| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
20% of WTs, embryonal kidney tumors
arising from malignant transformation of renal stem cells. The
WT1 gene encodes up to 16
Mr 52,000–56,000 protein
isoforms, generated via alternative mRNA splicing, RNA editing, and
non-AUG translational initiation; the proteins act predominantly as
transcription factors, regulating the promoters of several genes
critical for cell growth, including IGF2, platelet-derived growth
factor-A, epidermal growth factor receptor, and retinoic
acid receptor-
. The WT1(+KTS) isoforms are also thought to be
involved in RNA metabolism. The cellular requirement for a diverse and
tightly regulated array of WT1 isoforms is reflected in an elaborate
multicomponent gene regulatory system, which includes an
autoregulatable 5' promoter, 5' and 3' enhancer elements, and an intron
3 silencer (1
, 2)
. Furthermore, our previous work has
reported the identification of an antisense WT1 promoter
located in intron 1 that is transactivated by WT1 (3)
.
Antisense WT1 transcripts (WT1-AS) overlapping
the 5' end of the WT1 gene, with no apparent open reading
frames, have been detected in fetal kidney and WTs, suggesting a
regulatory role for these RNAs (4
, 5)
. Although WT1 has
been shown to be critical for normal renal development
(6)
, the relatively low incidence of WT1
mutations compared with tumor suppressor genes such as RB, has led to
the search for other loci that may be deleted or mutated in WTs.
Additionally, other deregulatory mechanisms that may affect candidate
loci, such as the loss of genomic imprinting, have been sought. Genomic
imprinting is the phenomenon by which maternal or paternal copies of a
gene can be selectively expressed, with epigenetic modification of DNA
serving as the regulatory signal. The chromosome 11p15 locus serves as
a paradigm for genetic and epigenetic alterations associated with WTs.
This region harbors a cluster of imprinted genes including
IGF2, H19, and KvLQT1 and not only
shows WT-associated LOH, with the selective loss of maternal alleles
but also exhibits loss of genomic imprinting control of IGF2
and H19 in WTs (7)
. The fact that WTs
undergoing LOH at 11p13 also preferentially lose the maternal allele
and retain the paternal allele (8)
suggested that
differential allelic expression of WT1 might also occur. On
the contrary, however, equivalent expression of parental alleles was
found in normal fetal tissues and WTs (9)
, with only
mosaic and polymorphic imprinting of WT1 evident in brain
and placenta (10)
. Several lines of evidence have led us
and others (11)
to postulate that WT1-AS may be
the candidate imprinted gene on chromosome 11p13: (a) part
of the WT1 antisense promoter locus was independently
identified as a hypermethylated sequence in human breast cancers
(12)
; (b) the discovery of an imprinted
antisense RNA for Igf2r (13)
; and
(c) our demonstration that WT1-AS can affect the
levels of WT1 protein in an in vitro system
(14)
. Our examination of the WT1 ARR reveals a
striking pattern of differential allelic methylation in WTs and their
matched normal kidneys. Analysis of allele specificity of expression
for WT1-AS is consistent with genomic imprinting.
Furthermore, whereas normal kidneys show monoallelic WT1-AS
expression, WTs display biallelic expression, thereby suggesting a
relaxation of imprinting in WTs. Our findings identify the
WT1 ARR as a primary site for epigenetic deregulation at
chromosome 11p13 in WTs. |
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
LOH Analysis.
LOH was examined using PCR-based tetranucleotide polymorphisms as
described previously (15)
, together with additional
polymorphisms in the WT1 gene (16, 17, 18)
.
Southern Hybridization Analysis.
