| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Department of Genetics, Stanford University School of Medicine, Stanford, California 94305
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Murine TSG101 is expressed from the one- or two-cell stage of embryonic development (9) and is expressed ubiquitously in the organs of adult mice and humans (3 , 9) . Either overexpression or deficiency of TSG101 can result in tumorigenesis (1) or defective cell cycling (2 , 19) , implying that either elevation or diminution of the TSG101 steady-state level can lead directly or indirectly to abnormal cell growth. A corollary of this statement is that TSG101 expression normally may be stringently controlled. We report here investigations that address the mechanism of regulation of TSG101 protein level. We show that intracellular TSG101 protein is in fact maintained within a narrow range in cultured cell populations by a posttranslational mechanism that modulates TSG101 protein degradation and prevents its accumulation in cells overexpressing TSG101 mRNA. We further show that regulation of the steady-state level of intracellular TSG101 protein is mediated by an evolutionarily conserved sequence (termed the SB4 ) located near its COOH terminus.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
DNA Subcloning and Manipulation.
The full-length protein coding sequence of mouse tsg101 cDNA
is 10 AA residues longer at the NH2 terminus than reported
initially (1)
, as recently verified and corrected by us
(GenBank accession numbers U52945 and U82130) and others
(9)
, and the corrected sequence was used in the
experiments reported here. Murine tsg101 cDNA was excised by
partial digestion with HindIII and digestion with
NotI from pLLEXP1 (1)
and inserted into
pIND (Invitrogen) that had been digested with HindIII and
NotI. The tsg101 coding sequence plus the 5'- and
3'-UTRs of the previously cloned cDNA are present in the resulting pIND
construct. Full-length human TSG101 cDNA (3)
was cleaved from pAMP1 by EagI and SalI and
inserted into pIND digested with NotI and XhoI.
Flag-tagged TSG101 constructs were made by fusing the 8-AA
Flag coding sequence (GACTACAAGGACGACGATGACAAG for AAs DYKDDDDK) in
frame with the last codon of the TSG101 protein coding
sequence through a spacer of three glycine codons (GGAGGTGGA). In-frame
short deletions in mouse TSG101 were generated by
linearization of the plasmid at an internal restriction enzyme cleavage
site, followed by treatment with S1 nuclease to delete several bases at
each end. Blunt ends were created using the Klenow fragment of
Escherichia coli DNA polymerase I, and E. coli
DNA ligase was used to recircularize the construct before
transformation. LacZ fusion constructs were generated by
joining the last codon of the E. coli LacZ gene in plasmids
pIND-LacZ and pIND(SP1)-LacZ to a TSG101 cDNA fragment
coding for the COOH-terminal polypeptide through a DNA linker (GGGATC
for AAs G and I). DNA sequencing was always performed to identify the
appropriate in-frame fusion and to verify the correctness of junctions,
manipulated DNA segments, and PCR-derived sequences.
Antibodies.
Antisera against the full-length murine TSG101 protein or the
COOH-terminal 20 AAs were raised in rabbits, and the antibodies were
purified by affinity chromatography as described previously
(2)
. Other antibodies used in this research included the
M2 mouse monoclonal antibody (Kodak, New Haven, CT) for detection of
the Flag peptide and the antibody against 
-tubulin (Sigma, St.
Louis, MO) for normalization of loading.
Gel Electrophoresis and Immunoblotting.
Proteins in cell lysates were separated by SDS-PAGE, electrotransferred
to nitrocellulose filters, and analyzed by enhanced chemiluminescence
(Amersham, Buckinghamshire, United Kingdom).
Protein Labeling and Immunoprecipitation.
Cells grown to about 50% confluence were washed and incubated for
1 h in methionine-free DMEM (Life Technologies, Inc.), followed by
labeling of proteins in 150 µCi/ml [35S]methionine for
the designated time. In pulse-chase experiments, the labeling time was
1 h. For immunoprecipitations, labeled cells were washed in PBS
twice before being lysed in 2 ml of cold radioimmunoprecipitation assay
buffer [50 mM Tris-Cl (pH 7.5), 0.15 M NaCl,
1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, and proteinase
inhibitors]. The lysates were centrifuged at 4000 rpm for 5 min, and
supernatants were either stored at -80°C or used directly.
Individual samples containing equal volumes of labeled extracts were
incubated for 1 h with 2 µg of nonspecific rabbit IgG and 30
µl of protein A-agarose beads (Pharmacia, Uppsala, Sweden) on a
rocking rotary shaker in a cold room. The supernatant was then
incubated with an excess amount of specific antibody and 30 µl of
protein A-agarose beads overnight. The beads were washed four times
with radioimmunoprecipitation assay buffer, and bound proteins were
dissolved by boiling in the loading buffer, separated on SDS-PAGE gels,
and analyzed by autoradiography. Protein concentrations were estimated
by serial dilution of the protein samples before loading onto gels and
by spectroscopic analysis of band intensities on X-ray films.
Northern Blot Analysis.
Total RNAs were isolated from cells by RNA STAT-60 (Tel-Test,
Friendswood, TX), separated in agarose gels under denaturing
conditions, and transferred using capillaries to Hybond-N nylon
membranes (Amersham Life Sciences). Hybridization and washing were
performed under stringent conditions as described by Sambrook et
al. (20)
.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. To determine whether TSG101 protein actually was being expressed from
adventitious constructs and to distinguish induced TSG101 from the
endogenous protein, we attached a nucleotide segment encoding an 8-AA
Flag sequence plus three additional spacer AAs (see "Materials and
Methods") to the 3' ends of human and murine TSG101 protein coding
sequences and generated Ecr293 (human) and Ecr3T3 (murine) stable
transfectants containing these constructs. After the addition of MA to
these cultures, Western blot analysis of cell extracts using antibodies
made against either full-length TSG101 or its COOH-terminal end
detected human and murine cDNA-encoded protein bands that migrated more
slowly in gels (calculated molecular weights of 49,000 and
50,000, respectively, in both murine and human cells) than the
respective endogenous TSG101 proteins, which migrate near
Mr 46,000 (Fig. 1, B–D).
Whereas the
positions of these bands were higher than expected from addition of the
11-AA Flag peptide and spacer to full-length TSG101 proteins,
immunoprecipitations from Ecr293 cells by antibody against the Flag
peptide (Fig. 1E
, right) confirmed that the
slowly migrating species made in these cells is Flag-tagged TSG101
protein derived from the induced adventitious construct (Fig. 1E
, left) rather than a modified form of
endogenous TSG101.
|
. Because similar results were observed in these cell lines during
expression of adventitious mouse and human TSG101 cDNAs, the
cDNAs and cell lines were used interchangeably in subsequent
experiments. As seen in Fig. 2
, the extent of replacement of the
endogenous protein varied with the period of induced expression of the
adventitious Flag-tagged protein (Fig. 2A)
and the
concentration of inducer (Fig. 2B)
. In the absence of
inducer, little or no adventitious protein was expressed, indicating
effective control of the regulated promoter. Adventitious TSG101
protein was first detected in elevated amounts 4 h after
induction, reached its maximum of twice the native level of endogenous
protein at 8 h, and was maintained at this level throughout the
experiment as long as inducer was present (Fig. 2A)
. After
8 h of induced expression of adventitious TSG101 by 1
µM MA, endogenous TSG101 began to decrease, and at
24 h, it was present in this experiment at 20% of the initial
level (Fig. 2A)
; the precise extent of reduction of
endogenous TSG101 varied slightly among different experiments. At a MA
concentration of 10 µM, adventitious TSG101 protein was
present at more than 10 times the amount of endogenous protein after
24 h of induction (Fig. 2B)
.
|
. As Flag-tagged
adventitious TSG101 decayed, endogenous TSG101 gradually retuned to its
normal steady-state level. The ratio of Flag-tagged adventitious TSG101
protein:endogenous native protein remained unchanged during
subculturing of continuously induced transfected cell lines for more
than 30 doublings (Fig. 2D)
, indicating that the observed
replacement of endogenous protein with adventitious protein did not
result from selective growth of induced cells. Interestingly, the
observed 1.5- to 2-fold increase in total (i.e., endogenous
plus adventitious) TSG101 protein at the time of maximum induction was
associated with cell clumping and a more rounded cell morphology
compared with inducer-treated cells that did not overexpress TSG101
protein.
Down-Regulation of TSG101 Protein Is Posttranslational.
In contrast to the observations made for TSG101 protein, Northern
blot analysis showed that TSG101-specific mRNA increased 6- to 10-fold 24 h after the addition of 1 or 10 µM MA to
Ecr293 cells containing the Flag-tagged murine TSG101 construct
(Fig. 3
,left). During this time, endogenous (human) TSG101
transcripts, which were distinguishable from the adventitious (mouse)
transcripts using a probe that detects their distinct 3'-UTR (GenBank
accession number U82130) remained at a constant level (Fig. 3
,
middle). Given the observed dramatic decrease in endogenous
TSG101 protein under experimental conditions (Fig. 2)
, in which
endogenous mRNA production remained constant, the observed
down-regulation of TSG101 protein production must necessarily be
independent of any transcriptional control. To determine whether this
posttranscriptional control occurs at the level of translation, we
radioactively labeled total cellular protein with
[35S]methionine and analyzed the proteins
immunoprecipitated by excess anti-TSG101 antibody (Fig. 4A)
. In the absence of inducer, a single radioactive band whose rate of
synthesis was unaltered by the induced synthesis of adventitious
Flag-tagged TSG101 protein was observed, indicating that
translation of the adventitious protein does not interfere with the
synthesis of endogenous TSG101 and thus implying that the regulation of
intracellular TSG101 levels within a narrow range is accomplished
posttranslationally.
|
|
, after 8 h of nonradioactive
chase of the methionine pulse, the combined intracellular level of
labeled adventitious and endogenous TSG101 proteins was less than the
level of endogenous TSG101 alone in noninduced cells, indicating that
overexpression of adventitious TSG101 accelerates the turnover rate of
the entire intracellular pool of TSG101 protein. These findings
implicate enhanced protein decay as the mechanism that prevents
intracellular accumulation of TSG101 during overexpression of the
adventitious gene.
A Conserved Region within the COOH-terminal Domain Is Required for
TSG101 Protein Autoregulation.
To identify the TSG101 sequences involved in posttranslational
regulation of the intracellular concentration, we constructed a set of
in-frame short deletion mutations within murine TSG101 cDNA
and isolated stably transfected Ecr293 cell clones containing these
constructs (Fig. 5)
. Cell lines showing induced expression were obtained at a high frequency
for all constructs except SD4-28, which produced detectable protein in
only 5 of 40 clones. As seen in Fig. 5B
, four of five TSG101
mutant proteins containing short in-frame deletions (i.e.
constructs DS1-1, DS2-9, SD3-17, and SD4-28, respectively) retained the
ability to down-regulate endogenous TSG101 protein after induction,
whereas the product of construct SD5-59, in which a glycine residue
replaced four AAs (AAs 348–351; Fig. 5B
), had little effect
on the intracellular level of endogenous protein. Confirmation that the
COOH-terminal end of adventitious TSG101 is necessary for
down-regulation of the endogenous protein was provided by our finding
that the LD1-18 construct, which lacks 42 AAs at the COOH-terminal end
of TSG101, totally lost this ability; additionally, unlike the
full-length adventitious TSG101 protein (Fig. 2)
, this overexpressed
deletion protein accumulated to 4–5 times the normal level of
endogenous TSG101 (Fig. 5B
, Fig. 5C
). Because the
AA residues removed in this construct are required for maintenance of
the steady-state level of TSG101 within a narrow range, this region of
TSG101 was termed the SB. The 3-AA internal deletion of SD5-59, which
significantly reduced the ability of TSG101 protein to down-regulate
its own intracellular level, is located in the SB (see Fig. 7
).
|
|
. Production
of these adventitious proteins at a level equivalent to or higher than
the endogenous protein failed to show a detectable decrease of
endogenous TSG101.
Pulse-chase experiments comparing the turnover rate of endogenous
TSG101 protein in cells that had been transfected by TSG101 cDNA
constructs containing or lacking the SB (Fig. 5)
directly implicated
the SB in TSG101 turnover. As seen in Fig. 6
,left, endogenous TSG101 was decreased by two-thirds during
the first 8 h of chase in cells overexpressing adventitious
Flag-tagged full-length TSG101 protein. However, cells showing
comparable overexpression of adventitious LD1-18 protein (Fig. 6
,
insert), which lacks the SB, showed much less reduction of
endogenous TSG101, suggesting that the mutant is defective in its
inability to accelerate decay of the endogenous full-length protein.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
These findings suggest a model in which the biological effects of TSG101 are modulated either by self-promoted proteolysis or participation with other cellular protein(s) in a proteolytic feedback control loop. The posttranslational autoregulation observed for TSG101 at the level of protein decay is reminiscent of the mechanism that prevents intracellular accumulation of the product of another tumor susceptibility gene, p53 (21) . In that case, overproduction of p53 promotes the synthesis of the MDM2 protein, which in turn accelerates p53 degradation (22 , 23) . If TSG101 participates in an analogous feedback control loop with a second protein, its partner in the loop is also likely to be affected by alterations in TSG101 production.
The ability of overexpressed TSG101 to accelerate its own degradation
is consistent with the proposal that TSG101 may have a role in
proteolysis (14
, 15)
. However, the COOH-terminal SB region
that our studies show is necessary for normal regulation of the
intracellular concentration of TSG101 is distinct from the
ubiquitin-conjugase-like domain previously identified in the
NH2-terminal region of TSG101. TSG101 derivatives lacking
or mutated in the SB accumulate at several times the normal level while
also not reducing the concentration of endogenous TSG101 protein,
demonstrating a crucial role for this region in TSG101 autoregulation.
However, truncated adventitious proteins containing only the SB fail to
accomplish down-regulation of endogenous TSG101 (Fig. 6)
, indicating
that the SB alone is insufficient. Interestingly, the SB and its
flanking sequences are the most conserved regions of TSG101 homology
among yeast, Caenorhabditis elegans, and mammals (Fig. 7)
, suggesting an evolutionarily preserved function in these disparate
organisms. Sequence similarity in the SB is 69% between C.
elegans and human or mouse and 56% between yeast and these
mammals. Among the 45 AAs in the SB, there are 21 AAs (47%) conserved
and 11 identical AAs (24%) in all four species.
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported in part by the 1993 Helmut Horten
Research Award (to S. N. C.), by a grant from the National Foundation
for Cancer Research, and by a gift from the Chiron Corporation. 
2 Present address: Cereon Genomics, 45 Sidney
Street, Cambridge, MA 02139.
3 To whom requests for reprints should be
addressed. Phone: (650) 723-5315; Fax: (650) 725-1536; E-mail: sncohen{at}stanford.edu
4 The abbreviations used are: SB, steadiness box;
AA, amino acid; MA, muristerone A; PA, ponasterone A; UTR, untranslated
region.
Received 9/28/99. Accepted 2/11/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  B. McDonald and J. Martin-Serrano Regulation of Tsg101 Expression by the Steadiness Box: A Role of Tsg101-associated Ligase Mol. Biol. Cell, February 1, 2008; 19(2): 754 - 763. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. W. Young, F. C. Mei, D. G. Rosen, G. Yang, N. Li, J. Liu, and X. Cheng Up-regulation of Tumor Susceptibility Gene 101 Protein in Ovarian Carcinomas Revealed by Proteomics Analyses Mol. Cell. Proteomics, February 1, 2007; 6(2): 294 - 304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T.-H. Cheng and S. N. Cohen Human MDM2 Isoforms Translated Differentially on Constitutive versus p53-Regulated Transcripts Have Distinct Functions in the p53/MDM2 and TSG101/MDM2 Feedback Control Loops Mol. Cell. Biol., January 1, 2007; 27(1): 111 - 119. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Spitzer, S. Schellmann, A. Sabovljevic, M. Shahriari, C. Keshavaiah, N. Bechtold, M. Herzog, S. Muller, F.-G. Hanisch, and M. Hulskamp The Arabidopsis elch mutant reveals functions of an ESCRT component in cytokinesis. Development, December 1, 2006; 133(23): 4679 - 4689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Langelier, U. K. von Schwedler, R. D. Fisher, I. De Domenico, P. L. White, C. P. Hill, J. Kaplan, D. Ward, and W. I. Sundquist Human ESCRT-II Complex and Its Role in Human Immunodeficiency Virus Type 1 Release J. Virol., October 1, 2006; 80(19): 9465 - 9480. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. O. Olabisi, G. M. Mahon, E. V. Kostenko, Z. Liu, H. L. Ozer, and I. P. Whitehead Bcr interacts with components of the endosomal sorting complex required for transport-I and is required for epidermal growth factor receptor turnover. Cancer Res., June 15, 2006; 66(12): 6250 - 6257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Carstens, A. Krempler, A. A. Triplett, M. van Lohuizen, and K.-U. Wagner Cell Cycle Arrest and Cell Death Are Controlled by p53-dependent and p53-independent Mechanisms in Tsg101-deficient Cells J. Biol. Chem., August 20, 2004; 279(34): 35984 - 35994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Stuchell, J. E. Garrus, B. Muller, K. M. Stray, S. Ghaffarian, R. McKinnon, H.-G. Krausslich, S. G. Morham, and W. I. Sundquist The Human Endosomal Sorting Complex Required for Transport (ESCRT-I) and Its Role in HIV-1 Budding J. Biol. Chem., August 20, 2004; 279(34): 36059 - 36071. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Amit, L. Yakir, M. Katz, Y. Zwang, M. D. Marmor, A. Citri, K. Shtiegman, I. Alroy, S. Tuvia, Y. Reiss, et al. Tal, a Tsg101-specific E3 ubiquitin ligase, regulates receptor endocytosis and retrovirus budding Genes & Dev., July 15, 2004; 18(14): 1737 - 1752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Teo, D. B. Veprintsev, and R. L. Williams Structural Insights into Endosomal Sorting Complex Required for Transport (ESCRT-I) Recognition of Ubiquitinated Proteins J. Biol. Chem., July 2, 2004; 279(27): 28689 - 28696. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Burgdorf, P. Leister, and K. H. Scheidtmann TSG101 Interacts with Apoptosis-antagonizing Transcription Factor and Enhances Androgen Receptor-mediated Transcription by Promoting Its Monoubiquitination J. Biol. Chem., April 23, 2004; 279(17): 17524 - 17534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yasuda, M. Nakao, Y. Kawaoka, and H. Shida Nedd4 Regulates Egress of Ebola Virus-Like Particles from Host Cells J. Virol., September 15, 2003; 77(18): 9987 - 9992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Goff, L. S. Ehrlich, S. N. Cohen, and C. A. Carter Tsg101 Control of Human Immunodeficiency Virus Type 1 Gag Trafficking and Release J. Virol., September 1, 2003; 77(17): 9173 - 9182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Pornillos, D. S. Higginson, K. M. Stray, R. D. Fisher, J. E. Garrus, M. Payne, G.-P. He, H. E. Wang, S. G. Morham, and W. I. Sundquist HIV Gag mimics the Tsg101-recruiting activity of the human Hrs protein J. Cell Biol., August 4, 2003; 162(3): 425 - 434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Lu, L. W. Hope, M. Brasch, C. Reinhard, and S. N. Cohen TSG101 interaction with HRS mediates endosomal trafficking and receptor down-regulation PNAS, June 24, 2003; 100(13): 7626 - 7631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Goila-Gaur, D. G. Demirov, J. M. Orenstein, A. Ono, and E. O. Freed Defects in Human Immunodeficiency Virus Budding and Endosomal Sorting Induced by TSG101 Overexpression J. Virol., June 1, 2003; 77(11): 6507 - 6519. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Krempler, M. D. Henry, A. A. Triplett, and K.-U. Wagner Targeted Deletion of the Tsg101 Gene Results in Cell Cycle Arrest at G1/S and p53-independent Cell Death J. Biol. Chem., November 1, 2002; 277(45): 43216 - 43223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Myers and J. F. Allen Tsg101, an Inactive Homologue of Ubiquitin Ligase E2, Interacts Specifically with Human Immunodeficiency Virus Type 2 Gag Polyprotein and Results in Increased Levels of Ubiquitinated Gag J. Virol., October 11, 2002; 76(22): 11226 - 11235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Oh, C. Mammucari, A. Nenci, S. Cabodi, S. N. Cohen, and G. P. Dotto Negative regulation of cell growth and differentiation by TSG101 through association with p21Cip1/WAF1 PNAS, April 16, 2002; 99(8): 5430 - 5435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. VerPlank, F. Bouamr, T. J. LaGrassa, B. Agresta, A. Kikonyogo, J. Leis, and C. A. Carter Tsg101, a homologue of ubiquitin-conjugating (E2) enzymes, binds the L domain in HIV type 1 Pr55Gag PNAS, June 20, 2001; (2001) 131059198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Li, J. Liao, J. Ruland, T. W. Mak, and S. N. Cohen A TSG101/MDM2 regulatory loop modulates MDM2 degradation and MDM2/p53 feedback control PNAS, February 13, 2001; 98(4): 1619 - 1624. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Oh, C. Mammucari, A. Nenci, S. Cabodi, S. N. Cohen, and G. P. Dotto Negative regulation of cell growth and differentiation by TSG101 through association with p21Cip1/WAF1 PNAS, April 16, 2002; 99(8): 5430 - 5435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. VerPlank, F. Bouamr, T. J. LaGrassa, B. Agresta, A. Kikonyogo, J. Leis, and C. A. Carter Tsg101, a homologue of ubiquitin-conjugating (E2) enzymes, binds the L domain in HIV type 1 Pr55Gag PNAS, July 3, 2001; 98(14): 7724 - 7729. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
, short in-frame deletions;
F, Flag tag. The mutations are as follows: SD1-1 has a
deletion of AAs 41–43; SD2-9 has a replacement of AAs 50–52 by Phe;
SD3-17 has a deletion of AAs 193–195; SD4-28 has a replacement of AAs
273–276 by Asp; and SD5–59 has a replacement of AAs 348–351 by Gly.
The deletion sites and fusion junctions involving the COOH-terminal
regions are indicated in Fig. 7
TSG) on induction. The two cell lines were
preinduced for 12 h, pulse-labeled for 1 h, and then chased
in fresh medium. In all these steps, the media were supplemented with 5
µM PA as an inducer. Cells were then collected after the
indicated times and analyzed by immunoprecipitation. Induced expression
of the adventitious TSG101 proteins was monitored by immunoblotting in
the two cell lines immediately before labeling, as shown in the
boxed insert. Antibody against the COOH-terminal peptide,
which detected both adventitious and endogenous full-length TSG101
protein (left) and full-length endogenous TSG101
(right) was used for subsequent immunoprecepitations. The
bars represent relative labeling intensities detected by
phosphor image after the bands were separated on DSD/PAGE gel.