Cancer Research Cancer Research Funding Available  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Günes, C.
Right arrow Articles by Englert, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Günes, C.
Right arrow Articles by Englert, C.
[Cancer Research 60, 2116-2121, April 15, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Expression of the hTERT Gene Is Regulated at the Level of Transcriptional Initiation and Repressed by Mad1

Çagatay Günes, Serge Lichtsteiner, Alain P. Vasserot and Christoph Englert1

Research Center Karlsruhe, Institute of Genetics, 76344 Eggenstein-Leopoldshafen, Germany [IC. G., C. E.], and Geron Corporation, Menlo Park, California 94025 [S. L., A. P. V.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Telomerase, an enzymatic activity responsible for the replication of chromosome end structures, is strongly upregulated in most human cancers. In contrast, most differentiated tissues are telomerase negative. The rate-limiting step for telomerase activity seems to be the expression of the catalytic subunit of the enzyme, encoded by the human telomerase reverse transcriptase (hTERT) gene. The precise mechanism of how hTERT is regulated has not been elucidated yet. We show here that the down-regulation of hTERT mRNA during 12-O-tetradecanoylphorbol-13-acetate-induced differentiation of human U937 cells is a consequence of a fast decrease in the rate of transcription rather than changes in its half-life. The only transcription factor that has so far been implicated in the regulation of hTERT expression is the c-Myc oncoprotein. Our analysis shows that another member of the myc/max/mad network, mad1, encoding a transcriptional repressor that is significantly increased by 12-O-tetradecanoylphorbol-13-acetate treatment, represses hTERT promoter-driven reporter gene activity in transient transfection assays. This effect is dependent on the NH2 terminal domain of Mad1, which mediates the association with the transcriptional corepressor mSin3. Our findings suggest the involvement of an additional transcription factor in the regulation of hTERT expression and may provide a model for how hTERT activity is controlled during the differentiation process in human somatic tissues.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Telomerase is a ribonucleoprotein complex that is responsible for the complete replication of chromosomal ends. These end structures, named telomeres, serve as protective caps and consist of short tandemly repeated DNA sequences. In humans, this sequence is TTAGGG, and the average telomere length is 5–15 kb (1 , 2) . Upon each cell division the chromosomal ends shorten at a rate of ~50–200 bp (3) . This molecular erosion sets a physical limit to the potential number of cell divisions and serves as a "mitotic clock" defining the lifespan of somatic cells. One mechanism to escape this limitation is the activation of telomerase. Because telomerase can reset the mitotic clock, it has been linked to the processes of tumorigenesis and aging.

To date, three components associated with telomerase activity in humans have been identified. The RNA component of telomerase is encoded by the hTR gene (Refs. 4 and 5 ; now called hTER) and functions as the template for elongation of the telomeric repeat units. hTER is constitutively expressed in all cells and is therefore not likely to be involved in the regulation of telomerase activity (6) . The same is true for another protein that is associated with telomerase, the product of the TP1/TLP1 gene (now called hTEP1), which is also expressed ubiquitously (7 , 8) . Recently, the catalytic subunit of human telomerase has been cloned and named hTERT2 because it possesses the activity of an RNA-dependent DNA polymerase (9, 10, 11) . Only hTER and hTERT are required for the reconstitution of telomerase activity in vitro and therefore represent the minimal catalytic core of telomerase in humans (12) .

Transfection of telomerase-negative cells with an hTERT cDNA has demonstrated that hTERT expression is rate-limiting for telomerase activity (13, 14, 15) . Moreover, cells that ectopically express hTERT overcome crisis and have an extended life span, supporting the causal relationship between the shortening of telomeres and cellular senescence (16 , 17) . Telomerase activity has been shown to be associated with proliferation (18 , 19) ; therefore, it is not surprising that almost all immortal and cancer cells display significant telomerase activity and express hTERT (20 , 21) . These observations and the finding that the myc oncogene can activate hTERT expression (22, 23, 24, 25) indicate that this gene may play a critical role in tumorigenesis.

While telomerase becomes activated during neoplastic transformation, telomerase activity decreases during differentiation processes, which are accompanied by loss of proliferative potential. This has been studied in embryonic stem cells that were differentiated by the removal of leukemia inhibitory factor from the culture medium and in F9 teratocarcinoma after retinoic acid-induced differentiation (26) . Loss of telomerase activity upon differentiation was also demonstrated in K-562 human erythroid leukemia cells as well as in HL-60 human promyelocytic leukemia cells (26 , 27) . In the latter, telomerase down-regulation was demonstrated to be an early event of the differentiation process and not its consequence (28) . Repression of telomerase activity was subsequently demonstrated to be associated with the down-regulation of hTERT expression upon differentiation of HL-60 cells with TPA (10 , 29) . It is, however, not yet clear at which level of gene expression this down-regulation occurs.

The only transcription factor that has thus far been implicated in the regulation of hTERT is encoded by the c-myc oncogene (22, 23, 24, 25) . The ability of c-Myc to function as a transcription factor has been shown to depend upon its dimerization with the protein Max (reviewed in Ref. 30 ). In addition to the formation of stable complexes with c-Myc, Max also heterodimerizes with proteins of the Mad(Mxi1) family (30, 31, 32) . These Mad/Max complexes act in an antagonistic manner to c-Myc/Max-induced transactivation and result in potent repression of gene expression. How these additional members of the Myc/Max/Mad network affect hTERT expression has, however, not been studied yet.

We have used the differentiation of human hematopoietic U937 cells by phorbol ester as a model to study the regulation of hTERT expression. We demonstrate here that the half-life of the hTERT mRNA is not altered by TPA treatment. Nuclear run-off analysis shows that the down-regulation of hTERT is a consequence of a decrease in transcriptional initiation of the gene. Furthermore, the decrease in hTERT activity is not preceded by a down-regulation of the oncoprotein c-Myc but is paralleled by an increase in levels of mad1. In transient transfection assays, Mad1 was able to repress hTERT promoter activity, an effect that was dependent on an E-box consensus sequence. The repressive effect of Mad1 also required an intact NH2 terminal domain, which mediates the interaction with the corepressor mSin3.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Cell Culture, Differentiation, and Immunoprecipitations.
U937 cells were obtained from the European Collection of Cell Cultures and were kept in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum. For differentiation, cells were seeded at a density of 1 x 105/ml and TPA (10 ng/ml in 0.1% DMSO) or retinoic acid (5 x 10-6 M in ethanol) was added to the medium. The transcriptional inhibitor actinomycin D was used at 5 µg/ml. Differentiation was assessed by expression of the monocytic markers CD11a and CD11c as well as CD4, which is expressed on immature U937 cells. Analysis was done using FACS assay with the respective monoclonal antibodies (PharMingen).