DNAs were digested with an excess of KpnI, SpeI,
and BstUI/Bsh1236I (New England Biolabs and MBI
Fermentas). BstUI and Bsh1236I are isoschizomers
recognizing the sequence CGCG, with digestion being blocked by
methylation. After transfer from 2% analytical agarose gels onto
Hybond-N+ nylon membranes (Amersham), filters
were hybridized overnight with probes radiolabeled with
[32-P]dCTP (3000 Ci/mmol) by random primer
extension labeling. For Southern blotting of matched normal kidney and
WT DNAs, we used an ARR probe spanning four BstUI sites
(Fig. 1a)
. The 850-bp probe corresponds to the region directly
upstream from the KpnI site located at position -422 in the
antisense promoter (Ref. 3
; position 1253 in the ARR
sequence; GenBank accession number AF233371), extending to the
SpeI site (position 403 in AF233371). The genomic region
between the antisense promoter and the 3' end of exon 1 is part of a
CpG island and was used to assess the possibility of global methylation
changes. The insert of plasmid pINE-3 (3)
was used for
this purpose (nucleotides 1318–2495 in AF233371). Hybridizations were
carried out at 65°C in buffer containing 6x SSC, 0.5% SDS,
100 µg/ml denatured salmon sperm DNA (Sigma), and 5x Denhardt’s
buffer [0.1% each of polyvinylpyrrolidone (PVP-360; Sigma), Ficoll
(Pharmacia), and BSA (fraction V; Sigma)]. The filters were washed in
2x SSC, 0.5% SDS at room temperature for 20 min with one change of
solution, and then the filters were given three 30-min washes in 0.1x
SSC, 0.5% SDS. After washing, the filters were autoradiographed with
intensifying screens at -70°C.
|
700 ng of genomic DNAs were
digested with SacI, boiled for 5 min, quickly chilled, and
subsequently incubated in 0.3 M NaOH for 15
min at 50°C. This sample was mixed with 2 volumes of molten 2%
NuSieve agarose (SeaKem). Ten-µl aliquots of the agarose/DNA mixture
containing 
100 ng of DNA were pipetted directly into 750 µl of
chilled paraffin liquid overlaying 1 ml of a 2.5
M sodium metabisulfite (BDH) solution (pH 5),
thereby forming agarose beads. These were incubated for 3.5 h at
50°C in the aqueous phase, after which treatments were stopped by
equilibrating the beads against 1 ml of TE (pH 8; 4 x 15 min), followed by desulfonation in 500 µl of 0.2
M NaOH (2 x 15 min). The
reactions were neutralized by washing with TE (pH 8; 3 x 10 min). Beads were either used directly for PCR or stored for
up to 4 weeks at 4°C. Prior to amplification, beads were
washed with H2O (2 x 15 min). All
reactions were subjected to two rounds of amplifications using a
seminested primer approach, and the 5' and 3' halves of the ARR were
separately amplified from bisulfite-modified DNA. Primer sequences,
with nucleotide positions referring to GenBank entry AF233371, were as
follows. Top-strand primers and nucleotide positions were: TF,
5'-GGGTGGAGAAGAAGGATATATTTAT-3', 371–395; TFN,
5'-GATATATTTATTTATTAGTTTTGGT-3', 385–409; TMR,
5'-CACCTTTATTTAACAAACTAATATTAC-3', 940–914; TR,
5'-AAACCCCTATAATTTACCCTCTTC-3', 1463–1440; TRN,
5'-CTATTAAAAACCTAAAC-CAATT-3', 1415–1394; and TMF,
5'-GGGATATTGAGATTTAGAAAT-TTTT-3', 884–908. Bottom-strand primers
and nucleotide positions were: BF1, 5'-CATTCACCTACTAATCTAATCCC-3',
389–413; BFN, 5'-CC-TACTAACTACAAAACCC-3', 487–505; BMR,
5'-TTAGTAGGTTGGTGTTATTTTTGGG-3', 931–907; BR2,
5'-TTTAGTTAGGATATAAGGAGGGAAT-3', 1580–1556; BRN,
5'-TTATTGAGAATTTAAGTTAGTT-3', 1415–1394; and BMF,
5'-CAAAAATAACACCAACCTACTAAACAAA-3', 908–935.
PCR was performed using 1 unit of SuperTaq (HT Biotechnology) in the
manufacturer’s buffer in a Hybaid PCR Express thermal cycler. Round 1
cycle parameters were as follows: 94°C for 3 min, 40 cycles of 94°C
for 30 s, 50°C for 30 s, 72°C for 90 s, and then
72°C for 5 min. For round 2, between 1 and 10 µl of round 1 product
was used as a template, and cycle parameters were as for round 1,
except 35 cycles were performed (for the primer pair BRN-BMF, an
annealing temperature of 52°C was used). PCR products were isolated
from 1.5% NuSieve agarose gels and cloned into pGEM T-Easy (Promega)
according to manufacturer’s protocol. Automated DNA sequencing was
provided by the Department of Biological Sciences DNA sequencing
service (Durham University, United Kingdom), and data were compiled
from independent clones with 
99% conversion (assessed on the basis
of non-CpG cytosines).
RT-PCR.
The reverse primer was annealed to 1 µg of total RNA by heating to
60°C for 5 min and then quenched on ice. Reverse transcription was
carried out with Super RT (HT Biotechnologies, Cambridge, United
Kingdom) reverse transcriptase at 50°C for 60 min, followed by PCR
cycling as follows: 95°C 3 min (1 cycle); 94°C 15 s, 60°C
30 s, 72°C 60 s (2 cycles); 94°C 15 s, 58°C
30 s, 72°C 60 s (2 cycles); 94°C 15 s, 56°C
30 s, 72°C 60 s (10 cycles, 20 for antisense product);
94°C 15 s, 56°C 30 s, 72°C 60 s with 20 s
extension per cycle (20 cycles). PCR products were digested by adding
the appropriate restriction enzyme directly to the PCR mix and
incubating for 60 min at 37°C. Products were separated on 1%
agarose/1% NuSieve gels and then alkali blotted onto Hybond
N+ membrane and hybridized with
32P-labeled antisense cDNA probe generated using
the primers given below. Primers either side of the antisense
WT1 RNA splice (20)
were used for RT-PCR: WT18,
CTTAGCACTTTCTTCTTGGC]; and WITKBF2, TTGCTCAGTGATTGACCAGG; primers used
for DNA controls were WITKBF2 and WITKBR2, TTGGCTGGAAAGCTTGCAGC. The
MnlI polymorphism (16)
used is marked by an
asterisk in Fig. 2a
. On digestion of the RT-PCR products, biallelic expression
is indicated by bands of 286 bp (MnlI undigested) and 222 bp
(MnlI digested). Alternatively major allelic bands of 286
or 222 bp are evident in the case of monoallelic expression.
|
|
Results and Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
. Our analysis focused on a region independently demonstrated as
hypermethylated in breast cancer (12)
and abutting a CpG
island (as predicted by the GRAIL/CpG algorithm). This region is
delimited by KpnI and SpeI sites and contains 32
CpG dinucleotide residues. Digestion of genomic DNAs with these enzymes
plus the methylation-sensitive enzyme BstUI yields a variety
of bands depending on the methylation status of the BstUI
sites, because the enzyme only cuts when its recognition site (CGCG) is
unmethylated (Fig. 1a)
.
|
, normal kidney DNA samples display a
542-bp band and a 731-bp band, whereas WT samples show the smaller band
only, irrespective of their LOH status. This indicates differential
methylation of the BstUI site at 542 bp in normal kidney and
hypo-methylation of this site in tumors without LOH at 11p13. WTs
undergoing LOH at 11p13 have been shown to preferentially lose the
maternal allele (8)
. Therefore, the comparison of normal
kidney DNA with LOH-positive WT DNAs strongly suggest that the 731-bp
band corresponds to the maternal allele (distinguishable from the
paternal allele at 542 bp because of methylation of the
BstUI site, marked with an asterisk in Fig. 1a
).
To date, we have found hypomethylation in 8 of 10 LOH-negative WTs, but
in contrast, a CCSK and a PNET did not exhibit hypomethylation of both
alleles; instead, they exhibited a degree of hypermethylation (Fig. 1b)
. No differences in banding were seen between any samples
when the CpG island probe adjacent to the ARR was used on the same
Southern blots (data not shown). These data strongly suggest that the
hypomethylation of the ARR is specific to WTs and is not a consequence
of global epigenetic modifications.
We assessed the regional methylation pattern directly by sequencing
bisulfite-modified DNA. This analysis distinguishes between methylated
and unmethylated CpG residues by selectively converting cytosine to
uracil in unmethylated CpGs, with methylated cytosines remaining
unconverted. By subsequent PCR and sequencing of modified DNAs, we have
established the pattern of methylation in the normal kidney and WT of
LOH-negative sample 3 (Fig. 1b
and Table 2
). In normal kidney, a pattern indicative of one methylated allele and
one unmethylated allele is observed, with 50% methylation apparent
at CpG islands 1–13. Tumor DNA, however, displays generalized
hypomethylation of CpG dinucleotides (Table 2)
. The data presented also
show that the distinguishing BstUI site used for Southern
blot analysis demarcates the start of a DMR and lies within a region
that we have suggested may contain negative regulatory elements
(3)
. Although the role of such negative regulatory
elements remains to be determined, the absence of methylation
changes in the core promoter region (3)
underlines their
possible importance.
|
. As
shown in Fig. 2
b, normal kidney samples that matched both
LOH-negative and LOH-positive WTs displayed monoallelic expression.
However, the LOH-negative tumor sample displayed biallelic antisense
WT1 RNA expression, whereas the LOH-positive WT expressed
only the paternal allele, as expected after maternal allele loss.
Together with the identification of the WT1 ARR DMR, these
results are consistent with imprinting of WT1-AS, although
formal evidence of genomic imprinting requires assessment of germ-line
cells in an animal model. Furthermore, our data suggest that relaxation
of WT1-AS imprinting is a frequent event in Wilms’
tumorigenesis. As reported previously, normal kidney, WTs, and fetal kidney all showed biallelic expression of the WT1 sense transcript (Ref. 9 and data not shown). Although very little is known about the cellular functions of the recently reported imprinted antisense transcripts for Igf2r (13) and KvLQT1 (21 , 22) , they have been postulated to act as allelic silencers, because sense and antisense coexpression from the same allele is not observed. Our observations suggest that WT1-AS transcription does not preclude sense mRNA expression in normal kidney or WTs, indicating an alternative role for WT1-AS in WT1 regulation.
One of the vital questions arising from our study is how the epigenetic
modifications of the ARR may be involved in directing a cell toward
cancerous growth. Examination of differential allelic methylation in
fetal kidney DNA (Fig. 1b)
reveals a prevalence of
hypomethylation (increased intensity of the 542-bp band) and a lesser
degree of hypermethylation (731-bp band). This was also evident in
three other fetal kidney samples, with densitometric analysis
indicating a 731-bp band:542-bp band ratio of 0.19 (± 0.04;
n = 4; data not shown). As predicted by this
epigenotype, biallelic expression of the WT1-AS was
detectable in fetal kidney (Fig. 2b)
. Normal kidneys display
a 731-bp band:542-bp band ratio of 0.96 (± 0.29;
n = 9). Comparison of differential
methylation and allele-specific expression in fetal kidney with that in
normal kidney and WTs suggests that tumor cells fail to either acquire
or maintain the methylation imprint prerequisite for normal
nephrogenesis, depending on which epigenotypic subset of fetal kidney
cells progress along the tumorigenic pathway. We therefore prefer the
term relaxation of imprinting, rather than loss of imprinting. It will
clearly be of great interest to examine the methylation and imprinting
status of premalignant lesions such as nephrogenic rests.
Low WT1 protein levels are observed in normal kidney, contrasting with high levels in fetal kidney and WTs (1 , 2) , indicating that imprinting of the ARR may represent a genetic switch controlling WT1 expression such that hypermethylation correlates with low protein and hypomethylation with high protein. In support of this, we have observed previously that altering WT1-AS levels can, surprisingly, lead to increased WT1 protein in vitro (14) . Although the mechanism by which this can occur remains to be elucidated, it is possible to envisage a situation in vivo whereby expression of WT1-AS may stabilize the sense transcript. Such a mechanism may facilitate the rapid increase and attenuation of WT1 levels that parallel the progression of metanephric mesenchymal cells toward an immature epithelial cell phenotype, and the subsequent maturation of epithelial cells (1 , 2) .
Although the elevated levels of WT1 in WTs are thought to reflect the arrested differentiation status of tumor cells (1 , 2) , our work suggests an intriguing functional equivalence between relaxation of imprinting and LOH at the WT1 locus. Because LOH usually arises from mitotic recombination and is accompanied by duplication of the paternal copy (1) , the net effect of both genetic and epigenetic defects would be increased antisense RNA from the paternal allele, a situation analogous to the deregulation of IGF2 in Beckwith-Wiedemann syndrome and WTs (1 , 7) . Thus, if relaxation of imprinting can result in increased WT1 gene expression via altered levels of WT1-AS, the LOH "second hit" required for Wilms’ tumorigenesis may, paradoxically, also lead to overexpression of WT1. Given the potential interaction of WT1 with downstream target genes, it can be envisaged that the loss or alteration of mechanisms controlling WT1 gene expression could have pleiotropic deleterious effects on regulated cellular growth and differentiation. Quantitative perturbations may, therefore, be alternative or additive to qualitative defects such as deletions and mutations when assessing the role of WT1 dysfunction in tumorigenesis, and WT1/WT1-AS may be considered as potentially oncogenic when inappropriately expressed. In this regard, we note with interest that ectopic expression of WT1 can increase the tumorigenic potential of adenovirus-transformed baby rat kidney cells (23) , and that elevated WT1 expression has also been observed in other neoplasias, including acute leukemias and malignant mesotheliomas (1 , 2) . Furthermore, WT1 expression has been shown to be altered in breast cancers (24) . Our characterization of ARR imprinting identifies a switch that, when deregulated, may contribute to the development of WTs and other cancers.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 This work was funded by the Cancer and Leukaemia
in Childhood Trust and a Medical Research Council (United Kingdom)
Studentship (to A. S.). 
