cancer Res., December 15, 2003; 63(24): 8629 - 8633. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Jackson, A. V. Trevino, M. C. Herzig, T. S. Herman, and J. M. Woynarowski Matrix attachment region (MAR) properties and abnormal expansion of AT island minisatellites in FRA16B fragile sites in leukemic CEM cells Nucleic Acids Res., November 1, 2003; 31(21): 6354 - 6364. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Corbin, M. E. Neilly, R. Espinosa III, E. M. Davis, T. W. McKeithan, and M. M. Le Beau Identification of Unstable Sequences within the Common Fragile Site at 3p14.2: Implications for the Mechanism of Deletions within Fragile Histidine Triad Gene/Common Fragile Site at 3p14.2 in Tumors Cancer Res., June 1, 2002; 62(12): 3477 - 3484. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kuroki, F. Trapasso, T. Shiraishi, H. Alder, K. Mimori, M. Mori, and C. M. Croce Genetic Alterations of the Tumor Suppressor Gene WWOX in Esophageal Squamous Cell Carcinoma Cancer Res., April 1, 2002; 62(8): 2258 - 2260. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Bednarek, C. L. Keck-Waggoner, R. L. Daniel, K. J. Laflin, P. L. Bergsagel, K. Kiguchi, A. J. Brenner, and C. M. Aldaz WWOX, the FRA16D Gene, Behaves as a Suppressor of Tumor Growth Cancer Res., November 1, 2001; 61(22): 8068 - 8073. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. W. Paige, K. J. Taylor, C. Taylor, S. G. Hillier, S. Farrington, D. Scott, D. J. Porteous, J. F. Smyth, H. Gabra, and J. E. V. Watson WWOX: A candidate tumor suppressor gene involved in multiple tumor types PNAS, September 25, 2001; 98(20): 11417 - 11422. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shiraishi, T. Druck, K. Mimori, J. Flomenberg, L. Berk, H. Alder, W. Miller, K. Huebner, and C. M. Croce Sequence conservation at human and mouse orthologous common fragile regions, FRA3B/FHIT and Fra14A2/Fhit PNAS, April 18, 2001; (2001) 91095898. [Abstract] [Full Text] |
||||
![]() |
E. C. Thorland, S. L. Myers, D. H. Persing, G. Sarkar, R. M. McGovern, B. S. Gostout, and D. I. Smith Human Papillomavirus Type 16 Integrations in Cervical Tumors Frequently Occur in Common Fragile Sites Cancer Res., November 1, 2000; 60(21): 5916 - 5921. [Abstract] [Full Text] |
||||
![]() |
K. Ried, M. Finnis, L. Hobson, M. Mangelsdorf, S. Dayan, J. K. Nancarrow, E. Woollatt, G. Kremmidiotis, A. Gardner, D. Venter, et al. Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells Hum. Mol. Genet., July 1, 2000; 9(11): 1651 - 1663. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Paris, J. S. Witte, P. A. Kupelian, H. Levin, E. A. Klein, W. J. Catalona, and G. Casey Identification and Fine Mapping of a Region Showing a High Frequency of Allelic Imbalance on Chromosome 16q23.2 That Corresponds to a Prostate Cancer Susceptibility Locus Cancer Res., July 1, 2000; 60(13): 3645 - 3649. [Abstract] [Full Text] |
||||
![]() |
M. Mangelsdorf, K. Ried, E. Woollatt, S. Dayan, H. Eyre, M. Finnis, L. Hobson, J. Nancarrow, D. Venter, E. Baker, et al. Chromosomal Fragile Site FRA16D and DNA Instability in Cancer Cancer Res., March 1, 2000; 60(6): 1683 - 1689. [Abstract] [Full Text] |
||||
![]() |
N.-S. Chang, N. Pratt, J. Heath, L. Schultz, D. Sleve, G. B. Carey, and N. Zevotek Hyaluronidase Induction of a WW Domain-containing Oxidoreductase That Enhances Tumor Necrosis Factor Cytotoxicity J. Biol. Chem., January 26, 2001; 276(5): 3361 - 3370. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shiraishi, T. Druck, K. Mimori, J. Flomenberg, L. Berk, H. Alder, W. Miller, K. Huebner, and C. M. Croce Sequence conservation at human and mouse orthologous common fragile regions, FRA3B/FHIT and Fra14A2/Fhit PNAS, May 8, 2001; 98(10): 5722 - 5727. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |