| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Graduate Program in Cancer Biology [G. L.], Department of Physiology [J. A. S.], Department of Biochemistry and Molecular Biology [S. C. B.], and the Barbara Ann Karmanos Cancer Institute [J. A. S., S. C. B.], Wayne State University School of Medicine, Detroit, Michigan 48201
| ABSTRACT |
|---|
|
|
|---|
(ER
) and p53, two important regulatory proteins in breast cancer,
bind to each other. In this report, using the glutathione
S-transferase pull-down methodology, we show the
ligand-independent interaction of ER
with the
NH2-terminal region of p53, a region known to bind the p300
and human double minute-2 (hdm2) regulatory factors.
Furthermore, we have demonstrated that ER
is capable of binding
hdm2 directly. The interaction of ER
and p53 does not
interfere with the binding between p53 and hdm2; rather,
these proteins form a ternary complex. The effect of ER
on the
p53-hdm2 regulatory loop has been examined. Our results
indicate that ER
protects p53 from being deactivated by
hdm2. It is evident from these investigations that the
ligand-independent protection of p53 by ER
is a novel role for this
protein in addition to its classic regulatory function as a
ligand-inducible transcription factor. This study also describes a new
mechanism of cellular regulation of p53 activity. | Introduction |
|---|
|
|
|---|
3
is a ligand-inducible transcription factor that activates the
transcription of genes that contain an estrogen response element in
their promoter region. Genes that have been shown to be estrogen
responsive include pS2 (1)
, cathepsin
D (1)
, vitellogenin (2)
,
c-fos (3
, 4)
, c-jun
(4)
, bcl-2 (5)
, adenosine
deaminase (6)
, transforming growth
factor-
(7)
, and tissue plasminogen
activator (8)
. Uterine tissue displays an additional
tissue-specific function of ER
that does not require a direct
interaction between receptor and DNA (9)
. Rather, ER
activates the regulatory factor, activator protein-1, by direct
protein/protein interaction of the receptor complexed with agonist or
antagonist. Generally, ER
mediates the mitogenic effect of
E2 and is believed to be important for breast tumor
development. Indeed, when ER
activity is blocked by the antagonist
tamoxifen, certain ER
-positive (ER
+) cancer cells undergo
apoptosis (10
, 11)
. The clinical application of this
mechanism of antagonism has become the most widely used therapy for
hormone-dependent breast cancer patients (12)
.
However, the application of this general understanding to ER-negative
(ER-) cells has proven to be confounding. When ER
was overexpressed
in ER- CHO cells (13)
and human cervical cancer HeLa
cells (14)
, E2 did not stimulate cell growth.
On the contrary, this hormone brought about growth inhibition and/or
cell death. Surprisingly, tamoxifen, which usually blocks ER
activity, killed these cells, as did E2. Likewise, the ER-
immortal MCF-10A breast epithelial cells (15)
and the
hormone-independent MDA-MB-231 breast cancer cells (16)
were both growth inhibited when stably transfected with ER
.
The recent discovery of a physical interaction between p53 and ER
(17)
and other steroid receptors (18
, 19)
suggested that the ER
-p53 complex might possess a function in
cellular biology. To this end, p53 has been shown to take part in
interactions with various other essential proteins such as p300
(20)
, mdm2 (21
, 22)
, SV40TAg
(22)
, ARF-14 (23)
, BRCA1 (24)
,
and BRCA2 (25)
. Here, we report a further examination of
the ER
-p53 interaction and describe a novel role for ER
in the
protection of p53 from deactivation by the hdm2.
| Materials and Methods |
|---|
|
|
|---|
(HEGO) was a gift from Dr. Pierre Chambon (Institut de
Genetique et de Biologie Moleculaire et Cellulaire, CNRS/
INSERM/ULP/College de France, BP 163, CU de Strasbourg, France).
pBS-mdm2 was a gift from Dr. Donna George (University of Pennsylvania
School of Medicine, Philadelphia, PA). The hdm2 cDNA
insert of this plasmid was used to generate the pCR3.1-hdm2
(which has a CMV and a T7 promoter and is suitable for both eukaryotic
expression and in vitro transcription/translation). pWWP-Luc
(26)
and pC53-SN3 (containing the p53wt cDNA insert) were
gifts from Dr. Bert Vogelstein (The Johns Hopkins Oncology Center,
Baltimore, MD 21231). The human p53wt insert of this plasmid was used
to generate the pGST-p53wt(aa1393), pGST-p53-N(aa1295),
pGST-p53-M(aa103295), and pGST-p53-C(aa103393) plasmids by cloning
the full-length or truncated forms of the p53 cDNA into the pGEX-6p-x
vector (Pharmacia Biotech, Piscataway, NJ).
Primers and PCR.
The following primers were synthesized by Integrated DNA Technology,
Inc. (Coralville, IN) and were used in PCR to synthesize DNA fragments
for fusion proteins. P53_C_EcoRI, TGAATTCAGTCTGAGTCAGGCCCT (note: p53
aa393 reverse); p53_N_BamHI, TAGGATCCATGGAGGAGCCGCAGT (note: p53 aa1
forward); P53MR, AAACTCGAGGCTCCCCTTTCTTGCGG (note: p53 aa290 reverse);
p53MF, TTGGATCCTACCAGGGCAGCTACGGT (note: p53 aa100 forward); ER-5'end,
TATAGGGCGAATTCGGCCACGGACCAT (note: ER
5' immediately upstream of ATG
codon plus the EcoRI linker); and hER_C_XhoI,
ATACTCGAGCTCTCAGACTGTGGCAGGGAA (note: ER
3' end plus the
XhoI linker).
The Expland High Fidelity PCR kit (Boehringer Mannheim) was used for PCR (conditions: 95°C, 15 s; 61°C, 25 s followed by 72°C, 1 min and 45 s for 32 cycles).
In Vitro Translation and GST Pull-Down Assays.
[35S]Met-labeled ER
and hdm2 proteins were made by
coupled transcription/translation (TNT T7 Quick Coupled
Transcription-Translation kits; Promega, Madison, WI). The pSG5-hER
(HEGO) and the pCR3.1-hdm2 (generated by recloning hdm2 cDNA into the
pCR3.1 vector) plasmid DNAs were used as templates.
The GST-p53wt(amino acids 1393), GST-p53-N(amino acids 1295), GST-p53-M(amino acids 103295), and GST-p53-C(amino acids 103393) fusion proteins were prepared according to the protocols that accompanied kits purchased from Pharmacia Biotech (Piscataway, NJ). Briefly, BL-21(DE3)pLysE cells carrying the fusion protein plasmids were induced for 1.5 h by 0.2 mM isopropyl-1-thio-ß-D-galactopyranoside, lysed, and analyzed for GST activity by the 1-chloro-2,4-dinitro-benzene assay (Pharmacia Biotech). Twenty µg of Sepharose 4B-GSH conjugated fusion protein were allowed to incubate with 5 µl of in vitro translated protein in 500 µl of HEPES buffer [50 mM KCl, 20 mM HEPES (pH 7.9), 2 mM EDTA, 0.1% NP40, 5% glycerol, 0.5% nonfat dry milk, and 5 mM DTT] at 4°C overnight or 37°C for 1 h. Unbound proteins were removed with four washes of 500 µl of HEPES buffer. Bound proteins were eluted by boiling in 30 µl of 1x SDS loading buffer and resolved by SDS-PAGE. The gels were then fixed for 30 min in the protein fixing solution, equilibrated in Amplify fluorographic reagent (Amersham Life Science, Inc., Arlington Heights, IL) for 20 min, dried, and visualized by autoradiography.
Cell Maintenance, Transfection, and Luciferase Assays.
HeLa cells were maintained in DMEM/F-12 media supplemented with 10%
fetal calf serum plus 0.5% gentamicin and subcultured once per week.
For transfections, the cells were passaged into growth medium
containing heat-inactivated, dextran-coated, charcoal-stripped serum
(8)
. Transient transfections were performed using the
Superfect reagent (Qiagen, Inc., Chatsworth, CA) according to the
manufacturers instructions. HeLa cells (5070% confluent) were
cotransfected overnight with 2 µg of pWWP-Luc and 1.0 µg of
pCR3.1-hdm2, 1.0 µg of pAlt-p53, and 0.25 µg of pCMV5-hER
as
indicated. Empty expression vectors (pCR3.1 and pCMV5) were used to
reach a final DNA concentration of 4.25 µg in each sample (1.5 µg
of pCHO110; ß-galactosidase expression plasmid was added as internal
control). The transfected cells were then incubated with or without
ligands for 24 h prior to harvesting. Lysates were normalized for
protein concentration or ß-galactosidase activity and assayed for
luciferase activity, using the TD 20/20 Luminometer (Turner Designs,
Sunnyvale, CA) for quantification. The ß-galactosidase activity and
the luciferase activity were assayed using kits provided by the Promega
Corp. (Madison, WI).
DNA Recombination and Cloning.
The vector DNA and the insert fragment (1:3 molar ratio; 100 ng), which
has been digested by appropriate enzymes, was added to T4 DNA ligase in
10 µl of buffered solution. The ligation reaction was allowed to
proceed at 16°C overnight. Ligates were then used to transform 100
µl of competent JM109 cells for 30 min on ice. The transformed cells
underwent heat shock for 40 s at 42°C. Super Optimal
Catabolite medium was added, and the cells were incubated at
37°C for 1 h with shaking, after which the cells were plated
onto agar with the selective antibiotic. After 18 h, the colonies
were isolated and inoculated into tubes containing 3 ml of liquid broth
containing the selective antibiotic. Thereafter, plasmid DNAs were
isolated, and restriction digestion analysis was carried out to
identify the correct clones.
Western Blotting.
MCF-10A and 139B6 cells were grown in medium as reported
previously (15)
. Cells (7080% confluency) were removed
from flasks with a rubber policeman and washed by centrifugation three
times with cold PBS, then lysed in RIPA buffer (1x PBS, 1% NP40,
0.5% sodium deoxycholate, 0.1% SDS containing an additional 100 µl
of 10 mg/ml PMSF, and 1 tablet of the complete mini protease
inhibitors; Boehringer Mannheim/Roche Molecular Biochemicals,
Indianapolis, IN). Cellular lysates were measured for their protein
concentrations by the BCA Protein Assay kit (Pierce, Rockford, IL), and
aliquots were added to lanes on SDS-PAGE. After electrophoresis, the
gels were sandwiched, and samples were transferred to a nitrocellulose
membrane. After blocking the membrane with 5% dry milk in PBS, the
first antibody (1:2500 dilution) against the target protein was allowed
to interact, followed by the secondary antibody (1:3000 dilution).
Samples were then visualized by standard ECL method (Amersham Life
Science, Inc., Arlington Heights, IL). The antibodies used were: H222,
rat monoclonal antibody against human ER
, supplied by Abbott
Laboratories (Abbott Park, IL); actin (I-19), goat polyclonal antibody
against human actin; p53(Bp53-12), mouse monoclonal antibody against
human p53 (both wt and mutant); HDM2(SMP14), mouse monoclonal antibody
against hdm2; HRP-conjugated goat antirat IgG; HRP-conjugated goat
antirabbit IgG; HRP-conjugated goat antimouse IgG; and HRP-conjugated
donkey antigoat IgG (all purchased from Santa Cruz Biotechnology, Inc.,
Santa Cruz, CA).
| Results |
|---|
|
|
|---|
Binds to the NH2-Terminal of p53.
and p53 (17)
was confirmed
in a GST pull-down assay in which in vitro translated ER
was incubated with Sephrose 4B-GSH-conjugated GST-p53wt (Fig. 1, a and b
to p53 is not affected by the presence in the
incubation of the ER
agonists, E2 and genistein, or
antagonists, 4-hydroxytamoxifen and ICI164,384.
|
are shown in Fig. 1c
, an equal amount of the truncated fusion
proteins (determined by the 1-chloro-2,4-dinitro-benzene assay
for GST activity) and E2, 4- hydroxytamoxifen, or no
ligand. Binding occurred when ER
was incubated with a fusion protein
containing the NH2-terminal 102 amino acids of p53 (Fig. 1, c and d
Studies have shown that the p53 NH2-terminal is the binding
region for both p300 (20)
and hdm2 (21)
. The
fact that p300 can bind to both ER
and p53 brings about two possible
scenarios: (a) p300 might bring ER
and p53 together; and
(b) ER
may compete with p53 for binding to p300. Results
from experiments in this laboratory (27)
, which
demonstrated that p53 does not compete with p300 in the suppression of
ER
activities, suggest that p300 does not play a role in the
ER
-p53 interaction.
ER
, p53, and hdm2 Form a Ternary Complex and ER
Can Bind to
hdm2 Directly.
Interestingly, when increasing amounts of
[35S]Met-labeled ER
(0.510 µl, with
10-7 M 4-hydroxytamoxifen) were added to
the tubes containing hdm2 and the GST-p53 fusion proteins, there was a
3.3-fold rise in the amount of hdm2 being pulled down by the
GST-p53-N (above that pulled-down in the absence of ER
; Fig. 2a
). The amount of ER
in this complex increased accordingly. A similar
observation was made when the GST-hdm2 fusion protein was used to
pull-down in vitro translated ER
and p53 proteins. In
this case, increasing input of ER
did not reduce the amount of p53
pulled-down by the GST-hdm2 fusion protein (Fig. 2b
). These
data suggest that ER
, p53, and hdm2 form a ternary
complex.
|
and
hdm2. In these experiments, GST fusion proteins of the
full-length and a truncated ER
were incubated with in
vitro translated [35S]Met-labeled hdm2 protein in
the absence or presence of E2 (Fig. 3
-GST fusion proteins were capable of direct
physical binding to hdm2 in the presence and in the absence
of ligand.
|
Protects p53 from Being Deactivated by hdm2.
, p53, and
hdm2 suggests a role for the receptor in the
p53-hdm2 regulatory loop (28)
. Possibly ER
influences the ability of hdm2 to down-regulate the
transactivity of p53 (28)
. To test this hypothesis, HeLa
cells were transiently cotransfected with the p53 responsive reporter
pWWP-Luc (26)
and expression plasmids for human
hdm2 (pCR3.1-hdm2), p53 (pAlt-p53), and/or ER
(pCMV5-hER
). As shown previously (26)
, the
luciferase activity increased when p53 was cotransfected with the
pWWP-Luc plasmid (Fig. 4
restored the p53-driven
WWP-Luc activity (Fig. 4
had no effect on the activity of WWP-Luc. In a
separate experiment, the restoration of p53-stimulated luciferase
activity was shown to be dependent on the amount of pCMV5-hER
transfected (range, 0.050.4 µg; data not shown). The
down-regulation of p53 by hdm2 was completely reversed by a
transfected level of ER
plasmid between 0.20 and 0.40 µg. These
results suggest that ER
protects p53 from being deactivated by
hdm2.
|
Leads to Elevated p53 and hdm2 Protein Levels.
in cells would be predicted to protect p53 from
hdm2-targeted degradation and lead to an increase in the
level of p53. According to this line of reasoning, a cellular increase
in p53 should enhance the expression of hdm2. The MCF-10A
human breast epithelial cell line normally does not contain ER
(15)
. Transfection of ER
into these cells created an
ER+ stable cell line, 139B6 (15)
. A Western blot of the
proteins in these transfected cells demonstrated that the presence of
ER
is accompanied by increasing levels of both p53 and hdm2 proteins
above those detected in the parental ER- cell line (Fig. 5
protection of the p53 that acts to lengthen the
G1 phase of the cell cycle.
|
| Discussion |
|---|
|
|
|---|
in this essential
regulatory pathway (Fig. 6
|
is
capable of binding to the NH2 terminus of the p53 protein
(Fig. 1
positively influenced the binding of hdm2
and p53 (Fig. 2
to protect p53 from functional
deactivation by hdm2, as demonstrated in a Luc reporter
assay (Fig. 4
, p53,
and hdm2 may have an important functional role. Our findings
that p53 (and thus hdm2) levels are increased in
ER
-transfected immortalized breast epithelial cells, compared with
those of the parental cell line, provide additional support for this
conclusion (Fig. 5
The relationship between ER
and hdm2 has been observed
previously. Sheikh et al. (30)
reported that
ER+ breast cancer cells have significantly higher (up to 30-fold)
hdm2 mRNA levels than those of ER- breast cancer cells. In
addition, MDA-MB-231 cells, which have been stably transfected with the
ER
cDNA, produced a 3-fold increase in the hdm2 mRNA
levels (30)
. In the absence of an ERE in the promoter of
the hdm2 gene, it appears that the observed stimulatory
effect of ER
on the hdm2 is carried out via the elevated
p53 transcriptional activity (hdm2 is positively regulated
by p53; Figs. 5
and 6
).