2 To whom requests for reprints should be
addressed, at Cancer and Leukaemia in Childhood Research Unit,
Department of Pathology and Microbiology, School of Medical Sciences,
University Walk, University of Bristol, Bristol BS8 1TD, United
Kingdom. Phone: 44-117-9288603; Fax: 44-117-9287896; E-mail: k.t.a.malik{at}bris.ac.uk
3 The abbreviations used are: WT, Wilms’ tumor;
IGF, insulin-like growth factor; LOH, loss of heterozygosity; ARR,
antisense regulatory region; RT-PCR, reverse transcription-PCR; CCSK,
clear cell sarcoma of the kidney; PNET, primitive neuroectodermal
tumor; DMR, differentially methylated region.
4 K. Malik and A, Salpekar, unpublished
data.
Received 9/27/99. Accepted 3/16/00.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResults and DiscussionREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. W. Brown, F. Power, B. Moore, A. K. Charles, and K. T.A. Malik Frequency and Timing of Loss of Imprinting at 11p13 and 11p15 in Wilms' Tumor Development Mol. Cancer Res., July 1, 2008; 6(7): 1114 - 1123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Dallosso, A. L. Hancock, S. Malik, A. Salpekar, L. King-Underwood, K. Pritchard-Jones, J. Peters, K. Moorwood, A. Ward, K. T.A. Malik, et al. Alternately spliced WT1 antisense transcripts interact with WT1 sense RNA and show epigenetic and splicing defects in cancer RNA, December 1, 2007; 13(12): 2287 - 2299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Hancock, K. W. Brown, K. Moorwood, H. Moon, C. Holmgren, S. H. Mardikar, A. R. Dallosso, E. Klenova, D. Loukinov, R. Ohlsson, et al. A CTCF-binding silencer regulates the imprinted genes AWT1 and WT1-AS and exhibits sequential epigenetic defects during Wilms' tumourigenesis Hum. Mol. Genet., February 1, 2007; 16(3): 343 - 354. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Tufarelli The silence RNA keeps: cis mechanisms of RNA mediated epigenetic silencing in mammals Phil Trans R Soc B, January 29, 2006; 361(1465): 67 - 79. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. P. Luedi, A. J. Hartemink, and R. L. Jirtle Genome-wide prediction of imprinted murine genes Genome Res., June 1, 2005; 15(6): 875 - 884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Clement, F. T. Bosman, C. Fontolliet, and J. Benhattar Monoallelic Methylation of the APC Promoter Is Altered in Normal Gastric Mucosa Associated with Neoplastic Lesions Cancer Res., October 1, 2004; 64(19): 6867 - 6873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Dallosso, A. L. Hancock, K. W. Brown, A. C. Williams, S. Jackson, and K. Malik Genomic imprinting at the WT1 gene involves a novel coding transcript (AWT1) that shows deregulation in Wilms' tumours Hum. Mol. Genet., February 15, 2004; 13(4): 405 - 415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Loirat, J. L. Andre, J. Champigneulle, C. Acquaviva, D. Chantereau, R. Bourquard, J. Elion, and E. Denamur WT1 splice site mutation in a 46,XX female with minimal-change nephrotic syndrome and Wilms' tumour Nephrol. Dial. Transplant., April 1, 2003; 18(4): 823 - 825. [Full Text] [PDF]
|
|
|
|
 |
|
 J. F Costello and C. Plass Methylation matters J. Med. Genet., May 1, 2001; 38(5): 285 - 303. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. Baudry, M. Hamelin, M.-O. Cabanis, J.-C. Fournet, M.-F. Tournade, S. Sarnacki, C. Junien, and C. Jeanpierre WT1 Splicing Alterations in Wilms' Tumors Clin. Cancer Res., October 1, 2000; 6(10): 3957 - 3965. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