Metabolic labeling followed by high stringency immunoprecipitation was done as described (33) . For the detection of Mad1, a polyclonal antiserum directed against the COOH terminus of human Mad1 was used (Santa Cruz Biotechnology).

Constructs, Transfections, and Reporter Gene Assays.
Generation of the hTERT promoter constructs pGRN150 and pGRN261 has been described (22) . pGRN176 has been generated by digestion of pGRN150 with PmlI and SrfI and subsequent religation. Construct pGRN316 contains nucleotides +1 to -246 from the hTERT genomic sequence, i.e., sequences immediately upstream of the ATG codon, and has the same 3' configuration as pGRN261 (cloned into the EcoRI site of pSEAP2-Basic).

U937 cells were transfected in six-well dishes using SuperFect (Qiagen) with 0.6 µg of reporter plasmid, 1.2 µg of expression plasmid, and 0.2 µg of internal control plasmid (pGL3 Control; Promega). Reporter gene activity was determined by the SEAP reporter gene assay (Roche).

RT-PCR Analysis and TRAP Assay.
First-strand cDNA synthesis was done using 2–5 µg of total RNA with SuperScript reverse transcriptase (Life Technologies, Inc.) in the presence of 100 ng of oligo-dT15 primers in a volume of 20 µl. The cDNA was diluted 1:5 in water, and 5 µl of the reverse transcriptase reaction was used for PCR analysis in a total volume of 50 µl containing 0.2 µM specific primers, 10% DMSO, 1.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphates, and 1 unit of Taq polymerase (Life Technologies, Inc.). For radioactive PCR analysis, 2.5 µCi of [{alpha}-32P]dCTP (3000 Ci/mmol; Amersham) was added to the reaction. Amplification products were analyzed on 5% nondenaturing polyacrylamide gels. PCR analysis (94°C, 30 s; 55°C, 30 s; and 72°C, 1 min) was done for 33 (hTERT), 30 (hTEP1), or 21 cycles (GAPDH). For radioactive PCR, the linear range of amplification was determined previously, and amplification was done for 25 cycles for hTERT and hTEP1.

The primers were hTERT-5' (TCTGGATTTGCAGGTGAACAGCC) and hTERT-3' (GGGTGGCCATCAGTCCAGGATGG) for hTERT, hTEP1-5' (TCAAGCCAAACC-TGAATCTGAG) and hTEP1-3' (CCCGAGTGAAT-CTTTCTACGC) for hTEP1, as well as GAPDH-5' (ACCACAGTCCATGCCATCAC) and GAPDH-3' (TCCACCACCCTGTTGCTGTA) for GAPDH.

To determine the enzymatic activity of telomerase in cell extracts, we used the TRAP as described (20) with the TRAPeze kit (Oncor) according to the recommendations of the supplier. Each sample contains the equivalent of 1 x 104 cells.

Nuclear Run-Off and Electrophoretic Mobility Shift Assays.
Nuclear run-off analysis was performed as described (34) with some modifications. For the isolation of nuclei from U937 cells, 5 x 107 cells were used per time point. All procedures were carried out at 4°C. Cells were collected by centrifugation and washed twice in PBS. The cell pellet was loosened by careful vortexing, resuspended in 4 ml of lysis buffer [10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, and 0.5% (v/v) NP40] and incubated on ice for 5 min. Nuclei were pelleted by centrifugation at 500 x g for 5 min. The supernatant was used for the isolation of cytoplasmic RNA. The nuclei were resuspended in 4 ml of lysis buffer and again centrifuged. The pellet was resuspended in 200 µl of glycerol storage buffer [50 mM Tris-HCl (pH 8.3), 40% (v/v) glycerol, 5 mM MgCl2, and 0.1 mM EDTA] and either used immediately for the run-off assay or frozen in liquid N2.

For the run-off assay, 200 µl of nuclei were mixed with 200 µl of reaction buffer [10 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 300 mM KCl, 0.5 mM each of ATP, CTP, and GTP, and 100 µCi of [{alpha}-32P]UTP (800 Ci/mmol; Amersham)] and incubated with shaking for 30 min at 30°C. Subsequently, DNA was digested by the addition of 20 µl of DNase I (1 mg/ml; RNase free) and incubation for 15 min at 30°C. Isolation of RNA was done using the TRIzol reagent (Life Technologies, Inc.) following the recommendations of the manufacturer.

Hybridization was performed with 1 x 106 cpm labeled RNA per sample using 5 ml of the Rapid-hyb buffer (Amersham) according to the manufacturer’s recommendations. To enhance sensitivity, the hybridization was done overnight. To reduce background signals, filters were washed under stringent conditions: two times in 2 x SSC/0.1% SDS, two times in 0.2 x SSC/0.1% SDS, and two times in 0.1x SSC/0.1% SDS for 25 min at 65°C. For each gene, 1 µg of a specific fragment was immobilized on a nylon membrane: for hTERT and GAPDH, the 450-bp (position 3014–3464) or the 449-bp (position 586–1039) amplification products described above; for c-fos, a 1-kbp PstI fragment; and for c-jun, a 1.4-kbp SmaI-HindIII fragment of the respective cDNAs was used.

Electrophoretic mobility shift assays were performed using a 26-bp oligonucleotide containing the consensus E-box (Santa Cruz Biotechnology) and nuclear extracts from U937 cells, which were prepared as described (35) . Approximately 10 fmol of labeled oligonucleotide (25,000 cpm) were incubated with 3 µg of nuclear extract in the presence of 1 µg of poly(deoxyinosinic-deoxycytidylic acid) in 1x binding buffer (36) for 20 min at room temperature. Subsequently, 3 µg of a c-Myc-specific antibody (N-262; Santa Cruz Biotechnology) or of an E2F-1-specific antibody (as a control) were added to the mixture, and after 10 min at room temperature, binding was allowed to occur overnight on ice. Complexes were separated on 5% nondenaturing polyacrylamide gels that were run at 4°C.

Northern Blot and Array Analysis.
For Northern analysis, 20 µg of cytoplasmic RNA were immobilized on a filter and sequentially probed with specific fragments to detect the c-myc (2.4-kb) and mad1 (3.8 and 6.5-kb) mRNA without stripping the filter. To analyze the expression of mad1 in human tumors, the commercially available Matched Tumor/Normal Expression Array (Clontech) was used. Hybridization with a mad1-specific probe was done according to the manufacturer.


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Down-Regulation of Telomerase Activity and hTERT Expression upon Differentiation of U937 Cells.
To study the regulation of telomerase activity as well as hTERT mRNA expression upon cellular differentiation, we have chosen the human myeloid leukemic U937 cell line. RA as well as phorbol esters such as TPA induce U937 cells to differentiate along the monocytic and macrophage-like pathway. These cells are thus very similar to HL-60 cells, where telomerase activity has been studied (10 , 26 , 37) but are much easier to transfect and are therefore advantageous for the present study. In the first set of experiments, we analyzed whether the hTERT gene as well as telomerase activity is regulated in a similar manner in U937 cells as it has been reported for HL-60 cells. We performed RT-PCR analysis with hTERT- and hTEP1-specific primers at various time points after induction of differentiation of U937 cells with RA or TPA. As demonstrated in Fig. 1aCitation , differentiation of these cells leads to a down-regulation of hTERT mRNA after 5 h and to its complete disappearance after 24 h. In contrast, the expression of hTEP1 was slightly increased after the addition of the differentiating agents, an observation that has been reported earlier for HL-60 cells (38) . TRAP assays using extracts from differentiating U937 cells showed that the addition of RA or TPA leads to a decrease of telomerase activity (Fig. 1b)Citation , although with much slower kinetics when compared with the hTERT mRNA. After 24 h, a reduction of telomerase activity was visible, and after 72 h, all the activity had disappeared. These data confirm that expression of hTERT is the rate-limiting step for telomerase activity. To verify that the experimental conditions used here resulted in the differentiation of U937 cells, we have examined expression of the cell surface markers CD4 as well as CD11a and CD11c (Fig. 1c)Citation . Whereas expression of the monocytic antigens CD11a and CD11c increased upon TPA treatment, CD4 surface expression, which is a hallmark for immature U937 cells, was lost rapidly. We conclude from these experiments that hTERT regulation in U937 cells is tightly controlled and that these cells therefore provide a useful model for studying the regulation of the hTERT gene upon differentiation. For all of the subsequent experiments, only TPA was used as a differentiating agent.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Down-regulation of hTERT mRNA level and telomerase activity upon RA and TPA treatment of U937 cells. a, RT-PCR analysis with primers specific for hTERT, hTEP1, and GAPDH. Exponentially growing cells were induced with either RA or TPA for the times indicated. b, TRAP assay using extracts from U937 cells that were treated identically to the cells used in a. The positive control (pos. control) and the internal control (IC, reveals the absence of PCR inhibitors) are provided by the manufacturer of the kit (TRAPeze kit). For the negative controls (neg. control), extracts from untreated cells were used. M, 100-bp marker. c, differentiation of U937 cells. Cells were induced by TPA, and surface antigen expression was measured by FACS analysis using specific antibodies.

 
The Half-Life of the hTERT mRNA Is Not Altered by TPA.
The rapid down-regulation of hTERT mRNA after TPA stimulation could result from a short half-life of the hTERT message. To test this and to examine whether TPA-mediated changes in hTERT mRNA stability contribute to its rapid disappearance, we performed semiquantitative RT-PCR analysis using DNA from actinomycin D-treated cells. In the presence of actinomycin D, a significant decrease of the hTERT mRNA could be observed as early as 1 h after addition of the drug (Fig. 2)Citation . After 4 h, hTERT message had almost completely disappeared. This regulation was specific because hTEP1 mRNA was affected to a much lesser extent by the inhibitor. Densitometric analysis revealed the half-life of hTERT in U937 cells to be ~50 min. The rate of decay of the hTERT mRNA was not affected by the addition of TPA, which suggests that the induction of differentiation did not change hTERT mRNA stability. The decrease of hTERT message induced by TPA was slower than that induced by actinomycin D alone or by both drugs, indicating that there is still residual transcription of the hTERT gene after 6 h of TPA treatment.



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Determination of the hTERT mRNA half-life. top, semiquantitative RT-PCR analysis. Exponentially growing U937 cells were treated with 10 ng/ml TPA (T), 5 µg/ml actinomycin D (ActD), or with a combination of both (T+D) for the times indicated; total RNA was extracted, and RT-PCR analysis was performed with primers specific for hTERT and hTEP1. To stay within a linear amplification range, PCR was done for 25 cycles in the presence of radiolabeled dCTP. bottom, quantitation of the hTERT mRNA levels in the top panel using the program NIH Image 1.61. The signal of the uninduced sample was set to 100%.

 
The Rate of hTERT Transcription Is Decreased by TPA Treatment.
Because altered mRNA stability is not responsible for the down-regulation of the hTERT mRNA upon induction of differentiation, we analyzed the level of initiation of hTERT transcription upon TPA treatment. Before and at various time points after induction of differentiation by the addition of TPA, nuclei were isolated, and nuclear run-off experiments were performed. As shown in Fig. 3Citation , the level of transcription of hTERT started to decrease as early as 15 min and was significantly down-regulated after 8 h of induction. In contrast, GAPDH expression was only mildly altered by the addition of TPA. To verify the effect of TPA on gene expression, we have included the immediate early genes c-fos and c-jun in the experiment. The expected transient rise in the expression of both genes that can be observed after 15 min serves as a positive control. These results indicate that the down-regulation of hTERT mRNA upon differentiation of U937 cells is predominantly caused by a decrease of the transcriptional activity of the gene.



View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. hTERT mRNA is regulated at the transcriptional level. top, nuclear run-off analysis using nuclei from U937 cells that were either untreated or treated with TPA for the times indicated. Radiolabeled RNA was used as a probe for filters with immobilized fragments specific for hTERT, c-fos, c-jun, and GAPDH. Filters were exposed for 7 days. bottom, quantitation of the signals from the run-off assay shown in the top panel. To calculate the relative amounts of newly transcribed RNAs, signals were quantitated using the program NIH Image 1.61. Signals from uninduced cells were set to 100%. The relative increase of the hTERT mRNA at the 4-h time point might be attributable to a suboptimal induction of the cells.

 
hTERT Down-Regulation Is Not Preceded by Loss of c-myc Activity.
The c-myc oncogene has been implicated in the regulation of the hTERT gene (22, 23, 24, 25) . Using reporter constructs harboring fragments of the hTERT promoter, we could confirm that the overexpression of c-myc leads to activation of the hTERT promoter in transient transfection assays in U937 cells (Fig. 4f)Citation . We then wanted to investigate the level of endogenous c-myc expression in response to TPA treatment in our cell system. Surprisingly, RT-PCR (data not shown) and Northern analysis did not reveal significant changes in c-myc mRNA, whereas hTERT levels decreased after addition of the drug (Fig. 4a)Citation . To analyze possible posttranscriptional effects, we examined the level of c-Myc protein. The amount of c-Myc that could be supershifted from complexes binding to an E-box-containing fragment slightly decreased after TPA addition (Fig. 4b)Citation . This decrease, however, was not complete, and there was still significant c-Myc activity when hTERT expression had already disappeared. This observation represents an exception to the general observation that c-myc mRNA and protein levels are turned off in differentiating cells. A similar observation, however, has been made in a subline of U937 cells in which TPA treatment did not result in a decrease in c-myc levels (39) . Moreover, a c-Myc target gene, ODC decreased rapidly, despite high levels of c-Myc, but the mechanism by which ODC expression was down-regulated remained undetermined. As in the case with ODC, our results imply that c-Myc is not the only determinant of hTERT activity in U937 cells.



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Effects of c-Myc and Mad1 on hTERT expression. a, analysis of hTERT mRNA levels by RT-PCR using RNA from cells treated with TPA for the times indicated (top). Middle, Northern Blot analysis of c-myc and mad1 expression. Bottom, the same filter was subsequently reprobed with a GAPDH probe as a loading control. b, electrophoretic mobility shift assay (top) using extracts from U937 cells treated with TPA for the times indicated. Note that the extracts for the EMSA experiment were made from the same cells that were used for the RNA preparation analyzed in a. The probe contained a consensus E-box sequence. c-Myc DNA binding activity was analyzed with a c-Myc-specific antibody. As a control for specificity, an E2F-1 antibody was used. The synthesis of Mad1 (bottom) during U937 differentiation was analyzed by metabolic labeling and subsequent immunoprecipitation using a Mad1-specific antibody. c, schematic representation of the genomic hTERT promoter fragments contained in the reporter constructs used in d, e, and f. Arrow, the transcriptional start site of hTERT. d, results of transient transfection assays in which a mad1 expression vector (Mad1-wt), a mad{Delta}N expression vector (Mad1-mut), or the respective empty vector was cotransfected into U937 cells with different reporter plasmids. e, dose dependence of Mad1-mediated repression. Increasing amounts of the mad1 expression vector (in µg) were cotransfected into U937 cells with a constant amount of the pGRN316 reporter construct. f, results of transient transfection assays in which a c-myc expression vector or the respective empty vector was cotransfected into U937 cells with different reporter plasmids. Results in d–f are given as relative activation/repression of the expression constructs as compared with the empty vector. Every experiment has been performed at least five times; in each case, a representative experiment is shown. Bars, SE.

 
Mad1 Can Repress the hTERT Promoter.
Whereas c-myc and max mRNA levels (data not shown) remained constant after TPA treatment, the amount of mad1 mRNA and protein increased dramatically after induction of differentiation (Fig. 4, a and b)Citation . This observation is in agreement with earlier reports (40) and prompted us to test the effect of Mad1 on the hTERT promoter. Overexpression of Mad1 in transient transfection assays in U937 cells resulted in a consistent and significant decrease of hTERT promoter activity (Fig. 4d)Citation . This repressive effect of Mad1 was dose dependent (Fig. 4e)Citation . The hTERT promoter contains two E-box consensus sites, one of which is located close to the translational initiation codon at position -29 to -34 (proximal E-box), whereas the second one is at position -238 to -243 with regard to the ATG (distal E-box; Fig. 4cCitation ; Ref. 22 ). The effect of Mad1 on the hTERT promoter was dependent on an intact proximal E-box. Deletion of this E-box led to reporter gene activity that was almost indistinguishable from a construct without an obvious E-box consensus. This observation was paralleled by the effect of c-Myc on the hTERT promoter, which was also mainly exerted via the evolutionarily conserved proximal E-box (Fig. 4fCitation ; Ref. 22 ). Thus, c-Myc and Mad1 exert their transcriptional effects via the same site in the hTERT promoter. A comparison of the c-Myc and Mad1 effects on the reporters pGRN261 and pGRN316 suggests that sequences upstream of both E-boxes appear to contribute to the repression of the hTERT promoter by Mad1 and its activation by c-Myc. Although there is no additional E-box in the 5' region of pGRN261, the reporter harbors several additional sequence elements that deviate by only 1 bp from the canonical CACGTG. Whether c-Myc/Max and/or Mad1/Max complexes bind to these sites, however, remains to be shown. To exclude competition between Mad1 and c-Myc as the basis for the observed effect, we have used a mutant form of Mad1. The Mad{Delta}N mutant (41) is devoid of the mSin interaction domain (SID) and is therefore not able to actively repress transcription. As can be seen in Fig. 4dCitation , cotransfection of Mad{Delta}N does not lead to repression of the hTERT promoter constructs. In contrast, the mutant led to a consistent increase in reporter gene activity. This effect could be explained by the displacement of endogenous Mad1, which is expressed at a low level in undifferentiated cells (Fig. 4bCitation , bottom), by the overexpressed mutant form. Thus, repression of the hTERT promoter by Mad1 involves an active repression mechanism rather than simple competition with c-Myc.

Mad1 Expression Is Lost in Human Tumors.
To analyze the expression of mad1 in human tumors, we have measured mad1 mRNA levels in an arrayed panel of human tumor and the respective normal tissue (Fig. 5)Citation . In a number of tissues, mad1 expression was too low to be analyzed; but in the particular case of colon cancers, as many as 91% (10 of 11) of the tumors showed decreased mad1 mRNA levels. In the combined 29 samples of tumors from colon, lung, stomach, and rectum, mad1 expression was lost or down-regulated in 69% (20 of 29) as compared with normal tissue from the same patient. Of note, several members of the Mad family have been discussed as tumor suppressors (42) . On the basis of our observations, one can therefore speculate that the repression of the hTERT promoter by Mad1 limits the replicative potential of a cell and thereby contributes to the tumor suppressor phenotype.



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Mad1 is down-regulated in human tumors. For the analysis of mad1 expression in human tumors, a matched array of normal (N) and tumor tissue (T) from different patients was analyzed with a mad1-specific probe. Because the expression level of mad1 varies between different organs, only those tissues with significant mad1 levels are shown.

 
In summary, we have demonstrated that the down-regulation of hTERT expression in differentiating U937 cells occurs at the level of transcriptional initiation. Furthermore we provide evidence that in addition to the c-Myc oncoprotein, the transcriptional repressor Mad1 regulates hTERT activity. To our knowledge, Mad1 is the first transcription factor identified that can repress the hTERT gene. This finding might also open up the possibility for novel therapeutic strategies with regard to telomerase inhibition. Finally, we think the cellular system used here is a useful model for the regulation of hTERT activity during the differentiation of somatic tissues.


    ACKNOWLEDGMENTS
 
We thank Dirk Eick for the c-myc expression construct and Bernhard Lüscher for the mad1, mad{Delta}N, and max constructs and valuable advice. We also thank Falk Weih, Michael Pankratz, and Bernhard Lüscher for reading and improving the manuscript; Martin Hegen for help with the FACS analysis; Carsten Weiss and the members of our lab for helpful discussions and suggestions; and Birgit Besenbeck, Stephan Brodbeck, and Robert Adams for excellent technical support.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Research Center Karlsruhe, Institute of Genetics, Hermann von Helmholtz-Platz 1, 76344 Eggenstein-Leopoldshafen, Germany. Phone: 49-7247-823444; Fax: 49-7247-823354; E-mail: christoph.englert{at}itg.fzk.de Back

2 The abbreviations used are: hTERT, human telomerase reverse transcriptase; TPA, 12-O-tetradecanoylphorbol-13-acetate; TRAP, telomeric repeat amplification protocol; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RA, retinoic acid; RT-PCR, reverse transcription-PCR; ODC, ornithine decarboxylase; FACS, fluorescence-activated cell sorter. Back

Received 10/27/99. Accepted 3/ 3/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Allshire R. C., Dempster M., Hastie N. D. Human telomeres contain at least three types of G-rich repeat distributed non-randomly. Nucleic Acids Res., 17: 4611-4627, 1989.[Abstract/Free Full Text]
  2. Moyzis R. K., Buckingham J. M., Cram L. S., Dani M., Deaven L. L., Jones M. D., Meyne J., Ratliff R. L., Wu J. R. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc. Natl. Acad. Sci. USA, 85: 6622-6626, 1988.[Abstract/Free Full Text]
  3. Vaziri H., Schachter F., Uchida I., Wei L., Zhu X., Effros R., Cohen D., Harley C. B. Loss of telomeric DNA during aging of normal and trisomy 21 human lymphocytes. Am. J. Hum. Genet., 52: 661-667, 1993.[Medline]
  4. Blasco M. A., Funk W., Villeponteau B., Greider C. W. Functional characterization and developmental regulation of mouse telomerase RNA. Science (Washington DC), 269: 1267-1270, 1995.[Abstract/Free Full Text]
  5. Feng J., Funk W. D., Wang S. S., Weinrich S. L., Avilion A. A., Chiu C. P., Adams R. R., Chang E., Allsopp R. C., Yu J., et al The RNA component of human telomerase. Science (Washington DC), 269: 1236-1241, 1995.[Abstract/Free Full Text]
  6. Avilion A. A., Piatyszek M. A., Gupta J., Shay J. W., Bacchetti S., Greider C. W. Human telomerase RNA and telomerase activity in immortal cell lines and tumor tissues. Cancer Res., 56: 645-650, 1996.[Abstract/Free Full Text]
  7. Harrington L., McPhail T., Mar V., Zhou W., Oulton R., Bass M. B., Arruda I., Robinson M. O. A mammalian telomerase-associated protein. Science (Washington DC), 275: 973-977, 1997.[Abstract/Free Full Text]
  8. Nakayama J., Saito M., Nakamura H., Matsuura A., Ishikawa F. TLP1: a gene encoding a protein component of mammalian telomerase is a novel member of WD repeats family. Cell, 88: 875-884, 1997.[Medline]
  9. Nakamura T. M., Morin G. B., Chapman K. B., Weinrich S. L., Andrews W. H., Lingner J., Harley C. B., Cech T. R. Telomerase catalytic subunit homologs from fission yeast and human. Science (Washington DC), 277: 955-959, 1997.[Abstract/Free Full Text]
  10. Meyerson M., Counter C. M., Eaton E. N., Ellisen L. W., Steiner P., Caddle S. D., Ziaugra L., Beijersbergen R. L., Davidoff M. J., Liu Q., Bacchetti S., Haber D. A., Weinberg R. A. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell, 90: 785-795, 1997.[Medline]
  11. Kilian A., Bowtell D. D., Abud H. E., Hime G. R., Venter D. J., Keese P. K., Duncan E. L., Reddel R. R., Jefferson R. A. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum. Mol. Genet., 6: 2011-2019, 1997.[Abstract/Free Full Text]
  12. Beattie T. L., Zhou W., Robinson M. O., Harrington L. Reconstitution of human telomerase activity in vitro.. Curr. Biol., 8: 177-180, 1998.[Medline]
  13. Weinrich S. L., Pruzan R., Ma L., Ouellette M., Tesmer V. M., Holt S. E., Bodnar A. G., Lichtsteiner S., Kim N. W., Trager J. B., Taylor R. D., Carlos R., Andrews W. H., Wright W. E., Shay J. W., Harley C. B., Morin G. B. Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nat. Genet., 17: 498-502, 1997.[Medline]
  14. Nakayama J., Tahara H., Tahara E., Saito M., Ito K., Nakamura H., Nakanishi T., Ide T., Ishikawa F. Telomerase activation by hTRT in human normal fibroblasts and hepatocellular carcinomas. Nat. Genet., 18: 65-68, 1998.[Medline]
  15. Counter C. M., Meyerson M., Eaton E. N., Ellisen L. W., Caddle S. D., Haber D. A., Weinberg R. A. Telomerase activity is restored in human cells by ectopic expression of hTERT (hEST2), the catalytic subunit of telomerase. Oncogene, 16: 1217-1222, 1998.[Medline]
  16. Bodnar A. G., Ouellette M., Frolkis M., Holt S. E., Chiu C. P., Morin G. B., Harley C. B., Shay J. W., Lichtsteiner S., Wright W. E. Extension of life-span by introduction of telomerase into normal human cells. Science (Washington DC), 279: 349-352, 1998.[Abstract/Free Full Text]
  17. Counter C. M., Hahn W. C., Wei W., Caddle S. D., Beijersbergen R. L., Lansdorp P. M., Sedivy J. M., Weinberg R. A. Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc. Natl. Acad. Sci. USA, 95: 14723-14728, 1998.[Abstract/Free Full Text]
  18. Belair C. D., Yeager T. R., Lopez P. M., Reznikoff C. A. Telomerase activity: a biomarker of cell proliferation, not malignant transformation. Proc. Natl. Acad. Sci. USA, 94: 13677-13682, 1997.[Abstract/Free Full Text]
  19. Lee H. W., Blasco M. A., Gottlieb G. J., Horner J. W., II, Greider C. W., DePinho R. A. Essential role of mouse telomerase in highly proliferative organs. Nature (Lond.), 392: 569-574, 1998.[Medline]
  20. Kim N. W., Piatyszek M. A., Prowse K. R., Harley C. B., West M. D., Ho P. L., Coviello G. M., Wright W. E., Weinrich S. L., Shay J. W. Specific association of human telomerase activity with immortal cells and cancer. Science (Washington DC), 266: 2011-2015, 1994.[Abstract/Free Full Text]
  21. Kolquist K. A., Ellisen L. W., Counter C. M., Meyerson M., Tan L. K., Weinberg R. A., Haber D. A., Gerald W. L. Expression of TERT in early premalignant lesions and a subset of cells in normal tissues. Nat. Genet., 19: 182-186, 1998.[Medline]
  22. Greenberg R. A., O’Hagan R. C., Deng H., Xiao Q., Hann S. R., Adams R. R., Lichtsteiner S., Chin L., Morin G. B., DePinho R. A. Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. Oncogene, 18: 1219-1226, 1999.[Medline]
  23. Greider C. W. Telomerase activation. One step on the road to cancer?. Trends Genet., 15: 109-112, 1999.[Medline]
  24. Wang J., Xie L. Y., Allan S., Beach D., Hannon G. J. Myc activates telomerase. Genes Dev., 12: 1769-1774, 1998.[Abstract/Free Full Text]
  25. Wu K. J., Grandori C., Amacker M., Simon-Vermot N., Polack A., Lingner J., Dalla-Favera R. Direct activation of TERT transcription by c-MYC. Nat. Genet., 21: 220-224, 1999.[Medline]
  26. Sharma H. W., Sokoloski J. A., Perez J. R., Maltese J. Y., Sartorelli A. C., Stein C. A., Nichols G., Khaled Z., Telang N. T., Narayanan R. Differentiation of immortal cells inhibits telomerase activity. Proc. Natl. Acad. Sci. USA, 92: 12343-12346, 1995.[Abstract/Free Full Text]
  27. Holt S. E., Wright W. E., Shay J. W. Regulation of telomerase activity in immortal cell lines. Mol. Cell. Biol., 16: 2932-2939, 1996.[Abstract]
  28. Savoysky E., Yoshida K., Ohtomo T., Yamaguchi Y., Akamatsu K., Yamazaki T., Yoshida S., Tsuchiya M. Down-regulation of telomerase activity is an early event in the differentiation of HL60 cells. Biochem. Biophys. Res. Commun., 226: 329-334, 1996.[Medline]
  29. Ramakrishnan S., Eppenberger U., Mueller H., Shinkai Y., Narayanan R. Expression profile of the putative catalytic subunit of the telomerase gene. Cancer Res., 58: 622-625, 1998.[Abstract/Free Full Text]
  30. Schreiber-Agus N., DePinho R. A. Repression by the Mad(Mxi1)-Sin3 complex. Bioessays, 20: 808-818, 1998.[Medline]
  31. Ayer D. E., Kretzner L., Eisenman R. N. Mad: a heterodimeric partner for Max that antagonizes Myc transcriptional activity. Cell, 72: 211-222, 1993.[Medline]
  32. Zervos A. S., Gyuris J., Brent R. Mxi1, a protein that specifically interacts with Max to bind Myc-Max recognition sites. Cell, 72: 223-232, 1993.[Medline]
  33. Larsson L. G., Bahram F., Burkhardt H., Luscher B. Analysis of the DNA-binding activities of Myc/Max/Mad network complexes during induced differentiation of U-937 monoblasts and F9 teratocarcinoma cells. Oncogene, 15: 737-748, 1997.[Medline]
  34. Greenberg M. E., Ziff E. B. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature (Lond.), 311: 433-438, 1984.[Medline]
  35. Schreiber E., Matthias P., Muller M. M., Schaffner W. Rapid detection of octamer binding proteins with "mini-extracts," prepared from a small number of cells. Nucleic Acids Res., 17: 6419 1989.[Free Full Text]
  36. Sommer A., Bousset K., Kremmer E., Austen M., Luscher B. Identification and characterization of specific DNA-binding complexes containing members of the Myc/Max/Mad network of transcriptional regulators. J. Biol. Chem., 273: 6632-6642, 1998.[Abstract/Free Full Text]
  37. Bestilny L. J., Brown C. B., Miura Y., Robertson L. D., Riabowol K. T. Selective inhibition of telomerase activity during terminal differentiation of immortal cell lines. Cancer Res., 56: 3796-3802, 1996.[Abstract/Free Full Text]
  38. Reichman T. W., Albanell J., Wang X., Moore M. A., Studzinski G. P. Downregulation of telomerase activity in HL60 cells by differentiating agents is accompanied by increased expression of telomerase-associated protein. J. Cell. Biochem., 67: 13-23, 1997.[Medline]
  39. Ryan K. M., Birnie G. D. Cell-cycle progression is not essential for c-Myc to block differentiation. Oncogene, 14: 2835-2843, 1997.[Medline]
  40. Ayer D. E., Eisenman R. N. A switch from Myc: Max to Mad:Max heterocomplexes accompanies monocyte/macrophage differentiation. Genes Dev., 7: 2110-2119, 1993.[Abstract/Free Full Text]
  41. Cerni C., Bousset K., Seelos C., Burkhardt H., Henriksson M., Luscher B. Differential effects by Mad and Max on transformation by cellular and viral onco-proteins. Oncogene, 11: 587-596, 1995.[Medline]
  42. Henriksson M., Luscher B. Proteins of the Myc network: essential regulators of cell growth and differentiation. Adv. Cancer Res., 68: 109-182, 1996.[Medline]



This article has been cited by other articles:


Home page
J. Virol.Home page
R. A. Katzenellenbogen, P. Vliet-Gregg, M. Xu, and D. A. Galloway
NFX1-123 Increases hTERT Expression and Telomerase Activity Posttranscriptionally in Human Papillomavirus Type 16 E6 Keratinocytes
J. Virol., July 1, 2009; 83(13): 6446 - 6456.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Wang, Y. Zhao, C. Hu, and J. Zhu
Differential repression of human and mouse TERT genes during cell differentiation
Nucleic Acids Res., May 1, 2009; 37(8): 2618 - 2629.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Bellon and C. Nicot
Central role of PI3K in transcriptional activation of hTERT in HTLV-I-infected cells
Blood, October 1, 2008; 112(7): 2946 - 2955.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. S. Makki, T. Heinzel, and C. Englert
TSA downregulates Wilms tumor gene 1 (Wt1) expression at multiple levels
Nucleic Acids Res., July 1, 2008; 36(12): 4067 - 4078.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Zhang, A. Wali, C. V. Ramana, and A. K. Rishi
Cell Growth Inhibition by Okadaic Acid Involves Gut-Enriched Kruppel-like Factor Mediated Enhanced Expression of c-Myc
Cancer Res., November 1, 2007; 67(21): 10198 - 10206.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
C. Cetinkaya, A. Hultquist, Y. Su, S. Wu, F. Bahram, S. Pahlman, I. Guzhova, and L.-G. Larsson
Combined IFN-{gamma} and retinoic acid treatment targets the N-Myc/Max/Mad1 network resulting in repression of N-Myc target genes in MYCN-amplified neuroblastoma cells
Mol. Cancer Ther., October 1, 2007; 6(10): 2634 - 2641.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Wang, C. Hu, and J. Zhu
Transcriptional Silencing of a Novel hTERT Reporter Locus during In Vitro Differentiation of Mouse Embryonic Stem Cells
Mol. Biol. Cell, February 1, 2007; 18(2): 669 - 677.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G.-S. Shieh, A.-L. Shiau, Y.-T. Yo, P.-R. Lin, C.-C. Chang, T.-S. Tzai, and C.-L. Wu
Low-Dose Etoposide Enhances Telomerase-Dependent Adenovirus-Mediated Cytosine Deaminase Gene Therapy through Augmentation of Adenoviral Infection and Transgene Expression in a Syngeneic Bladder Tumor Model.
Cancer Res., October 15, 2006; 66(20): 9957 - 9966.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
R. Maurelli, G. Zambruno, L. Guerra, C. Abbruzzese, G. Dimri, M. Gellini, S. Bondanza, and E. Dellambra
Inactivation of p16INK4a (inhibitor of cyclin-dependent kinase 4A) Immortalizes Primary Human Keratinocytes By Maintaining Cells in the Stem Cell Compartment
FASEB J, July 1, 2006; 20(9): 1516 - 1518.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Li, N. Idamakanti, T. Arroyo, S. Thorne, T. Reid, S. Nichols, M. VanRoey, G. Colbern, N. Nguyen, O. Tam, et al.
Dual Promoter-Controlled Oncolytic Adenovirus CG5757 Has Strong Tumor Selectivity and Significant Antitumor Efficacy in Preclinical Models
Clin. Cancer Res., December 15, 2005; 11(24): 8845 - 8855.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Renaud, D. Loukinov, F. T. Bosman, V. Lobanenkov, and J. Benhattar
CTCF binds the proximal exonic region of hTERT and inhibits its transcription
Nucleic Acids Res., December 2, 2005; 33(21): 6850 - 6860.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Quante, S. Heeg, A. von Werder, G. Goessel, C. Fulda, M. Doebele, H. Nakagawa, R. Beijersbergen, H. E. Blum, and O. G. Opitz
Differential transcriptional regulation of human telomerase in a cellular model representing important genetic alterations in esophageal squamous carcinogenesis
Carcinogenesis, November 1, 2005; 26(11): 1879 - 1889.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. M. Ritz, O. Kuhle, S. Riethdorf, B. Sipos, W. Deppert, C. Englert, and C. Gunes
A Novel Transgenic Mouse Model Reveals Humanlike Regulation of an 8-kbp Human TERT Gene Promoter Fragment in Normal and Tumor Tissues
Cancer Res., February 15, 2005; 65(4): 1187 - 1196.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Y. Matsumura-Arioka, K. Ohtani, T. Hara, R. Iwanaga, and M. Nakamura
Identification of two distinct elements mediating activation of telomerase (hTERT) gene expression in association with cell growth in human T cells
Int. Immunol., February 1, 2005; 17(2): 207 - 215.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Yang, C. C. Ou, R. I. Feldman, S. V. Nicosia, P. A. Kruk, and J. Q. Cheng
Aurora-A Kinase Regulates Telomerase Activity through c-Myc in Human Ovarian and Breast Epithelial Cells
Cancer Res., January 15, 2004; 64(2): 463 - 467.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. R. McMurray and D. J. McCance
Human Papillomavirus Type 16 E6 Activates TERT Gene Transcription through Induction of c-Myc and Release of USF-Mediated Repression
J. Virol., September 15, 2003; 77(18): 9852 - 9861.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Kraemer, S. Fuessel, U. Schmidt, M. Kotzsch, B. Schwenzer, M. P. Wirth, and A. Meye
Antisense-mediated hTERT Inhibition Specifically Reduces the Growth of Human Bladder Cancer Cells
Clin. Cancer Res., September 1, 2003; 9(10): 3794 - 3800.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Takeda, H. Inaba, M. Yamazaki, S. Kyo, T. Miyamoto, S. Suzuki, T. Ehara, T. Kakizawa, M. Hara, L. J. DeGroot, et al.
Tumor-Specific Gene Therapy for Undifferentiated Thyroid Carcinoma Utilizing the Telomerase Reverse Transcriptase Promoter
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3531 - 3538.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Veldman, X. Liu, H. Yuan, and R. Schlegel
Human papillomavirus E6 and Myc proteins associate in vivo and bind to and cooperatively activate the telomerase reverse transcriptase promoter
PNAS, July 8, 2003; 100(14): 8211 - 8216.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
I. Horikawa and J. C. Barrett
Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms
Carcinogenesis, July 1, 2003; 24(7): 1167 - 1176.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. J. Kurz, Y. Hong, E. Trivier, H.-L. Huang, S. Decary, G. H. Zang, T. F. Luscher, and J. D. Erusalimsky
Fibroblast Growth Factor-2, But Not Vascular Endothelial Growth Factor, Upregulates Telomerase Activity in Human Endothelial Cells
Arterioscler Thromb Vasc Biol, May 1, 2003; 23(5): 748 - 754.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Szutorisz, J. Lingner, A. P. Cuthbert, D. A. Trott, R. F. Newbold, and M. Nabholz
A Chromosome 3-encoded Repressor of the Human Telomerase Reverse Transcriptase (hTERT) Gene Controls the State of hTERT Chromatin
Cancer Res., February 1, 2003; 63(3): 689 - 695.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
S. A. Stewart
Multiple Levels of Telomerase Regulation
Mol. Interv., December 1, 2002; 2(8): 481 - 483.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. Won, J. Yim, and T. K. Kim
Sp1 and Sp3 Recruit Histone Deacetylase to Repress Transcription of Human Telomerase Reverse Transcriptase (hTERT) Promoter in Normal Human Somatic Cells
J. Biol. Chem., October 4, 2002; 277(41): 38230 - 38238.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
Y.-S. Cong, W. E. Wright, and J. W. Shay
Human Telomerase and Its Regulation
Microbiol. Mol. Biol. Rev., September 1, 2002; 66(3): 407 - 425.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. P. Dimri, J.-L. Martinez, J. J. L. Jacobs, P. Keblusek, K. Itahana, M. van Lohuizen, J. Campisi, D. E. Wazer, and V. Band
The Bmi-1 Oncogene Induces Telomerase Activity and Immortalizes Human Mammary Epithelial Cells
Cancer Res., August 15, 2002; 62(16): 4736 - 4745.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
I. Horikawa, P. L. Cable, S. J. Mazur, E. Appella, C. A. Afshari, and J. C. Barrett
Downstream E-Box-mediated Regulation of the Human Telomerase Reverse Transcriptase (hTERT) Gene Transcription: Evidence for an Endogenous Mechanism of Transcriptional Repression
Mol. Biol. Cell, August 1, 2002; 13(8): 2585 - 2597.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. J. Mauro and D. N. Foster
Regulators of Telomerase Activity
Am. J. Respir. Cell Mol. Biol., May 1, 2002; 26(5): 521 - 524.
[Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Cerezo, H. Kalthoff, M. Schuermann, B. Schafer, and P. Boukamp
Dual regulation of telomerase activity through c-Myc-dependent inhibition and alternative splicing of hTERT
J. Cell Sci., March 15, 2002; 115(6): 1305 - 1312.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J.-L. Mergny, J.-F. Riou, P. Mailliet, M.-P. Teulade-Fichou, and E. Gilson
Natural and pharmacological regulation of telomerase
Nucleic Acids Res., February 15, 2002; 30(4): 839 - 865.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
K. Nomoto, M. Maekawa, K. Sugano, M. Ushiama, N. Fukayama, S. Fujita, and T. Kakizoe
Methylation Status and Expression of Human Telomerase Reverse Transcriptase mRNA in Relation to Hypermethylation of the p16 gene in Colorectal Cancers as Analyzed by Bisulfite PCR-SSCP
Jpn. J. Clin. Oncol., January 1, 2002; 32(1): 3 - 8.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A.-L. Ducrest, M. Amacker, Y. D. Mathieu, A. P. Cuthbert, D. A. Trott, R. F. Newbold, M. Nabholz, and J. Lingner
Regulation of Human Telomerase Activity: Repression by Normal Chromosome 3 Abolishes Nuclear Telomerase Reverse Transcriptase Transcripts but Does Not Affect c-Myc Activity
Cancer Res., October 1, 2001; 61(20): 7594 - 7602.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Pendino, M. Flexor, F. Delhommeau, D. Buet, M. Lanotte, and E. Ségal-Bendirdjian
Retinoids down-regulate telomerase and telomere length in a pathway distinct from leukemia cell differentiation
PNAS, May 18, 2001; (2001) 111464998.
[Abstract] [Full Text]


Home page
J. Virol.Home page
T. Veldman, I. Horikawa, J. C. Barrett, and R. Schlegel
Transcriptional Activation of the Telomerase hTERT Gene by Human Papillomavirus Type 16 E6 Oncoprotein
J. Virol., May 1, 2001; 75(9): 4467 - 4472.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Xu, N. Popov, M. Hou, Q. Wang, M. Bjorkholm, A. Gruber, A. R. Menkel, and M. Henriksson
Switch from Myc/Max to Mad1/Max binding and decrease in histone acetylation at the telomerase reverse transcriptase promoter during differentiation of HL60 cells
PNAS, March 27, 2001; 98(7): 3826 - 3831.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-S. Cong and S. Bacchetti
Histone Deacetylation Is Involved in the Transcriptional Repression of hTERT in Normal Human Cells
J. Biol. Chem., November 10, 2000; 275(46): 35665 - 35668.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Ogretmen, J. M. Kraveka, D. Schady, J. Usta, Y. A. Hannun, and L. M. Obeid
Molecular Mechanisms of Ceramide-mediated Telomerase Inhibition in the A549 Human Lung Adenocarcinoma Cell Line
J. Biol. Chem., August 24, 2001; 276(35): 32506 - 32514.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Knight, M. A. Cotter II, and E. S. Robertson
The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Transactivates the Telomerase Reverse Transcriptase Promoter
J. Biol. Chem., June 15, 2001; 276(25): 22971 - 22978.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Pendino, M. Flexor, F. Delhommeau, D. Buet, M. Lanotte, and E. Segal-Bendirdjian
Retinoids down-regulate telomerase and telomere length in a pathway distinct from leukemia cell differentiation
PNAS, June 5, 2001; 98(12): 6662 - 6667.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Günes, C.
Right arrow Articles by Englert, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Günes, C.
Right arrow Articles by Englert, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online