| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Research Center Karlsruhe, Institute of Genetics, 76344 Eggenstein-Leopoldshafen, Germany [
C. G., C. E.], and Geron Corporation, Menlo Park, California 94025 [S. L., A. P. V.]
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
50–200 bp
(3)
. This molecular erosion sets a physical limit to the
potential number of cell divisions and serves as a "mitotic clock"
defining the lifespan of somatic cells. One mechanism to escape this
limitation is the activation of telomerase. Because telomerase can
reset the mitotic clock, it has been linked to the processes of
tumorigenesis and aging. To date, three components associated with telomerase activity in humans have been identified. The RNA component of telomerase is encoded by the hTR gene (Refs. 4 and 5 ; now called hTER) and functions as the template for elongation of the telomeric repeat units. hTER is constitutively expressed in all cells and is therefore not likely to be involved in the regulation of telomerase activity (6) . The same is true for another protein that is associated with telomerase, the product of the TP1/TLP1 gene (now called hTEP1), which is also expressed ubiquitously (7 , 8) . Recently, the catalytic subunit of human telomerase has been cloned and named hTERT2 because it possesses the activity of an RNA-dependent DNA polymerase (9, 10, 11) . Only hTER and hTERT are required for the reconstitution of telomerase activity in vitro and therefore represent the minimal catalytic core of telomerase in humans (12) .
Transfection of telomerase-negative cells with an hTERT cDNA has demonstrated that hTERT expression is rate-limiting for telomerase activity (13, 14, 15) . Moreover, cells that ectopically express hTERT overcome crisis and have an extended life span, supporting the causal relationship between the shortening of telomeres and cellular senescence (16 , 17) . Telomerase activity has been shown to be associated with proliferation (18 , 19) ; therefore, it is not surprising that almost all immortal and cancer cells display significant telomerase activity and express hTERT (20 , 21) . These observations and the finding that the myc oncogene can activate hTERT expression (22, 23, 24, 25) indicate that this gene may play a critical role in tumorigenesis.
While telomerase becomes activated during neoplastic transformation, telomerase activity decreases during differentiation processes, which are accompanied by loss of proliferative potential. This has been studied in embryonic stem cells that were differentiated by the removal of leukemia inhibitory factor from the culture medium and in F9 teratocarcinoma after retinoic acid-induced differentiation (26) . Loss of telomerase activity upon differentiation was also demonstrated in K-562 human erythroid leukemia cells as well as in HL-60 human promyelocytic leukemia cells (26 , 27) . In the latter, telomerase down-regulation was demonstrated to be an early event of the differentiation process and not its consequence (28) . Repression of telomerase activity was subsequently demonstrated to be associated with the down-regulation of hTERT expression upon differentiation of HL-60 cells with TPA (10 , 29) . It is, however, not yet clear at which level of gene expression this down-regulation occurs.
The only transcription factor that has thus far been implicated in the regulation of hTERT is encoded by the c-myc oncogene (22, 23, 24, 25) . The ability of c-Myc to function as a transcription factor has been shown to depend upon its dimerization with the protein Max (reviewed in Ref. 30 ). In addition to the formation of stable complexes with c-Myc, Max also heterodimerizes with proteins of the Mad(Mxi1) family (30, 31, 32) . These Mad/Max complexes act in an antagonistic manner to c-Myc/Max-induced transactivation and result in potent repression of gene expression. How these additional members of the Myc/Max/Mad network affect hTERT expression has, however, not been studied yet.
We have used the differentiation of human hematopoietic U937 cells by phorbol ester as a model to study the regulation of hTERT expression. We demonstrate here that the half-life of the hTERT mRNA is not altered by TPA treatment. Nuclear run-off analysis shows that the down-regulation of hTERT is a consequence of a decrease in transcriptional initiation of the gene. Furthermore, the decrease in hTERT activity is not preceded by a down-regulation of the oncoprotein c-Myc but is paralleled by an increase in levels of mad1. In transient transfection assays, Mad1 was able to repress hTERT promoter activity, an effect that was dependent on an E-box consensus sequence. The repressive effect of Mad1 also required an intact NH2 terminal domain, which mediates the interaction with the corepressor mSin3.
|
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
Metabolic labeling followed by high stringency immunoprecipitation was done as described (33) . For the detection of Mad1, a polyclonal antiserum directed against the COOH terminus of human Mad1 was used (Santa Cruz Biotechnology).
Constructs, Transfections, and Reporter Gene Assays.
Generation of the hTERT promoter constructs pGRN150 and
pGRN261 has been described (22)
. pGRN176 has been
generated by digestion of pGRN150 with PmlI and
SrfI and subsequent religation. Construct pGRN316 contains
nucleotides +1 to -246 from the hTERT genomic sequence,
i.e., sequences immediately upstream of the ATG codon, and
has the same 3' configuration as pGRN261 (cloned into the
EcoRI site of pSEAP2-Basic).
U937 cells were transfected in six-well dishes using SuperFect (Qiagen) with 0.6 µg of reporter plasmid, 1.2 µg of expression plasmid, and 0.2 µg of internal control plasmid (pGL3 Control; Promega). Reporter gene activity was determined by the SEAP reporter gene assay (Roche).
RT-PCR Analysis and TRAP Assay.
First-strand cDNA synthesis was done using 2–5 µg of total RNA
with SuperScript reverse transcriptase (Life Technologies, Inc.) in the
presence of 100 ng of oligo-dT15 primers in a volume of 20
µl. The cDNA was diluted 1:5 in water, and 5 µl of the reverse
transcriptase reaction was used for PCR analysis in a total volume of
50 µl containing 0.2 µM specific primers, 10% DMSO,
1.5 mM MgCl2, 0.2 mM
deoxynucleotide triphosphates, and 1 unit of Taq polymerase (Life
Technologies, Inc.). For radioactive PCR analysis, 2.5 µCi of
[
-32P]dCTP (3000 Ci/mmol; Amersham) was added to the
reaction. Amplification products were analyzed on 5% nondenaturing
polyacrylamide gels. PCR analysis (94°C, 30 s; 55°C, 30 s; and 72°C, 1 min) was done for 33 (hTERT), 30
(hTEP1), or 21 cycles (GAPDH). For radioactive
PCR, the linear range of amplification was determined previously, and
amplification was done for 25 cycles for hTERT and
hTEP1.
The primers were hTERT-5' (TCTGGATTTGCAGGTGAACAGCC) and hTERT-3' (GGGTGGCCATCAGTCCAGGATGG) for hTERT, hTEP1-5' (TCAAGCCAAACC-TGAATCTGAG) and hTEP1-3' (CCCGAGTGAAT-CTTTCTACGC) for hTEP1, as well as GAPDH-5' (ACCACAGTCCATGCCATCAC) and GAPDH-3' (TCCACCACCCTGTTGCTGTA) for GAPDH.
To determine the enzymatic activity of telomerase in cell extracts, we used the TRAP as described (20) with the TRAPeze kit (Oncor) according to the recommendations of the supplier. Each sample contains the equivalent of 1 x 104 cells.
Nuclear Run-Off and Electrophoretic Mobility Shift Assays.
Nuclear run-off analysis was performed as described (34)
with some modifications. For the isolation of nuclei from U937 cells,
5 x 107 cells were used per time point. All
procedures were carried out at 4°C. Cells were collected by
centrifugation and washed twice in PBS. The cell pellet was loosened by
careful vortexing, resuspended in 4 ml of lysis buffer [10
mM Tris-HCl (pH 7.4), 10 mM NaCl, 3
mM MgCl2, and 0.5% (v/v) NP40] and incubated
on ice for 5 min. Nuclei were pelleted by centrifugation at
500 x g for 5 min. The supernatant was used
for the isolation of cytoplasmic RNA. The nuclei were resuspended in 4
ml of lysis buffer and again centrifuged. The pellet was resuspended in
200 µl of glycerol storage buffer [50 mM Tris-HCl (pH
8.3), 40% (v/v) glycerol, 5 mM MgCl2, and 0.1
mM EDTA] and either used immediately for the run-off assay
or frozen in liquid N2.
For the run-off assay, 200 µl of nuclei were mixed with 200
µl of reaction buffer [10 mM Tris-HCl (pH 8.0), 5
mM MgCl2, 300 mM KCl, 0.5
mM each of ATP, CTP, and GTP, and 100 µCi of
[-32P]UTP (800 Ci/mmol; Amersham)] and incubated with
shaking for 30 min at 30°C. Subsequently, DNA was digested by the
addition of 20 µl of DNase I (1 mg/ml; RNase free) and incubation for
15 min at 30°C. Isolation of RNA was done using the TRIzol reagent
(Life Technologies, Inc.) following the recommendations of the
manufacturer.
Hybridization was performed with 1 x 106 cpm labeled RNA per sample using 5 ml of the Rapid-hyb buffer (Amersham) according to the manufacturer’s recommendations. To enhance sensitivity, the hybridization was done overnight. To reduce background signals, filters were washed under stringent conditions: two times in 2 x SSC/0.1% SDS, two times in 0.2 x SSC/0.1% SDS, and two times in 0.1x SSC/0.1% SDS for 25 min at 65°C. For each gene, 1 µg of a specific fragment was immobilized on a nylon membrane: for hTERT and GAPDH, the 450-bp (position 3014–3464) or the 449-bp (position 586–1039) amplification products described above; for c-fos, a 1-kbp PstI fragment; and for c-jun, a 1.4-kbp SmaI-HindIII fragment of the respective cDNAs was used.
Electrophoretic mobility shift assays were performed using a 26-bp oligonucleotide containing the consensus E-box (Santa Cruz Biotechnology) and nuclear extracts from U937 cells, which were prepared as described (35) . Approximately 10 fmol of labeled oligonucleotide (25,000 cpm) were incubated with 3 µg of nuclear extract in the presence of 1 µg of poly(deoxyinosinic-deoxycytidylic acid) in 1x binding buffer (36) for 20 min at room temperature. Subsequently, 3 µg of a c-Myc-specific antibody (N-262; Santa Cruz Biotechnology) or of an E2F-1-specific antibody (as a control) were added to the mixture, and after 10 min at room temperature, binding was allowed to occur overnight on ice. Complexes were separated on 5% nondenaturing polyacrylamide gels that were run at 4°C.
Northern Blot and Array Analysis.
For Northern analysis, 20 µg of cytoplasmic RNA were immobilized on a
filter and sequentially probed with specific fragments to detect the
c-myc (2.4-kb) and mad1 (3.8 and 6.5-kb) mRNA
without stripping the filter. To analyze the expression of
mad1 in human tumors, the commercially available Matched
Tumor/Normal Expression Array (Clontech) was used. Hybridization with a
mad1-specific probe was done according to the manufacturer.
|
Results and Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
, differentiation of these cells leads to a down-regulation of
hTERT mRNA after 5 h and to its complete disappearance
after 24 h. In contrast, the expression of hTEP1 was
slightly increased after the addition of the differentiating agents, an
observation that has been reported earlier for HL-60 cells
(38)
. TRAP assays using extracts from differentiating U937
cells showed that the addition of RA or TPA leads to a decrease of
telomerase activity (Fig. 1b)
, although with much slower
kinetics when compared with the hTERT mRNA. After 24 h,
a reduction of telomerase activity was visible, and after 72 h,
all the activity had disappeared. These data confirm that expression of
hTERT is the rate-limiting step for telomerase activity. To
verify that the experimental conditions used here resulted in the
differentiation of U937 cells, we have examined expression of the cell
surface markers CD4 as well as CD11a and CD11c (Fig. 1c)
.
Whereas expression of the monocytic antigens CD11a and CD11c increased
upon TPA treatment, CD4 surface expression, which is a hallmark for
immature U937 cells, was lost rapidly. We conclude from these
experiments that hTERT regulation in U937 cells is tightly
controlled and that these cells therefore provide a useful model for
studying the regulation of the hTERT gene upon
differentiation. For all of the subsequent experiments, only TPA was
used as a differentiating agent.
|
. After 4 h, hTERT message had almost completely
disappeared. This regulation was specific because hTEP1 mRNA
was affected to a much lesser extent by the inhibitor. Densitometric
analysis revealed the half-life of hTERT in U937 cells to be
50 min. The rate of decay of the hTERT mRNA was not
affected by the addition of TPA, which suggests that the induction of
differentiation did not change hTERT mRNA stability. The
decrease of hTERT message induced by TPA was slower than
that induced by actinomycin D alone or by both drugs, indicating that
there is still residual transcription of the hTERT gene
after 6 h of TPA treatment.
|
, the level of transcription of hTERT started to decrease as
early as 15 min and was significantly down-regulated after 8 h of
induction. In contrast, GAPDH expression was only mildly
altered by the addition of TPA. To verify the effect of TPA on gene
expression, we have included the immediate early genes c-fos
and c-jun in the experiment. The expected transient rise in
the expression of both genes that can be observed after 15 min serves
as a positive control. These results indicate that the down-regulation
of hTERT mRNA upon differentiation of U937 cells is
predominantly caused by a decrease of the transcriptional activity of
the gene.
|
. We then wanted to investigate the level of endogenous c-myc
expression in response to TPA treatment in our cell system.
Surprisingly, RT-PCR (data not shown) and Northern analysis did not
reveal significant changes in c-myc mRNA, whereas
hTERT levels decreased after addition of the drug (Fig. 4a)
. To analyze possible posttranscriptional effects, we
examined the level of c-Myc protein. The amount of c-Myc that could be
supershifted from complexes binding to an E-box-containing fragment
slightly decreased after TPA addition (Fig. 4b)
. This
decrease, however, was not complete, and there was still significant
c-Myc activity when hTERT expression had already
disappeared. This observation represents an exception to the general
observation that c-myc mRNA and protein levels are turned
off in differentiating cells. A similar observation, however, has been
made in a subline of U937 cells in which TPA treatment did not result
in a decrease in c-myc levels (39)
. Moreover, a
c-Myc target gene, ODC decreased rapidly, despite high levels of c-Myc,
but the mechanism by which ODC expression was down-regulated remained
undetermined. As in the case with ODC, our results imply that c-Myc is
not the only determinant of hTERT activity in U937 cells.
|
. This
observation is in agreement with earlier reports (40)
and
prompted us to test the effect of Mad1 on the hTERT
promoter. Overexpression of Mad1 in transient transfection assays in
U937 cells resulted in a consistent and significant decrease of
hTERT promoter activity (Fig. 4d)
. This
repressive effect of Mad1 was dose dependent (Fig. 4e)
. The
hTERT promoter contains two E-box consensus sites, one of
which is located close to the translational initiation codon at
position -29 to -34 (proximal E-box), whereas the second one is at
position -238 to -243 with regard to the ATG (distal E-box; Fig. 4c
; Ref. 22
). The effect of Mad1 on the hTERT
promoter was dependent on an intact proximal E-box. Deletion of this
E-box led to reporter gene activity that was almost indistinguishable
from a construct without an obvious E-box consensus. This observation
was paralleled by the effect of c-Myc on the hTERT promoter,
which was also mainly exerted via the evolutionarily conserved proximal
E-box (Fig. 4f
; Ref. 22
). Thus, c-Myc and Mad1 exert their
transcriptional effects via the same site in the hTERT
promoter. A comparison of the c-Myc and Mad1 effects on the reporters
pGRN261 and pGRN316 suggests that sequences upstream of both E-boxes
appear to contribute to the repression of the hTERT promoter
by Mad1 and its activation by c-Myc. Although there is no additional
E-box in the 5' region of pGRN261, the reporter harbors several
additional sequence elements that deviate by only 1 bp from the
canonical CACGTG. Whether c-Myc/Max and/or Mad1/Max complexes bind to
these sites, however, remains to be shown. To exclude competition
between Mad1 and c-Myc as the basis for the observed effect, we have
used a mutant form of Mad1. The Mad
N mutant (41)
is
devoid of the mSin interaction domain (SID) and is therefore not able
to actively repress transcription. As can be seen in Fig. 4d
, cotransfection of MadN does not lead to repression of
the hTERT promoter constructs. In contrast, the mutant led
to a consistent increase in reporter gene activity. This effect could
be explained by the displacement of endogenous Mad1, which is expressed
at a low level in undifferentiated cells (Fig. 4b
, bottom),
by the overexpressed mutant form. Thus, repression of the
hTERT promoter by Mad1 involves an active repression
mechanism rather than simple competition with c-Myc.
Mad1 Expression Is Lost in Human Tumors.
To analyze the expression of mad1 in human tumors, we have
measured mad1 mRNA levels in an arrayed panel of human tumor
and the respective normal tissue (Fig. 5)
. In a number of tissues, mad1 expression was too low to be
analyzed; but in the particular case of colon cancers, as many as 91%
(10 of 11) of the tumors showed decreased mad1 mRNA levels.
In the combined 29 samples of tumors from colon, lung, stomach, and
rectum, mad1 expression was lost or down-regulated in 69%
(20 of 29) as compared with normal tissue from the same patient. Of
note, several members of the Mad family have been discussed as tumor
suppressors (42)
. On the basis of our observations, one
can therefore speculate that the repression of the hTERT
promoter by Mad1 limits the replicative potential of a cell and thereby
contributes to the tumor suppressor phenotype.
|
|
ACKNOWLEDGMENTS |
|---|
N,
and max constructs and valuable advice. We also thank Falk
Weih, Michael Pankratz, and Bernhard Lüscher for reading and
improving the manuscript; Martin Hegen for help with the FACS analysis;
Carsten Weiss and the members of our lab for helpful discussions and
suggestions; and Birgit Besenbeck, Stephan Brodbeck, and Robert Adams
for excellent technical support. |
FOOTNOTES |
|---|
1 To whom requests for reprints should be
addressed, at Research Center Karlsruhe, Institute of Genetics, Hermann
von Helmholtz-Platz 1, 76344 Eggenstein-Leopoldshafen, Germany. Phone:
49-7247-823444; Fax: 49-7247-823354; E-mail: christoph.englert{at}itg.fzk.de 
2 The abbreviations used are: hTERT, human
telomerase reverse transcriptase; TPA,
12-O-tetradecanoylphorbol-13-acetate; TRAP, telomeric repeat
amplification protocol; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; RA, retinoic acid; RT-PCR, reverse transcription-PCR;
ODC, ornithine decarboxylase; FACS, fluorescence-activated cell
sorter.
Received 10/27/99. Accepted 3/ 3/00.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  R. A. Katzenellenbogen, P. Vliet-Gregg, M. Xu, and D. A. Galloway NFX1-123 Increases hTERT Expression and Telomerase Activity Posttranscriptionally in Human Papillomavirus Type 16 E6 Keratinocytes J. Virol., July 1, 2009; 83(13): 6446 - 6456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wang, Y. Zhao, C. Hu, and J. Zhu Differential repression of human and mouse TERT genes during cell differentiation Nucleic Acids Res., May 1, 2009; 37(8): 2618 - 2629. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bellon and C. Nicot Central role of PI3K in transcriptional activation of hTERT in HTLV-I-infected cells Blood, October 1, 2008; 112(7): 2946 - 2955. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Makki, T. Heinzel, and C. Englert TSA downregulates Wilms tumor gene 1 (Wt1) expression at multiple levels Nucleic Acids Res., July 1, 2008; 36(12): 4067 - 4078. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zhang, A. Wali, C. V. Ramana, and A. K. Rishi Cell Growth Inhibition by Okadaic Acid Involves Gut-Enriched Kruppel-like Factor Mediated Enhanced Expression of c-Myc Cancer Res., November 1, 2007; 67(21): 10198 - 10206. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Cetinkaya, A. Hultquist, Y. Su, S. Wu, F. Bahram, S. Pahlman, I. Guzhova, and L.-G. Larsson Combined IFN-{gamma} and retinoic acid treatment targets the N-Myc/Max/Mad1 network resulting in repression of N-Myc target genes in MYCN-amplified neuroblastoma cells Mol. Cancer Ther., October 1, 2007; 6(10): 2634 - 2641. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wang, C. Hu, and J. Zhu Transcriptional Silencing of a Novel hTERT Reporter Locus during In Vitro Differentiation of Mouse Embryonic Stem Cells Mol. Biol. Cell, February 1, 2007; 18(2): 669 - 677. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G.-S. Shieh, A.-L. Shiau, Y.-T. Yo, P.-R. Lin, C.-C. Chang, T.-S. Tzai, and C.-L. Wu Low-Dose Etoposide Enhances Telomerase-Dependent Adenovirus-Mediated Cytosine Deaminase Gene Therapy through Augmentation of Adenoviral Infection and Transgene Expression in a Syngeneic Bladder Tumor Model. Cancer Res., October 15, 2006; 66(20): 9957 - 9966. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Maurelli, G. Zambruno, L. Guerra, C. Abbruzzese, G. Dimri, M. Gellini, S. Bondanza, and E. Dellambra Inactivation of p16INK4a (inhibitor of cyclin-dependent kinase 4A) Immortalizes Primary Human Keratinocytes By Maintaining Cells in the Stem Cell Compartment FASEB J, July 1, 2006; 20(9): 1516 - 1518. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, N. Idamakanti, T. Arroyo, S. Thorne, T. Reid, S. Nichols, M. VanRoey, G. Colbern, N. Nguyen, O. Tam, et al. Dual Promoter-Controlled Oncolytic Adenovirus CG5757 Has Strong Tumor Selectivity and Significant Antitumor Efficacy in Preclinical Models Clin. Cancer Res., December 15, 2005; 11(24): 8845 - 8855. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Renaud, D. Loukinov, F. T. Bosman, V. Lobanenkov, and J. Benhattar CTCF binds the proximal exonic region of hTERT and inhibits its transcription Nucleic Acids Res., December 2, 2005; 33(21): 6850 - 6860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Quante, S. Heeg, A. von Werder, G. Goessel, C. Fulda, M. Doebele, H. Nakagawa, R. Beijersbergen, H. E. Blum, and O. G. Opitz Differential transcriptional regulation of human telomerase in a cellular model representing important genetic alterations in esophageal squamous carcinogenesis Carcinogenesis, November 1, 2005; 26(11): 1879 - 1889. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Ritz, O. Kuhle, S. Riethdorf, B. Sipos, W. Deppert, C. Englert, and C. Gunes A Novel Transgenic Mouse Model Reveals Humanlike Regulation of an 8-kbp Human TERT Gene Promoter Fragment in Normal and Tumor Tissues Cancer Res., February 15, 2005; 65(4): 1187 - 1196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Matsumura-Arioka, K. Ohtani, T. Hara, R. Iwanaga, and M. Nakamura Identification of two distinct elements mediating activation of telomerase (hTERT) gene expression in association with cell growth in human T cells Int. Immunol., February 1, 2005; 17(2): 207 - 215. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yang, C. C. Ou, R. I. Feldman, S. V. Nicosia, P. A. Kruk, and J. Q. Cheng Aurora-A Kinase Regulates Telomerase Activity through c-Myc in Human Ovarian and Breast Epithelial Cells Cancer Res., January 15, 2004; 64(2): 463 - 467. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. R. McMurray and D. J. McCance Human Papillomavirus Type 16 E6 Activates TERT Gene Transcription through Induction of c-Myc and Release of USF-Mediated Repression J. Virol., September 15, 2003; 77(18): 9852 - 9861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kraemer, S. Fuessel, U. Schmidt, M. Kotzsch, B. Schwenzer, M. P. Wirth, and A. Meye Antisense-mediated hTERT Inhibition Specifically Reduces the Growth of Human Bladder Cancer Cells Clin. Cancer Res., September 1, 2003; 9(10): 3794 - 3800. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Takeda, H. Inaba, M. Yamazaki, S. Kyo, T. Miyamoto, S. Suzuki, T. Ehara, T. Kakizawa, M. Hara, L. J. DeGroot, et al. Tumor-Specific Gene Therapy for Undifferentiated Thyroid Carcinoma Utilizing the Telomerase Reverse Transcriptase Promoter J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3531 - 3538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Veldman, X. Liu, H. Yuan, and R. Schlegel Human papillomavirus E6 and Myc proteins associate in vivo and bind to and cooperatively activate the telomerase reverse transcriptase promoter PNAS, July 8, 2003; 100(14): 8211 - 8216. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Horikawa and J. C. Barrett Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms Carcinogenesis, July 1, 2003; 24(7): 1167 - 1176. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Kurz, Y. Hong, E. Trivier, H.-L. Huang, S. Decary, G. H. Zang, T. F. Luscher, and J. D. Erusalimsky Fibroblast Growth Factor-2, But Not Vascular Endothelial Growth Factor, Upregulates Telomerase Activity in Human Endothelial Cells Arterioscler Thromb Vasc Biol, May 1, 2003; 23(5): 748 - 754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Szutorisz, J. Lingner, A. P. Cuthbert, D. A. Trott, R. F. Newbold, and M. Nabholz A Chromosome 3-encoded Repressor of the Human Telomerase Reverse Transcriptase (hTERT) Gene Controls the State of hTERT Chromatin Cancer Res., February 1, 2003; 63(3): 689 - 695. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Stewart Multiple Levels of Telomerase Regulation Mol. Interv., December 1, 2002; 2(8): 481 - 483. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. Won, J. Yim, and T. K. Kim Sp1 and Sp3 Recruit Histone Deacetylase to Repress Transcription of Human Telomerase Reverse Transcriptase (hTERT) Promoter in Normal Human Somatic Cells J. Biol. Chem., October 4, 2002; 277(41): 38230 - 38238. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-S. Cong, W. E. Wright, and J. W. Shay Human Telomerase and Its Regulation Microbiol. Mol. Biol. Rev., September 1, 2002; 66(3): 407 - 425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Dimri, J.-L. Martinez, J. J. L. Jacobs, P. Keblusek, K. Itahana, M. van Lohuizen, J. Campisi, D. E. Wazer, and V. Band The Bmi-1 Oncogene Induces Telomerase Activity and Immortalizes Human Mammary Epithelial Cells Cancer Res., August 15, 2002; 62(16): 4736 - 4745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Horikawa, P. L. Cable, S. J. Mazur, E. Appella, C. A. Afshari, and J. C. Barrett Downstream E-Box-mediated Regulation of the Human Telomerase Reverse Transcriptase (hTERT) Gene Transcription: Evidence for an Endogenous Mechanism of Transcriptional Repression Mol. Biol. Cell, August 1, 2002; 13(8): 2585 - 2597. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. J. Mauro and D. N. Foster Regulators of Telomerase Activity Am. J. Respir. Cell Mol. Biol., May 1, 2002; 26(5): 521 - 524. [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cerezo, H. Kalthoff, M. Schuermann, B. Schafer, and P. Boukamp Dual regulation of telomerase activity through c-Myc-dependent inhibition and alternative splicing of hTERT J. Cell Sci., March 15, 2002; 115(6): 1305 - 1312. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-L. Mergny, J.-F. Riou, P. Mailliet, M.-P. Teulade-Fichou, and E. Gilson Natural and pharmacological regulation of telomerase Nucleic Acids Res., February 15, 2002; 30(4): 839 - 865. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Nomoto, M. Maekawa, K. Sugano, M. Ushiama, N. Fukayama, S. Fujita, and T. Kakizoe Methylation Status and Expression of Human Telomerase Reverse Transcriptase mRNA in Relation to Hypermethylation of the p16 gene in Colorectal Cancers as Analyzed by Bisulfite PCR-SSCP Jpn. J. Clin. Oncol., January 1, 2002; 32(1): 3 - 8. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-L. Ducrest, M. Amacker, Y. D. Mathieu, A. P. Cuthbert, D. A. Trott, R. F. Newbold, M. Nabholz, and J. Lingner Regulation of Human Telomerase Activity: Repression by Normal Chromosome 3 Abolishes Nuclear Telomerase Reverse Transcriptase Transcripts but Does Not Affect c-Myc Activity Cancer Res., October 1, 2001; 61(20): 7594 - 7602. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Pendino, M. Flexor, F. Delhommeau, D. Buet, M. Lanotte, and E. Ségal-Bendirdjian Retinoids down-regulate telomerase and telomere length in a pathway distinct from leukemia cell differentiation PNAS, May 18, 2001; (2001) 111464998. [Abstract] [Full Text]
|
|
|
|
|
|
T. Veldman, I. Horikawa, J. C. Barrett, and R. Schlegel Transcriptional Activation of the Telomerase hTERT Gene by Human Papillomavirus Type 16 E6 Oncoprotein J. Virol., May 1, 2001; 75(9): 4467 - 4472. [Abstract] [Full Text]
|
|
|
|
|
|
D. Xu, N. Popov, M. Hou, Q. Wang, M. Bjorkholm, A. Gruber, A. R. Menkel, and M. Henriksson Switch from Myc/Max to Mad1/Max binding and decrease in histone acetylation at the telomerase reverse transcriptase promoter during differentiation of HL60 cells PNAS, March 27, 2001; 98(7): 3826 - 3831. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-S. Cong and S. Bacchetti Histone Deacetylation Is Involved in the Transcriptional Repression of hTERT in Normal Human Cells J. Biol. Chem., November 10, 2000; 275(46): 35665 - 35668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Ogretmen, J. M. Kraveka, D. Schady, J. Usta, Y. A. Hannun, and L. M. Obeid Molecular Mechanisms of Ceramide-mediated Telomerase Inhibition in the A549 Human Lung Adenocarcinoma Cell Line J. Biol. Chem., August 24, 2001; 276(35): 32506 - 32514. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Knight, M. A. Cotter II, and E. S. Robertson The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Transactivates the Telomerase Reverse Transcriptase Promoter J. Biol. Chem., June 15, 2001; 276(25): 22971 - 22978. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Pendino, M. Flexor, F. Delhommeau, D. Buet, M. Lanotte, and E. Segal-Bendirdjian Retinoids down-regulate telomerase and telomere length in a pathway distinct from leukemia cell differentiation PNAS, June 5, 2001; 98(12): 6662 - 6667. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