Other than p53, three important regulatory proteins [p300
(31)
, p19ARF (32)
and Rb (33)
]
have been reported to bind to mdm2. All of these proteins compromised
the ability of mdm2 to degrade p53. Furthermore, the protective effects
of p19ARF had been shown to occur via its ability to inhibit the ligase
activity of hdm2. To this end, our results have demonstrated
that ER
also protects p53 from being deactivated by hdm2
(Fig. 4
). ER
is capable of binding hdm2 directly (Fig. 3
), as well as elevating levels of p53 and hdm2 in ER
stably transfected MCF10A cells (Fig. 5
). This suggests that ER
might suppress the ubiquitin ligase activity of hdm2.
In normal breast tissues under nonlactating conditions, ER
is
present only in
7% of the epithelial cells (34)
. This
level may increase or decrease in breast tumor tissue. Often, ER
expression is lost during the progression of breast cancer.
Furthermore, there is an inverse correlation between ER
expression
and malignant progression in mammary neoplasia (34)
.
Because ER
expression is up-regulated in tissues that are rapidly
dividing, such as the uterine endometrium during the proliferative
phase, it is conceivable that the accompanying elevated p53 activity
plays a role in the prevention of rapidly growing tissues from becoming
transformed.
Other investigators (13
, 14
, 16)
have observed increased
doubling times after they introduced ER
into ER- cells. This role
played by ER
is very similar to the role of the p14ARF tumor
suppressor (23)
, which binds to both p53 and
hdm2 and protects p53 from being down-regulated by
hdm2. Over the past decade, the cytotoxicity resulting from
ER
overexpression (13)
has been observed repeatedly
(14, 15, 16
, 30)
. Nevertheless, this observation remains
unexplained. In one classic example, Kushner et al.
(13)
overexpressed ER
in CHO cells and found that even
trace amounts of E2 (or tamoxifen) were lethal to these
stably transfected cells. On the basis of the present information, the
enhanced ER
-mediated protection of the wtp53 may have resulted in
the death of these cells. Just as the double knock-out of the
mdm2 gene is lethal to the embryonic development
(35)
, overprotection of p53 from hdm2 deactivation can
lead to growth retardation or even lethality. It appears that elevated
p53 is responsible for the increased hdm2 levels, and it
would follow that the elevated protection of p53 may explain the
toxicity that is associated with ER
overexpression.
These investigations have resulted in the novel finding that ER
functions to protect p53 from hdm2-induced deactivation.
This role of the unliganded receptor is quite unlike the classic
function of ER
which, once bound to E2, regulates target
genes containing the specific response element in their promoters. Such
genes take part in mitogenesis as well as differentiation
(1, 2, 3, 4, 5, 6, 7, 8)
.
| Acknowledgments |
|---|
| FOOTNOTES |
|---|
1 These investigations were supported in part by
NIH Grants DK 54837 and CA 68655. ![]()
2 To whom requests for reprints should be
addressed, at Department of Biochemistry and Molecular Biology, Wayne
State University School of Medicine, 540 Canfield, Detroit, MI 48202.
Phone: (313) 577-1283; Fax: (313) 577-4112. ![]()
3 The abbreviations used are: ER
, estrogen
receptor
; GST, glutathione S-transferase; hdm2,
human double minute-2 oncogene; E2, 17ß-estradiol;
wt, wild type; HRP, horseradish peroxidase; Luc, luciferase; CMV,
cytomegalovirus; CHO, Chinese hamster ovary; GSH, reduced
glutathione. ![]()
Received 1/ 6/00. Accepted 2/17/00.
| REFERENCES |
|---|
|
|
|---|
is mediated by an estrogen response element composed of two imperfect palindromes. J. Steroid Biochem. Mol. Biol., 59: 261-269, 1996.[Medline]
B and AP-1 activity in a cell-specific manner. J. Steroid Biochem. Mol. Biol., 67: 79-88, 1998.[Medline]
This article has been cited by other articles:
![]() |
A. Sayeed, S. D. Konduri, W. Liu, S. Bansal, F. Li, and G. M. Das Estrogen Receptor {alpha} Inhibits p53-Mediated Transcriptional Repression: Implications for the Regulation of Apoptosis Cancer Res., August 15, 2007; 67(16): 7746 - 7755. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Duong, N. Boulle, S. Daujat, J. Chauvet, S. Bonnet, H. Neel, and V. Cavailles Differential Regulation of Estrogen Receptor {alpha} Turnover and Transactivation by Mdm2 and Stress-Inducing Agents Cancer Res., June 1, 2007; 67(11): 5513 - 5521. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bionaz and J. J. Loor Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle Physiol Genomics, May 11, 2007; 29(3): 312 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Menendez, A. Inga, J. Snipe, O. Krysiak, G. Schonfelder, and M. A. Resnick A Single-Nucleotide Polymorphism in a Half-Binding Site Creates p53 and Estrogen Receptor Control of Vascular Endothelial Growth Factor Receptor 1 Mol. Cell. Biol., April 1, 2007; 27(7): 2590 - 2600. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C Fleisch, C. A Maxwell, and M.-H. Barcellos-Hoff The pleiotropic roles of transforming growth factor beta in homeostasis and carcinogenesis of endocrine organs. Endocr. Relat. Cancer, June 1, 2006; 13(2): 379 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, S. D. Konduri, S. Bansal, B. K. Nayak, S. A. Rajasekaran, S. M. Karuppayil, A. K. Rajasekaran, and G. M. Das Estrogen Receptor-{alpha} Binds p53 Tumor Suppressor Protein Directly and Represses Its Function J. Biol. Chem., April 14, 2006; 281(15): 9837 - 9840. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Kinyamu and T. K. Archer Estrogen Receptor-Dependent Proteasomal Degradation of the Glucocorticoid Receptor Is Coupled to an Increase in Mdm2 Protein Expression Mol. Cell. Biol., August 15, 2003; 23(16): 5867 - 5881. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Verschraegen, W. Hu, Y. Du, J. Mendoza, J. Early, M. Deavers, R. S. Freedman, R. C. Bast Jr., A. P. Kudelka, J. J. Kavanagh, et al. Establishment and Characterization of Cancer Cell Cultures and Xenografts Derived from Primary or Metastatic Mullerian Cancers Clin. Cancer Res., February 1, 2003; 9(2): 845 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Qin, T. Nguyen, J. Stewart, I. Samudio, R. Burghardt, and S. Safe Estrogen Up-Regulation of p53 Gene Expression in MCF-7 Breast Cancer Cells Is Mediated by Calmodulin Kinase IV-Dependent Activation of a Nuclear Factor {kappa}B/CCAAT-Binding Transcription Factor-1 Complex Mol. Endocrinol., August 1, 2002; 16(8): 1793 - 1809. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vanzulli, A. Efeyan, F. Benavides, L. A. Helguero, G. Peters, J. Shen, C. J. Conti, C. Lanari, and A. Molinolo p21, p27 and p53 in estrogen and antiprogestin-induced tumor regression of experimental mouse mammary ductal carcinomas Carcinogenesis, May 1, 2002; 23(5): 749 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Conway, S. N. Edmiston, L. Cui, S. S. Drouin, J. Pang, M. He, C.-K. Tse, J. Geradts, L. Dressler, E. T. Liu, et al. Prevalence and Spectrum of p53 Mutations Associated with Smoking in Breast Cancer Cancer Res., April 1, 2002; 62(7): 1987 - 1995. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kato, S. Horiuchi, A. Takahashi, Y. Ueoka, T. Arima, T. Matsuda, H. Kato, J.-i. Nishida, Y. Nakabeppu, and N. Wake Contribution of Estrogen Receptor alpha to Oncogenic K-Ras-mediated NIH3T3 Cell Transformation and Its Implication for Escape from Senescence by Modulating the p53 Pathway J. Biol. Chem., March 22, 2002; 277(13): 11217 - 11224. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sengupta and B. Wasylyk Ligand-dependent interaction of the glucocorticoid receptor with p53 enhances their degradation by Hdm2 Genes & Dev., September 15, 2001; 15(18): 2367 - 2380. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Isaacs, S.'i. Saito, and L. M. Neckers Requirement for HDM2 Activity in the Rapid Degradation of p53 in Neuroblastoma J. Biol. Chem., May 18, 2001; 276(21): 18497 - 18506. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |