Cancer Research Grants  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, G.
Right arrow Articles by Brooks, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, G.
Right arrow Articles by Brooks, S. C.
[Cancer Research 60, 1810-1814, April 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Estrogen Receptor Protects p53 from Deactivation by Human Double Minute-21

Guozhen Liu, Janice A. Schwartz and Sam C. Brooks2

Graduate Program in Cancer Biology [G. L.], Department of Physiology [J. A. S.], Department of Biochemistry and Molecular Biology [S. C. B.], and the Barbara Ann Karmanos Cancer Institute [J. A. S., S. C. B.], Wayne State University School of Medicine, Detroit, Michigan 48201


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We and others have demonstrated that estrogen receptor {alpha} (ER{alpha}) and p53, two important regulatory proteins in breast cancer, bind to each other. In this report, using the glutathione S-transferase pull-down methodology, we show the ligand-independent interaction of ER{alpha} with the NH2-terminal region of p53, a region known to bind the p300 and human double minute-2 (hdm2) regulatory factors. Furthermore, we have demonstrated that ER{alpha} is capable of binding hdm2 directly. The interaction of ER{alpha} and p53 does not interfere with the binding between p53 and hdm2; rather, these proteins form a ternary complex. The effect of ER{alpha} on the p53-hdm2 regulatory loop has been examined. Our results indicate that ER{alpha} protects p53 from being deactivated by hdm2. It is evident from these investigations that the ligand-independent protection of p53 by ER{alpha} is a novel role for this protein in addition to its classic regulatory function as a ligand-inducible transcription factor. This study also describes a new mechanism of cellular regulation of p53 activity.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
ER{alpha}3 is a ligand-inducible transcription factor that activates the transcription of genes that contain an estrogen response element in their promoter region. Genes that have been shown to be estrogen responsive include pS2 (1) , cathepsin D (1) , vitellogenin (2) , c-fos (3 , 4) , c-jun (4) , bcl-2 (5) , adenosine deaminase (6) , transforming growth factor-{alpha} (7) , and tissue plasminogen activator (8) . Uterine tissue displays an additional tissue-specific function of ER{alpha} that does not require a direct interaction between receptor and DNA (9) . Rather, ER{alpha} activates the regulatory factor, activator protein-1, by direct protein/protein interaction of the receptor complexed with agonist or antagonist. Generally, ER{alpha} mediates the mitogenic effect of E2 and is believed to be important for breast tumor development. Indeed, when ER{alpha} activity is blocked by the antagonist tamoxifen, certain ER{alpha}-positive (ER{alpha}+) cancer cells undergo apoptosis (10 , 11) . The clinical application of this mechanism of antagonism has become the most widely used therapy for hormone-dependent breast cancer patients (12) .

However, the application of this general understanding to ER-negative (ER-) cells has proven to be confounding. When ER{alpha} was overexpressed in ER- CHO cells (13) and human cervical cancer HeLa cells (14) , E2 did not stimulate cell growth. On the contrary, this hormone brought about growth inhibition and/or cell death. Surprisingly, tamoxifen, which usually blocks ER{alpha} activity, killed these cells, as did E2. Likewise, the ER- immortal MCF-10A breast epithelial cells (15) and the hormone-independent MDA-MB-231 breast cancer cells (16) were both growth inhibited when stably transfected with ER{alpha}.

The recent discovery of a physical interaction between p53 and ER{alpha} (17) and other steroid receptors (18 , 19) suggested that the ER{alpha}-p53 complex might possess a function in cellular biology. To this end, p53 has been shown to take part in interactions with various other essential proteins such as p300 (20) , mdm2 (21 , 22) , SV40TAg (22) , ARF-14 (23) , BRCA1 (24) , and BRCA2 (25) . Here, we report a further examination of the ER{alpha}-p53 interaction and describe a novel role for ER{alpha} in the protection of p53 from deactivation by the hdm2.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Plasmids.
pSG5-hER{alpha} (HEGO) was a gift from Dr. Pierre Chambon (Institut de Genetique et de Biologie Moleculaire et Cellulaire, CNRS/ INSERM/ULP/College de France, BP 163, CU de Strasbourg, France). pBS-mdm2 was a gift from Dr. Donna George (University of Pennsylvania School of Medicine, Philadelphia, PA). The hdm2 cDNA insert of this plasmid was used to generate the pCR3.1-hdm2 (which has a CMV and a T7 promoter and is suitable for both eukaryotic expression and in vitro transcription/translation). pWWP-Luc (26) and pC53-SN3 (containing the p53wt cDNA insert) were gifts from Dr. Bert Vogelstein (The Johns Hopkins Oncology Center, Baltimore, MD 21231). The human p53wt insert of this plasmid was used to generate the pGST-p53wt(aa1–393), pGST-p53-N(aa1–295), pGST-p53-M(aa103–295), and pGST-p53-C(aa103–393) plasmids by cloning the full-length or truncated forms of the p53 cDNA into the pGEX-6p-x vector (Pharmacia Biotech, Piscataway, NJ).

Primers and PCR.
The following primers were synthesized by Integrated DNA Technology, Inc. (Coralville, IN) and were used in PCR to synthesize DNA fragments for fusion proteins. P53_C_EcoRI, TGAATTCAGTCTGAGTCAGGCCCT (note: p53 aa393 reverse); p53_N_BamHI, TAGGATCCATGGAGGAGCCGCAGT (note: p53 aa1 forward); P53MR, AAACTCGAGGCTCCCCTTTCTTGCGG (note: p53 aa290 reverse); p53MF, TTGGATCCTACCAGGGCAGCTACGGT (note: p53 aa100 forward); ER-5'end, TATAGGGCGAATTCGGCCACGGACCAT (note: ER{alpha} 5' immediately upstream of ATG codon plus the EcoRI linker); and hER_C_XhoI, ATACTCGAGCTCTCAGACTGTGGCAGGGAA (note: ER{alpha} 3' end plus the XhoI linker).

The Expland High Fidelity PCR kit (Boehringer Mannheim) was used for PCR (conditions: 95°C, 15 s; 61°C, 25 s followed by 72°C, 1 min and 45 s for 32 cycles).

In Vitro Translation and GST Pull-Down Assays.
[35S]Met-labeled ER{alpha} and hdm2 proteins were made by coupled transcription/translation (TNT T7 Quick Coupled Transcription-Translation kits; Promega, Madison, WI). The pSG5-hER{alpha} (HEGO) and the pCR3.1-hdm2 (generated by recloning hdm2 cDNA into the pCR3.1 vector) plasmid DNAs were used as templates.

The GST-p53wt(amino acids 1–393), GST-p53-N(amino acids 1–295), GST-p53-M(amino acids 103–295), and GST-p53-C(amino acids 103–393) fusion proteins were prepared according to the protocols that accompanied kits purchased from Pharmacia Biotech (Piscataway, NJ). Briefly, BL-21(DE3)pLysE cells carrying the fusion protein plasmids were induced for 1.5 h by 0.2 mM isopropyl-1-thio-ß-D-galactopyranoside, lysed, and analyzed for GST activity by the 1-chloro-2,4-dinitro-benzene assay (Pharmacia Biotech). Twenty µg of Sepharose 4B-GSH conjugated fusion protein were allowed to incubate with 5 µl of in vitro translated protein in 500 µl of HEPES buffer [50 mM KCl, 20 mM HEPES (pH 7.9), 2 mM EDTA, 0.1% NP40, 5% glycerol, 0.5% nonfat dry milk, and 5 mM DTT] at 4°C overnight or 37°C for 1 h. Unbound proteins were removed with four washes of 500 µl of HEPES buffer. Bound proteins were eluted by boiling in 30 µl of 1x SDS loading buffer and resolved by SDS-PAGE. The gels were then fixed for 30 min in the protein fixing solution, equilibrated in Amplify fluorographic reagent (Amersham Life Science, Inc., Arlington Heights, IL) for 20 min, dried, and visualized by autoradiography.

Cell Maintenance, Transfection, and Luciferase Assays.
HeLa cells were maintained in DMEM/F-12 media supplemented with 10% fetal calf serum plus 0.5% gentamicin and subcultured once per week. For transfections, the cells were passaged into growth medium containing heat-inactivated, dextran-coated, charcoal-stripped serum (8) . Transient transfections were performed using the Superfect reagent (Qiagen, Inc., Chatsworth, CA) according to the manufacturer’s instructions. HeLa cells (50–70% confluent) were cotransfected overnight with 2 µg of pWWP-Luc and 1.0 µg of pCR3.1-hdm2, 1.0 µg of pAlt-p53, and 0.25 µg of pCMV5-hER{alpha} as indicated. Empty expression vectors (pCR3.1 and pCMV5) were used to reach a final DNA concentration of 4.25 µg in each sample (1.5 µg of pCHO110; ß-galactosidase expression plasmid was added as internal control). The transfected cells were then incubated with or without ligands for 24 h prior to harvesting. Lysates were normalized for protein concentration or ß-galactosidase activity and assayed for luciferase activity, using the TD 20/20 Luminometer (Turner Designs, Sunnyvale, CA) for quantification. The ß-galactosidase activity and the luciferase activity were assayed using kits provided by the Promega Corp. (Madison, WI).

DNA Recombination and Cloning.
The vector DNA and the insert fragment (1:3 molar ratio; 100 ng), which has been digested by appropriate enzymes, was added to T4 DNA ligase in 10 µl of buffered solution. The ligation reaction was allowed to proceed at 16°C overnight. Ligates were then used to transform 100 µl of competent JM109 cells for 30 min on ice. The transformed cells underwent heat shock for 40 s at 42°C. Super Optimal Catabolite medium was added, and the cells were incubated at 37°C for 1 h with shaking, after which the cells were plated onto agar with the selective antibiotic. After 18 h, the colonies were isolated and inoculated into tubes containing 3 ml of liquid broth containing the selective antibiotic. Thereafter, plasmid DNAs were isolated, and restriction digestion analysis was carried out to identify the correct clones.

Western Blotting.
MCF-10A and 139B6 cells were grown in medium as reported previously (15) . Cells (70–80% confluency) were removed from flasks with a rubber policeman and washed by centrifugation three times with cold PBS, then lysed in RIPA buffer (1x PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS containing an additional 100 µl of 10 mg/ml PMSF, and 1 tablet of the complete mini protease inhibitors; Boehringer Mannheim/Roche Molecular Biochemicals, Indianapolis, IN). Cellular lysates were measured for their protein concentrations by the BCA Protein Assay kit (Pierce, Rockford, IL), and aliquots were added to lanes on SDS-PAGE. After electrophoresis, the gels were sandwiched, and samples were transferred to a nitrocellulose membrane. After blocking the membrane with 5% dry milk in PBS, the first antibody (1:2500 dilution) against the target protein was allowed to interact, followed by the secondary antibody (1:3000 dilution). Samples were then visualized by standard ECL method (Amersham Life Science, Inc., Arlington Heights, IL). The antibodies used were: H222, rat monoclonal antibody against human ER{alpha}, supplied by Abbott Laboratories (Abbott Park, IL); actin (I-19), goat polyclonal antibody against human actin; p53(Bp53-12), mouse monoclonal antibody against human p53 (both wt and mutant); HDM2(SMP14), mouse monoclonal antibody against hdm2; HRP-conjugated goat antirat IgG; HRP-conjugated goat antirabbit IgG; HRP-conjugated goat antimouse IgG; and HRP-conjugated donkey antigoat IgG (all purchased from Santa Cruz Biotechnology, Inc., Santa Cruz, CA).


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
ER{alpha} Binds to the NH2-Terminal of p53.
The interaction between ER{alpha} and p53 (17) was confirmed in a GST pull-down assay in which in vitro translated ER{alpha} was incubated with Sephrose 4B-GSH-conjugated GST-p53wt (Fig. 1, a and bCitation ). The binding of ER{alpha} to p53 is not affected by the presence in the incubation of the ER{alpha} agonists, E2 and genistein, or antagonists, 4-hydroxytamoxifen and ICI164,384.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. ER{alpha} binds to the wt p53 protein with or without various ligands. a, in vitro translated ER{alpha} (2 µl/sample; 70,000 cpm) was allowed to interact with the GST-p53wt fusion protein in the presence of 10-7 M ligand as indicated. Lane 1, GST alone; all the other lanes contained GST-p53wt (20 µg) and the indicated ligand. Shadows below the major bands (Mr 66,000) are incompletely translated ER{alpha} proteins. b, the bands were scanned by the STORM 840 (Molecular Dynamic System, Sunnyvale, CA; linear to 5 logs). The data were processed and quantitated with a Windows NT work station using the ImageQuantNT software. Results shown are typical of three experiments. These data are similar to those obtained when GST-ER{alpha} was used to pull-down p53 (data not shown). c, in vitro translated [35S]Met-labeled ER{alpha} protein (70,000 cpm/tube) was allowed to interact with an equal amount of truncated fusion proteins (measured by GST activity): GST-p53-N, GST-p53-M, and GST-p53-C. Ligands were added (10-7 M) as indicated. Bound proteins (pulled down by the Sepharose 4B-GSH-GST-p53-N, M, or C complex) were resolved by SDS-PAGE and visualized by autoradiography.

 
Data from experiments designed to determine the domains on p53 that bind with ER{alpha} are shown in Fig. 1cCitation . Three truncated GST-p53 fusion proteins were constructed, each composed of specific functional domains of this regulatory protein. GST-p53-N contained the NH2-terminal 295 amino acids, which included the NH2-terminal transactivation domain and the sequence-specific DNA binding domain. GST-p53-M was made up of amino acids 103–295, which encompassed the sequence-specific DNA binding domain, and GST-p53-C consisted of the amino acids 103–393, which encompassed the sequence-specific DNA binding domain and the COOH-terminal regulatory domain. Each incubation contained the same amount of radioactive ER{alpha}, an equal amount of the truncated fusion proteins (determined by the 1-chloro-2,4-dinitro-benzene assay for GST activity) and E2, 4- hydroxytamoxifen, or no ligand. Binding occurred when ER{alpha} was incubated with a fusion protein containing the NH2-terminal 102 amino acids of p53 (Fig. 1, c and dCitation ). Apparently, the protein-protein interaction involved some of the residues beyond amino acid 103, because GST-p53-M and GST-p53-C displayed a minor interaction with the receptor. Ligands had no effect on the binding.

Studies have shown that the p53 NH2-terminal is the binding region for both p300 (20) and hdm2 (21) . The fact that p300 can bind to both ER{alpha} and p53 brings about two possible scenarios: (a) p300 might bring ER{alpha} and p53 together; and (b) ER{alpha} may compete with p53 for binding to p300. Results from experiments in this laboratory (27) , which demonstrated that p53 does not compete with p300 in the suppression of ER{alpha} activities, suggest that p300 does not play a role in the ER{alpha}-p53 interaction.

ER{alpha}, p53, and hdm2 Form a Ternary Complex and ER{alpha} Can Bind to hdm2 Directly.
Interestingly, when increasing amounts of [35S]Met-labeled ER{alpha} (0.5–10 µl, with 10-7 M 4-hydroxytamoxifen) were added to the tubes containing hdm2 and the GST-p53 fusion proteins, there was a 3.3-fold rise in the amount of hdm2 being pulled down by the GST-p53-N (above that pulled-down in the absence of ER{alpha}; Fig. 2aCitation ). The amount of ER{alpha} in this complex increased accordingly. A similar observation was made when the GST-hdm2 fusion protein was used to pull-down in vitro translated ER{alpha} and p53 proteins. In this case, increasing input of ER{alpha} did not reduce the amount of p53 pulled-down by the GST-hdm2 fusion protein (Fig. 2bCitation ). These data suggest that ER{alpha}, p53, and hdm2 form a ternary complex.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. ER{alpha}, p53, and hdm2 form a complex. a, upper panel: equal amounts of in vitro translated hdm2 protein (~70,000 cpm) and increasing amounts of in vitro translated ER{alpha} protein were incubated with the GST-p53-N fusion protein in the presence of 10-7 M 4-hydroxytamoxifen. The GST-p53-N fusion protein pulled-down both hdm2 and increasing amounts of ER{alpha}. ER{alpha} amplified the hdm2 being pulled-down by p53. Lower panel, quantitation of the band fluorescence by STORM 840. b, upper panel: equal amounts of in vitro translated p53 protein (~70,000 cpm) and increasing amounts of in vitro translated ER{alpha} protein were incubated with the GST-hdm2 fusion protein. The GST-hdm2 fusion protein pulled-down both p53 and increasing amounts of ER{alpha}. ER{alpha} did not reduce the amount of p53 being pulled-down by hdm2. Lower panel, quantitation of the band fluorescence by STORM 840.

 
Support for the formation of a ternary complex was gained from experiments carried out to examine the binding of ER{alpha} and hdm2. In these experiments, GST fusion proteins of the full-length and a truncated ER{alpha} were incubated with in vitro translated [35S]Met-labeled hdm2 protein in the absence or presence of E2 (Fig. 3Citation ). These experiments showed that both the full-length and the AB domain-deleted ER{alpha}-GST fusion proteins were capable of direct physical binding to hdm2 in the presence and in the absence of ligand.



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. ER{alpha} is capable of binding to hdm2 directly. Twenty µg of GST-hER{alpha} or GST-ER{alpha} ({Delta}AB) fusion proteins were allowed to interact with the in vitro translated and [35S]Met-labeled hdm2 (70,000 cpm) at 4°C overnight in HEPES buffer in the absence or presence of 10-7 M E2. Unbound proteins were removed with four washes of HEPES buffer. Bound proteins (pulled-down by the Sepharose 4B-GSH complex) were resolved by SDS-PAGE and visualized by autoradiography. Similar results were observed in experiments in which the GST fusion protein of the full-length ER{alpha} were incubated with labeled hdm2 in the presence of genistein and ICI 164,384 (data not shown).

 
ER{alpha} Protects p53 from Being Deactivated by hdm2.
The formation of a ternary complex composed of ER{alpha}, p53, and hdm2 suggests a role for the receptor in the p53-hdm2 regulatory loop (28) . Possibly ER{alpha} influences the ability of hdm2 to down-regulate the transactivity of p53 (28) . To test this hypothesis, HeLa cells were transiently cotransfected with the p53 responsive reporter pWWP-Luc (26) and expression plasmids for human hdm2 (pCR3.1-hdm2), p53 (pAlt-p53), and/or ER{alpha} (pCMV5-hER{alpha}). As shown previously (26) , the luciferase activity increased when p53 was cotransfected with the pWWP-Luc plasmid (Fig. 4Citation , groups 1 and 2). When hdm2 was added, p53 became ineffective in inducing the activity of this reporter gene (Fig. 4Citation , groups 3 and 4). Interestingly, coexpression of ER{alpha} restored the p53-driven WWP-Luc activity (Fig. 4Citation , group 5). Alone, or in the presence of hdm2, ER{alpha} had no effect on the activity of WWP-Luc. In a separate experiment, the restoration of p53-stimulated luciferase activity was shown to be dependent on the amount of pCMV5-hER{alpha} transfected (range, 0.05–0.4 µg; data not shown). The down-regulation of p53 by hdm2 was completely reversed by a transfected level of ER{alpha} plasmid between 0.20 and 0.40 µg. These results suggest that ER{alpha} protects p53 from being deactivated by hdm2.



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. ER{alpha} reverses the negative effect of hdm2 on p53 function. HeLa cells (60% confluent) were transiently cotransfected using Superfect (Qiagen) according to manufacturer’s instructions with 2 µg of pWWP-Luc (p53 responsive reporter, containing the p21/Waf1/CIP1 promoter) and 1.0 µg of pCR3.1-hdm2, 1.0 µg of pAlt-p53, and/or 0.25 µg of pCMV5-hER{alpha} as indicated. Empty expression vectors (pCR3.1 and pCMV5) were used to reach a final DNA concentration of 4.25 µg (plus 1.5 µg of pCHO110, ß-galactosidase expression plasmid) in each sample. Similar amounts of protein were translated from each of these vectors that contained the CMV promoter. After an overnight incubation, the cells were exposed to fresh medium containing ethanol vehicle alone or either 4-hydroxytamoxifen (4-OH-tamoxifen, 10-7 M) or E2 (10-8 M) for 20 h prior to harvesting (for groups 2 and 4, there is only one bar because the ligands were not necessary in the absence of ER{alpha}). After harvesting and lysis, samples were normalized by determining the protein concentration or the ß-galactosidase activity and assayed for luciferase activity. The data shown represent the means of three experiments performed in duplicate; bars, SD.

 
Expression of ER{alpha} Leads to Elevated p53 and hdm2 Protein Levels.
p53 has been shown to augment the expression of hdm2 (28) . In turn, hdm2 also controls the level of p53 in cells via the ubiquitin-proteasome pathway (21) , which decreases the level of this tumor suppressor. The presence of ER{alpha} in cells would be predicted to protect p53 from hdm2-targeted degradation and lead to an increase in the level of p53. According to this line of reasoning, a cellular increase in p53 should enhance the expression of hdm2. The MCF-10A human breast epithelial cell line normally does not contain ER{alpha} (15) . Transfection of ER{alpha} into these cells created an ER+ stable cell line, 139B6 (15) . A Western blot of the proteins in these transfected cells demonstrated that the presence of ER{alpha} is accompanied by increasing levels of both p53 and hdm2 proteins above those detected in the parental ER- cell line (Fig. 5Citation ). Interestingly, the 139B6 cells have a longer doubling time than the vector-transfected MCF-10A cell line (15) , possibly a result of ER{alpha} protection of the p53 that acts to lengthen the G1 phase of the cell cycle.



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effect of the expression of ER{alpha} in MCF-10A cells on the cellular p53 and hdm2 protein levels. Western blots were performed on 20 µg of the MCF-10A and 139B6 cell proteins, which were resolved in SDS-PAGE, transferred to a nitrocellulose membrane, and exposed to monoclonal antibodies as described in "Materials and Methods." Samples were visualized by the standard ECL method. Right, molecular weights shown in thousands.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The tumor suppressor p53 and the oncogene hdm2 display an essential interplay in regulating cellular proliferation and apoptosis. It has been demonstrated that p53 up-regulates the expression of hdm2 via a stimulation of its mRNA transcription (28) . On the other hand, hdm2 suppresses the p53 transactivity by interfering with the interaction between p53 and the basic transcriptional machinery (29) . hdm2 also controls the level of this tumor suppressor protein through the ubiquitin-proteasome pathway (21) . Results from this investigation point toward a role for ER{alpha} in this essential regulatory pathway (Fig. 6Citation ).



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Schematic representation of a proposed role for ER{alpha} in the p53-hdm2 regulatory loop.

 
Using the GST pull-down assay, we have demonstrated that ER{alpha} is capable of binding to the NH2 terminus of the p53 protein (Fig. 1Citation ). This interaction is unaffected by the presence of ligand. As a further indication of the interworking of these proteins, we have shown that ER{alpha} positively influenced the binding of hdm2 and p53 (Fig. 2Citation ), although both factors bind to the NH2 terminus of p53. The ability of ER{alpha} to protect p53 from functional deactivation by hdm2, as demonstrated in a Luc reporter assay (Fig. 4Citation ), suggests that the ternary complex formed by ER{alpha}, p53, and hdm2 may have an important functional role. Our findings that p53 (and thus hdm2) levels are increased in ER{alpha}-transfected immortalized breast epithelial cells, compared with those of the parental cell line, provide additional support for this conclusion (Fig. 5Citation ).

The relationship between ER{alpha} and hdm2 has been observed previously. Sheikh et al. (30) reported that ER+ breast cancer cells have significantly higher (up to 30-fold) hdm2 mRNA levels than those of ER- breast cancer cells. In addition, MDA-MB-231 cells, which have been stably transfected with the ER{alpha} cDNA, produced a 3-fold increase in the hdm2 mRNA levels (30) . In the absence of an ERE in the promoter of the hdm2 gene, it appears that the observed stimulatory effect of ER{alpha} on the hdm2 is carried out via the elevated p53 transcriptional activity (hdm2 is positively regulated by p53; Figs. 5Citation and 6Citation ).

Other than p53, three important regulatory proteins [p300 (31) , p19ARF (32) and Rb (33) ] have been reported to bind to mdm2. All of these proteins compromised the ability of mdm2 to degrade p53. Furthermore, the protective effects of p19ARF had been shown to occur via its ability to inhibit the ligase activity of hdm2. To this end, our results have demonstrated that ER{alpha} also protects p53 from being deactivated by hdm2 (Fig. 4Citation ). ER{alpha} is capable of binding hdm2 directly (Fig. 3Citation ), as well as elevating levels of p53 and hdm2 in ER{alpha} stably transfected MCF10A cells (Fig. 5Citation ). This suggests that ER{alpha} might suppress the ubiquitin ligase activity of hdm2.

In normal breast tissues under nonlactating conditions, ER{alpha} is present only in ~7% of the epithelial cells (34) . This level may increase or decrease in breast tumor tissue. Often, ER{alpha} expression is lost during the progression of breast cancer. Furthermore, there is an inverse correlation between ER{alpha} expression and malignant progression in mammary neoplasia (34) . Because ER{alpha} expression is up-regulated in tissues that are rapidly dividing, such as the uterine endometrium during the proliferative phase, it is conceivable that the accompanying elevated p53 activity plays a role in the prevention of rapidly growing tissues from becoming transformed.

Other investigators (13 , 14 , 16) have observed increased doubling times after they introduced ER{alpha} into ER- cells. This role played by ER{alpha} is very similar to the role of the p14ARF tumor suppressor (23) , which binds to both p53 and hdm2 and protects p53 from being down-regulated by hdm2. Over the past decade, the cytotoxicity resulting from ER{alpha} overexpression (13) has been observed repeatedly (14, 15, 16 , 30) . Nevertheless, this observation remains unexplained. In one classic example, Kushner et al. (13) overexpressed ER{alpha} in CHO cells and found that even trace amounts of E2 (or tamoxifen) were lethal to these stably transfected cells. On the basis of the present information, the enhanced ER{alpha}-mediated protection of the wtp53 may have resulted in the death of these cells. Just as the double knock-out of the mdm2 gene is lethal to the embryonic development (35) , overprotection of p53 from hdm2 deactivation can lead to growth retardation or even lethality. It appears that elevated p53 is responsible for the increased hdm2 levels, and it would follow that the elevated protection of p53 may explain the toxicity that is associated with ER{alpha} overexpression.

These investigations have resulted in the novel finding that ER{alpha} functions to protect p53 from hdm2-induced deactivation. This role of the unliganded receptor is quite unlike the classic function of ER{alpha} which, once bound to E2, regulates target genes containing the specific response element in their promoters. Such genes take part in mitogenesis as well as differentiation (1, 2, 3, 4, 5, 6, 7, 8) .


    Acknowledgments
 
The authors are grateful to Drs. B. Vogelstein, P. Chambon, D. George, and R. H. Goodman for providing plasmids used in these experiments.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 These investigations were supported in part by NIH Grants DK 54837 and CA 68655. Back

2 To whom requests for reprints should be addressed, at Department of Biochemistry and Molecular Biology, Wayne State University School of Medicine, 540 Canfield, Detroit, MI 48202. Phone: (313) 577-1283; Fax: (313) 577-4112. Back

3 The abbreviations used are: ER{alpha}, estrogen receptor {alpha}; GST, glutathione S-transferase; hdm2, human double minute-2 oncogene; E2, 17ß-estradiol; wt, wild type; HRP, horseradish peroxidase; Luc, luciferase; CMV, cytomegalovirus; CHO, Chinese hamster ovary; GSH, reduced glutathione. Back

Received 1/ 6/00. Accepted 2/17/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Rajah T. T., Dunn S. T., Pento J. T. The influence of antiestrogens on pS2 and cathepsin D mRNA induction in MCF-7 breast cancer cells. Anticancer Res., 16: 837-842, 1996.[Medline]
  2. Nardulli A. M., Romine L. E., Carpo C., Greene G. L., Rainish B. Estrogen receptor affinity and location of consensus and imperfect estrogen response elements influence transcription activation of simplified promoters. Mol. Endocrinol., 10: 694-704, 1996.[Abstract/Free Full Text]
  3. Hyder S. M., Stancel G. M. In vitro interaction of uterine estrogen receptor with the estrogen response element present in the 3'-flanking region of the murine c-fos protooncogene. J. Steroid Biochem. Mol. Biol., 48: 69-79, 1994.[Medline]
  4. Salmi A., Ammala M., Rutanen E. M. Proto-oncogenes c-jun and c-fos are down-regulated in human endometrium during pregnancy: relationship to oestrogen receptor status. Mol. Hum. Reprod., 2: 979-984, 1996.[Abstract/Free Full Text]
  5. Bhargava V., Kell D. L., van de Rijn M., Warnke R. A. Bcl-2 immunoreactivity in breast carcinoma correlates with hormone receptor positivity. Am. J. Pathol., 145: 535-540, 1995.[Abstract]
  6. Xie W., Duan R., Safe S. Estrogen induces adenosine deaminase gene expression in MCF-7 human breast cancer cells: role of estrogen receptor-Sp1 interactions. Endocrinology, 140: 219-227, 1999.[Abstract/Free Full Text]
  7. El-Ashry D., Chrysogelos S. A., Lippman M. E., Kern F. G. Estrogen induction of TGF-{alpha} is mediated by an estrogen response element composed of two imperfect palindromes. J. Steroid Biochem. Mol. Biol., 59: 261-269, 1996.[Medline]
  8. Davis M. D., Butler W. B., Brooks S. C. Induction of tissue plasminogen activator mRNA and activity by structurally altered estrogens. J. Steroid Biochem. Mol. Biol., 52: 421-430, 1995.[Medline]
  9. Cerillo G., Rees A., Manchanda N., Reilly C., Brogan I., White A., Needham M. The oestrogen receptor regulates NF{kappa}B and AP-1 activity in a cell-specific manner. J. Steroid Biochem. Mol. Biol., 67: 79-88, 1998.[Medline]
  10. Treon S. P., Teoh G., Urashima M., Ogata A., Chauhan D., Webb I. J., Anderson K. C. Anti-estrogens induce apoptosis of multiple myeloma cells. Blood, 92: 1749-1757, 1998.[Abstract/Free Full Text]
  11. Bardon S., Vignon F., Montcourrier P., Rochefort H. Steroid receptor-mediated cytotoxicity of an antiestrogen and an antiprogestin in breast cancer cells. Cancer Res., 47: 1441-1448, 1987.[Abstract/Free Full Text]
  12. Katzenellenbogen B. S., Montano M. M., Ekena K., Herman M. E., McInerney E. M., William L. McGuire Memorial Lecture. Antiestrogens: mechanisms of action and resistance in breast cancer. Breast Cancer Res. Treat., 44: 23-38, 1997.[Medline]
  13. Kushner P. J., Hort E., Shine J., Baxter J. D., Greene G. L. Construction of cell lines that express high levels of the human estrogen receptor and are killed by estrogens. Mol. Endocrinol., 4: 1465-1473, 1990.[Abstract/Free Full Text]
  14. Touitou I., Mathieu M., Rochefort H. Stable transfection of the estrogen receptor cDNA into HeLa cells induces estrogen responsiveness of endogenous cathepsin D gene but not of cell growth. Biochem. Biophys. Res. Commun., 31: 109-115, 1990.
  15. Pilat M. J., Christman J. K., Brooks S. C. Characterization of the estrogen receptor transfected MCF10A breast cell line 139B6. Breast Cancer Res. Treat., 37: 253-266, 1996.[Medline]
  16. Jiang S. Y., Jordan V. C. Growth regulation of estrogen receptor-negative breast cancer cells transfected with complementary DNAs for estrogen receptor. J. Natl. Cancer Inst., 84: 580-591, 1992.[Abstract/Free Full Text]
  17. Yu C. L., Driggers P., Barrera-Hernandez G., Nunez S. B., Segars J. H., Cheng S. The tumor suppressor p53 is a negative regulator of estrogen receptor signaling pathways. Biochem. Biophys. Res. Commun., 20: 617-620, 1997.
  18. Yap N., Yu C. L., Cheng S. Y. Modulation of the transcriptional activity of thyroid hormone receptors by the tumor suppressor p53. Proc. Natl. Acad. Sci. USA, 30: 4273-4277, 1996.
  19. Yu C., Yap N., Chen D., Cheng S. Modulation of hormone-dependent transcriptional activity of the glucocorticoid receptor by the tumor suppressor p53. Cancer Lett., 24: 191-196, 1997.
  20. Yuan Z. M., Huang Y., Ishiko T., Nakada S., Utsugisawa T., Shioya H., Utsugisawa Y., Yokoyama K., Weichselbaum R., Shi Y., Kufe D. Role for p300 in stabilization of p53 in the response to DNA damage. J. Biol. Chem., 274: 1883-1886, 1999.[Abstract/Free Full Text]
  21. Tao W., Levine A. J. Nucleocytoplasmic shuttling of oncoprotein Hdm2 is required for Hdm2-mediated degradation of p53. Proc. Natl. Acad. Sci. USA, 16: 3077-3080, 1999.
  22. Ko L. J., Prives C. p53: puzzle and paradigm. Genes Dev., 10: 1054-1072, 1996.[Free Full Text]
  23. Stott F. J., Bates S., James M. C., McConnell B. B., Starborg M., Brookes S., Palmero I., Ryan K., Hara E., Vovsden K. H., Peters G. The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. EMBO J., 17: 5001-5014, 1998.[Medline]
  24. Chai Y. L., Cui J., Shao N., Shyam E., Reddy P., Rao V. N. The second BRCT domain of BRCA1 proteins interacts with p53 and stimulates transcription from the p21WAF1/CIP1 promoter. Oncogene, 18: 263-268, 1999.[Medline]
  25. Marmorstein L. Y., Ouchi T., Aaronson S. A. The BRCA2 gene product functionally interacts with p53 and RAD51. Proc. Natl. Acad. Sci. USA, 95: 13869-13874, 1998.[Abstract/Free Full Text]
  26. el-Deiry W. S., Tokino T., Velculescu V. E., Levy D. B., Parsons R., Trent J. M., Lin D., Mercer W. E., Kinzler K. W., Vogelstein B. WAF1, a potential mediator of p53 tumor suppression. Cell, 75: 817-825, 1993.[Medline]
  27. Liu G., Schwartz J. A., Brooks S. C. p53 suppresses estrogen responsive genes by interfering with the ER/ERE binding. Biochem. Biophys. Res. Commun., 264: 359-364, 1999.[Medline]
  28. Wu X., Bayle J. H., Olson D., Levine A. J. The p53-mdm-2 autoregulatory feedback loo. p. Genes Dev., 7: 1126-1132, 1993.[Abstract/Free Full Text]
  29. Kussie P. H., Gorina S., Marechal V., Elenbaas B., Moreau J., Levine A. J., Pavletich N. P. Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain. Science (Washington DC), 274: 948-953, 1996.[Abstract/Free Full Text]
  30. Sheikh M. S., Shao Z. M., Hussain A., Fontana J. A. The p53-binding protein MDM2 gene is differentially expressed in human breast carcinoma. Cancer Res., 53: 3226-3228, 1993.[Abstract/Free Full Text]
  31. Grossman S. R., Perez M., Kung A. L., Joseph M., Mansur C., Xiao Z. X., Kumar S., Howley P. M., Livingston D. M. p300/MDM2 complexes participate in MDM2-mediated p53 degradation. Mol. Cell, 2: 405-415, 1998.[Medline]
  32. Honda R., Yasuda H. Association of p19(ARF) with Mdm2 inhibits ubiquitin ligase activity of Mdm2 for tumor suppressor p53. EMBO J., 18: 22-27, 1999.[Medline]
  33. Hsieh J. K., Chan F. S., O’Connor D. J., Mittnacht S., Zhong S., Lu X. RB regulates the stability and the apoptotic function of p53 via MDM2. Mol. Cell, 3: 181-193, 1999.[Medline]
  34. Brooks S. C., Pauley R. Breast cancer biology Dulbecco R. eds. . Encyclopedia of Human Biology, 2: 53-65, Academic Press Inc San Diego 1991.
  35. Jones S. N., Roe A. E., Donehower L. A., Bradley A. Rescue of embryonic lethality in Mdm2-deficient mice by absence of p53. Nature (Lond.), 378: 206-208, 1995.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
A. Sayeed, S. D. Konduri, W. Liu, S. Bansal, F. Li, and G. M. Das
Estrogen Receptor {alpha} Inhibits p53-Mediated Transcriptional Repression: Implications for the Regulation of Apoptosis
Cancer Res., August 15, 2007; 67(16): 7746 - 7755.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. Duong, N. Boulle, S. Daujat, J. Chauvet, S. Bonnet, H. Neel, and V. Cavailles
Differential Regulation of Estrogen Receptor {alpha} Turnover and Transactivation by Mdm2 and Stress-Inducing Agents
Cancer Res., June 1, 2007; 67(11): 5513 - 5521.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Bionaz and J. J. Loor
Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle
Physiol Genomics, May 11, 2007; 29(3): 312 - 319.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Menendez, A. Inga, J. Snipe, O. Krysiak, G. Schonfelder, and M. A. Resnick
A Single-Nucleotide Polymorphism in a Half-Binding Site Creates p53 and Estrogen Receptor Control of Vascular Endothelial Growth Factor Receptor 1
Mol. Cell. Biol., April 1, 2007; 27(7): 2590 - 2600.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. C Fleisch, C. A Maxwell, and M.-H. Barcellos-Hoff
The pleiotropic roles of transforming growth factor beta in homeostasis and carcinogenesis of endocrine organs.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 379 - 400.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Liu, S. D. Konduri, S. Bansal, B. K. Nayak, S. A. Rajasekaran, S. M. Karuppayil, A. K. Rajasekaran, and G. M. Das
Estrogen Receptor-{alpha} Binds p53 Tumor Suppressor Protein Directly and Represses Its Function
J. Biol. Chem., April 14, 2006; 281(15): 9837 - 9840.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. K. Kinyamu and T. K. Archer
Estrogen Receptor-Dependent Proteasomal Degradation of the Glucocorticoid Receptor Is Coupled to an Increase in Mdm2 Protein Expression
Mol. Cell. Biol., August 15, 2003; 23(16): 5867 - 5881.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. F. Verschraegen, W. Hu, Y. Du, J. Mendoza, J. Early, M. Deavers, R. S. Freedman, R. C. Bast Jr., A. P. Kudelka, J. J. Kavanagh, et al.
Establishment and Characterization of Cancer Cell Cultures and Xenografts Derived from Primary or Metastatic Mullerian Cancers
Clin. Cancer Res., February 1, 2003; 9(2): 845 - 852.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Qin, T. Nguyen, J. Stewart, I. Samudio, R. Burghardt, and S. Safe
Estrogen Up-Regulation of p53 Gene Expression in MCF-7 Breast Cancer Cells Is Mediated by Calmodulin Kinase IV-Dependent Activation of a Nuclear Factor {kappa}B/CCAAT-Binding Transcription Factor-1 Complex
Mol. Endocrinol., August 1, 2002; 16(8): 1793 - 1809.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. Vanzulli, A. Efeyan, F. Benavides, L. A. Helguero, G. Peters, J. Shen, C. J. Conti, C. Lanari, and A. Molinolo
p21, p27 and p53 in estrogen and antiprogestin-induced tumor regression of experimental mouse mammary ductal carcinomas
Carcinogenesis, May 1, 2002; 23(5): 749 - 758.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Conway, S. N. Edmiston, L. Cui, S. S. Drouin, J. Pang, M. He, C.-K. Tse, J. Geradts, L. Dressler, E. T. Liu, et al.
Prevalence and Spectrum of p53 Mutations Associated with Smoking in Breast Cancer
Cancer Res., April 1, 2002; 62(7): 1987 - 1995.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Kato, S. Horiuchi, A. Takahashi, Y. Ueoka, T. Arima, T. Matsuda, H. Kato, J.-i. Nishida, Y. Nakabeppu, and N. Wake
Contribution of Estrogen Receptor alpha to Oncogenic K-Ras-mediated NIH3T3 Cell Transformation and Its Implication for Escape from Senescence by Modulating the p53 Pathway
J. Biol. Chem., March 22, 2002; 277(13): 11217 - 11224.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Sengupta and B. Wasylyk
Ligand-dependent interaction of the glucocorticoid receptor with p53 enhances their degradation by Hdm2
Genes & Dev., September 15, 2001; 15(18): 2367 - 2380.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Isaacs, S.'i. Saito, and L. M. Neckers
Requirement for HDM2 Activity in the Rapid Degradation of p53 in Neuroblastoma
J. Biol. Chem., May 18, 2001; 276(21): 18497 - 18506.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, G.
Right arrow Articles by Brooks, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, G.
Right arrow Articles by Brooks, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online