Cancer Research Donn Young  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malik, K.
Right arrow Articles by Brown, K. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malik, K.
Right arrow Articles by Brown, K. W.
[Cancer Research 60, 2356-2360, May 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Identification of Differential Methylation of the WT1 Antisense Regulatory Region and Relaxation of Imprinting in Wilms’ Tumor1

Karim Malik2, Ashreena Salpekar, Anne Hancock, Kim Moorwood, Sally Jackson, Adrian Charles and Keith W. Brown


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Wilms’ tumor (WT) is associated with loss of heterozygosity at chromosome 11p13, the site of the Wilms’ tumor suppressor gene, WT1. Although the preferential loss of maternal alleles suggested that differential allelic expression of WT1 might occur, this has not been evident in normal fetal tissues or WTs. In this study, we show that the WT1 antisense regulatory region is differentially methylated, with Southern blot analysis of four loss of heterozygosity-negative WTs and their corresponding normal kidneys indicating that allelic methylation is lost in WTs. Reverse transcription-PCR expression analysis correlates methylation with monoallelic expression of the antisense WT1 transcript (WT1-AS) in normal kidney. However, WTs display hypomethylation and biallelic expression of WT1-AS. Our findings are consistent with imprinting of WT1-AS in normal kidney and the relaxation of imprinting in Wilms’ tumorigenesis. This identifies the WT1 antisense regulatory region in intron 1 as a primary site for epigenetic deregulation at chromosome 11p13 in WTs.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Intragenic loss-of-function mutations of tumor suppressor genes are associated with the development of various cancers. One such gene is the WT3 suppressor gene, WT1, which is disrupted by intragenic deletions and mutations in ~20% of WTs, embryonal kidney tumors arising from malignant transformation of renal stem cells. The WT1 gene encodes up to 16 Mr 52,000–56,000 protein isoforms, generated via alternative mRNA splicing, RNA editing, and non-AUG translational initiation; the proteins act predominantly as transcription factors, regulating the promoters of several genes critical for cell growth, including IGF2, platelet-derived growth factor-A, epidermal growth factor receptor, and retinoic acid receptor-{alpha}. The WT1(+KTS) isoforms are also thought to be involved in RNA metabolism. The cellular requirement for a diverse and tightly regulated array of WT1 isoforms is reflected in an elaborate multicomponent gene regulatory system, which includes an autoregulatable 5' promoter, 5' and 3' enhancer elements, and an intron 3 silencer (1 , 2) . Furthermore, our previous work has reported the identification of an antisense WT1 promoter located in intron 1 that is transactivated by WT1 (3) . Antisense WT1 transcripts (WT1-AS) overlapping the 5' end of the WT1 gene, with no apparent open reading frames, have been detected in fetal kidney and WTs, suggesting a regulatory role for these RNAs (4 , 5) . Although WT1 has been shown to be critical for normal renal development (6) , the relatively low incidence of WT1 mutations compared with tumor suppressor genes such as RB, has led to the search for other loci that may be deleted or mutated in WTs. Additionally, other deregulatory mechanisms that may affect candidate loci, such as the loss of genomic imprinting, have been sought. Genomic imprinting is the phenomenon by which maternal or paternal copies of a gene can be selectively expressed, with epigenetic modification of DNA serving as the regulatory signal. The chromosome 11p15 locus serves as a paradigm for genetic and epigenetic alterations associated with WTs. This region harbors a cluster of imprinted genes including IGF2, H19, and KvLQT1 and not only shows WT-associated LOH, with the selective loss of maternal alleles but also exhibits loss of genomic imprinting control of IGF2 and H19 in WTs (7) . The fact that WTs undergoing LOH at 11p13 also preferentially lose the maternal allele and retain the paternal allele (8) suggested that differential allelic expression of WT1 might also occur. On the contrary, however, equivalent expression of parental alleles was found in normal fetal tissues and WTs (9) , with only mosaic and polymorphic imprinting of WT1 evident in brain and placenta (10) . Several lines of evidence have led us and others (11) to postulate that WT1-AS may be the candidate imprinted gene on chromosome 11p13: (a) part of the WT1 antisense promoter locus was independently identified as a hypermethylated sequence in human breast cancers (12) ; (b) the discovery of an imprinted antisense RNA for Igf2r (13) ; and (c) our demonstration that WT1-AS can affect the levels of WT1 protein in an in vitro system (14) . Our examination of the WT1 ARR reveals a striking pattern of differential allelic methylation in WTs and their matched normal kidneys. Analysis of allele specificity of expression for WT1-AS is consistent with genomic imprinting. Furthermore, whereas normal kidneys show monoallelic WT1-AS expression, WTs display biallelic expression, thereby suggesting a relaxation of imprinting in WTs. Our findings identify the WT1 ARR as a primary site for epigenetic deregulation at chromosome 11p13 in WTs.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Tissue Samples and Nucleic Acid Preparation.
All tumors were typical WTs unless otherwise indicated, ranging from stage II to stage V, and were obtained snap frozen from the Bristol Children’s Hospital, along with adjacent histologically normal kidney. The fetal kidney sample was obtained at 22 weeks gestation. DNAs were extracted by standard phenol/chloroform extraction, and total RNAs were purified using TRI reagent (Sigma Chemical Co.) according to the manufacturer’s instructions.

LOH Analysis.
LOH was examined using PCR-based tetranucleotide polymorphisms as described previously (15) , together with additional polymorphisms in the WT1 gene (16, 17, 18) .

Southern Hybridization Analysis.
DNAs were digested with an excess of KpnI, SpeI, and BstUI/Bsh1236I (New England Biolabs and MBI Fermentas). BstUI and Bsh1236I are isoschizomers recognizing the sequence CGCG, with digestion being blocked by methylation. After transfer from 2% analytical agarose gels onto Hybond-N+ nylon membranes (Amersham), filters were hybridized overnight with probes radiolabeled with [{alpha}32-P]dCTP (3000 Ci/mmol) by random primer extension labeling. For Southern blotting of matched normal kidney and WT DNAs, we used an ARR probe spanning four BstUI sites (Fig. 1a)Citation . The 850-bp probe corresponds to the region directly upstream from the KpnI site located at position -422 in the antisense promoter (Ref. 3 ; position 1253 in the ARR sequence; GenBank accession number AF233371), extending to the SpeI site (position 403 in AF233371). The genomic region between the antisense promoter and the 3' end of exon 1 is part of a CpG island and was used to assess the possibility of global methylation changes. The insert of plasmid pINE-3 (3) was used for this purpose (nucleotides 1318–2495 in AF233371). Hybridizations were carried out at 65°C in buffer containing 6x SSC, 0.5% SDS, 100 µg/ml denatured salmon sperm DNA (Sigma), and 5x Denhardt’s buffer [0.1% each of polyvinylpyrrolidone (PVP-360; Sigma), Ficoll (Pharmacia), and BSA (fraction V; Sigma)]. The filters were washed in 2x SSC, 0.5% SDS at room temperature for 20 min with one change of solution, and then the filters were given three 30-min washes in 0.1x SSC, 0.5% SDS. After washing, the filters were autoradiographed with intensifying screens at -70°C.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Differential methylation of the WT1 ARR. a, map of the ARR probe and schematic diagram of major fragments produced when DNA is digested with SpeI, KpnI, and BstUI. The differentially methylated BstUI site is shown with an asterisk and marks one edge of the DMR. The distribution of CpG dinucleotides is shown, numbered relative to Table 2Citation . The 3' end of the CpG island predicted by the GRAIL program is also indicated. b, Southern blot analysis using 10 µg of genomic DNAs digested with KpnI, SpeI, and BstUI and probed with the WT1 ARR. DNAs are: T, WT; NK, matched normal kidney; FK, fetal kidney. Arrows, DNA band sizes according to molecular weight markers.

 
Bisulfite Sequence Analysis.
Bisulfite analysis used a modification of the protocol of Olek et al. (19) . Briefly, ~700 ng of genomic DNAs were digested with SacI, boiled for 5 min, quickly chilled, and subsequently incubated in 0.3 M NaOH for 15 min at 50°C. This sample was mixed with 2 volumes of molten 2% NuSieve agarose (SeaKem). Ten-µl aliquots of the agarose/DNA mixture containing <=100 ng of DNA were pipetted directly into 750 µl of chilled paraffin liquid overlaying 1 ml of a 2.5 M sodium metabisulfite (BDH) solution (pH 5), thereby forming agarose beads. These were incubated for 3.5 h at 50°C in the aqueous phase, after which treatments were stopped by equilibrating the beads against 1 ml of TE (pH 8; 4 x 15 min), followed by desulfonation in 500 µl of 0.2 M NaOH (2 x 15 min). The reactions were neutralized by washing with TE (pH 8; 3 x 10 min). Beads were either used directly for PCR or stored for up to 4 weeks at 4°C. Prior to amplification, beads were washed with H2O (2 x 15 min). All reactions were subjected to two rounds of amplifications using a seminested primer approach, and the 5' and 3' halves of the ARR were separately amplified from bisulfite-modified DNA. Primer sequences, with nucleotide positions referring to GenBank entry AF233371, were as follows. Top-strand primers and nucleotide positions were: TF, 5'-GGGTGGAGAAGAAGGATATATTTAT-3', 371–395; TFN, 5'-GATATATTTATTTATTAGTTTTGGT-3', 385–409; TMR, 5'-CACCTTTATTTAACAAACTAATATTAC-3', 940–914; TR, 5'-AAACCCCTATAATTTACCCTCTTC-3', 1463–1440; TRN, 5'-CTATTAAAAACCTAAAC-CAATT-3', 1415–1394; and TMF, 5'-GGGATATTGAGATTTAGAAAT-TTTT-3', 884–908. Bottom-strand primers and nucleotide positions were: BF1, 5'-CATTCACCTACTAATCTAATCCC-3', 389–413; BFN, 5'-CC-TACTAACTACAAAACCC-3', 487–505; BMR, 5'-TTAGTAGGTTGGTGTTATTTTTGGG-3', 931–907; BR2, 5'-TTTAGTTAGGATATAAGGAGGGAAT-3', 1580–1556; BRN, 5'-TTATTGAGAATTTAAGTTAGTT-3', 1415–1394; and BMF, 5'-CAAAAATAACACCAACCTACTAAACAAA-3', 908–935.

PCR was performed using 1 unit of SuperTaq (HT Biotechnology) in the manufacturer’s buffer in a Hybaid PCR Express thermal cycler. Round 1 cycle parameters were as follows: 94°C for 3 min, 40 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 90 s, and then 72°C for 5 min. For round 2, between 1 and 10 µl of round 1 product was used as a template, and cycle parameters were as for round 1, except 35 cycles were performed (for the primer pair BRN-BMF, an annealing temperature of 52°C was used). PCR products were isolated from 1.5% NuSieve agarose gels and cloned into pGEM T-Easy (Promega) according to manufacturer’s protocol. Automated DNA sequencing was provided by the Department of Biological Sciences DNA sequencing service (Durham University, United Kingdom), and data were compiled from independent clones with >=99% conversion (assessed on the basis of non-CpG cytosines).

RT-PCR.
The reverse primer was annealed to 1 µg of total RNA by heating to 60°C for 5 min and then quenched on ice. Reverse transcription was carried out with Super RT (HT Biotechnologies, Cambridge, United Kingdom) reverse transcriptase at 50°C for 60 min, followed by PCR cycling as follows: 95°C 3 min (1 cycle); 94°C 15 s, 60°C 30 s, 72°C 60 s (2 cycles); 94°C 15 s, 58°C 30 s, 72°C 60 s (2 cycles); 94°C 15 s, 56°C 30 s, 72°C 60 s (10 cycles, 20 for antisense product); 94°C 15 s, 56°C 30 s, 72°C 60 s with 20 s extension per cycle (20 cycles). PCR products were digested by adding the appropriate restriction enzyme directly to the PCR mix and incubating for 60 min at 37°C. Products were separated on 1% agarose/1% NuSieve gels and then alkali blotted onto Hybond N+ membrane and hybridized with 32P-labeled antisense cDNA probe generated using the primers given below. Primers either side of the antisense WT1 RNA splice (20) were used for RT-PCR: WT18, CTTAGCACTTTCTTCTTGGC]; and WITKBF2, TTGCTCAGTGATTGACCAGG; primers used for DNA controls were WITKBF2 and WITKBR2, TTGGCTGGAAAGCTTGCAGC. The MnlI polymorphism (16) used is marked by an asterisk in Fig. 2aCitation . On digestion of the RT-PCR products, biallelic expression is indicated by bands of 286 bp (MnlI undigested) and 222 bp (MnlI digested). Alternatively major allelic bands of 286 or 222 bp are evident in the case of monoallelic expression.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Allele-specific expression of antisense WT1 RNA. a, schematic diagram showing the primers either side of the antisense WT1 RNA splice used for RT-PCR. *, MnlI polymorphism (16) used to distinguish between alleles. b, RT-PCR of DNA and RNA from fetal kidney (FK), WTs, and matched normal kidney (NK). -RT, minus reverse transcriptase control; +RT, plus reverse transcriptase. Biallelic expression is indicated by bands of 286 bp (MnlI undigested) and 222 bp (MnlI digested), whereas only one band can be produced in the case of monoallelic expression

 

    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Our previous work has characterized WT1 regulatory elements including the 5' promoter and the antisense promoter, with a view to establishing whether quantitative deregulation of WT1 expression may arise through mutations within these regions. However, we have detected no mutations in either promoter.4 As outlined above, there are several reasons to presuppose that epigenetic changes may also take place at the WT1 locus on chromosome 11p13, and we therefore examined WTs with and without LOH at chromosome 11p13 for altered methylation in the WT1 ARR (Table 1)Citation . Our analysis focused on a region independently demonstrated as hypermethylated in breast cancer (12) and abutting a CpG island (as predicted by the GRAIL/CpG algorithm). This region is delimited by KpnI and SpeI sites and contains 32 CpG dinucleotide residues. Digestion of genomic DNAs with these enzymes plus the methylation-sensitive enzyme BstUI yields a variety of bands depending on the methylation status of the BstUI sites, because the enzyme only cuts when its recognition site (CGCG) is unmethylated (Fig. 1a)Citation .


View this table:
[in this window]
[in a new window]

 
Table 1 LOH data for tumor samples

Tumor samples were assessed for LOH by PCR using previously reported polymorphic markers (15 16 17 18) .

 
As shown in Fig. 1bCitation , normal kidney DNA samples display a 542-bp band and a 731-bp band, whereas WT samples show the smaller band only, irrespective of their LOH status. This indicates differential methylation of the BstUI site at 542 bp in normal kidney and hypo-methylation of this site in tumors without LOH at 11p13. WTs undergoing LOH at 11p13 have been shown to preferentially lose the maternal allele (8) . Therefore, the comparison of normal kidney DNA with LOH-positive WT DNAs strongly suggest that the 731-bp band corresponds to the maternal allele (distinguishable from the paternal allele at 542 bp because of methylation of the BstUI site, marked with an asterisk in Fig. 1aCitation ). To date, we have found hypomethylation in 8 of 10 LOH-negative WTs, but in contrast, a CCSK and a PNET did not exhibit hypomethylation of both alleles; instead, they exhibited a degree of hypermethylation (Fig. 1b)Citation . No differences in banding were seen between any samples when the CpG island probe adjacent to the ARR was used on the same Southern blots (data not shown). These data strongly suggest that the hypomethylation of the ARR is specific to WTs and is not a consequence of global epigenetic modifications.

We assessed the regional methylation pattern directly by sequencing bisulfite-modified DNA. This analysis distinguishes between methylated and unmethylated CpG residues by selectively converting cytosine to uracil in unmethylated CpGs, with methylated cytosines remaining unconverted. By subsequent PCR and sequencing of modified DNAs, we have established the pattern of methylation in the normal kidney and WT of LOH-negative sample 3 (Fig. 1bCitation and Table 2Citation ). In normal kidney, a pattern indicative of one methylated allele and one unmethylated allele is observed, with ~50% methylation apparent at CpG islands 1–13. Tumor DNA, however, displays generalized hypomethylation of CpG dinucleotides (Table 2)Citation . The data presented also show that the distinguishing BstUI site used for Southern blot analysis demarcates the start of a DMR and lies within a region that we have suggested may contain negative regulatory elements (3) . Although the role of such negative regulatory elements remains to be determined, the absence of methylation changes in the core promoter region (3) underlines their possible importance.


View this table:
[in this window]
[in a new window]

 
Table 2 Demarcation of the DMR by bisulfite sequencing analysis: LOH-negative sample 3

The methylation patterns across the antisense promoter and regulatory region were assessed in normal kidney and WT DNAs corresponding to LOH-negative sample 3 (see Fig. 1bCitation ). Independent clones A–J are shown on the vertical axis, and CpG dinucleotides assessed are numbered on the horizontal axis. The CpGs are oriented relative to Fig. 1aCitation by the KpnI and SpeI sites. Methylated CpGs are indicated by + and unmethylated by -.

 
The allele-specific methylation pattern observed in normal kidney strongly suggests genomic imprinting of the WT1 ARR and tumor-specific relaxation of imprinting in WTs. We therefore assessed allele specificity of expression using RT-PCR (Fig. 2a)Citation . As shown in Fig. 2Citation b, normal kidney samples that matched both LOH-negative and LOH-positive WTs displayed monoallelic expression. However, the LOH-negative tumor sample displayed biallelic antisense WT1 RNA expression, whereas the LOH-positive WT expressed only the paternal allele, as expected after maternal allele loss. Together with the identification of the WT1 ARR DMR, these results are consistent with imprinting of WT1-AS, although formal evidence of genomic imprinting requires assessment of germ-line cells in an animal model. Furthermore, our data suggest that relaxation of WT1-AS imprinting is a frequent event in Wilms’ tumorigenesis.

As reported previously, normal kidney, WTs, and fetal kidney all showed biallelic expression of the WT1 sense transcript (Ref. 9 and data not shown). Although very little is known about the cellular functions of the recently reported imprinted antisense transcripts for Igf2r (13) and KvLQT1 (21 , 22) , they have been postulated to act as allelic silencers, because sense and antisense coexpression from the same allele is not observed. Our observations suggest that WT1-AS transcription does not preclude sense mRNA expression in normal kidney or WTs, indicating an alternative role for WT1-AS in WT1 regulation.

One of the vital questions arising from our study is how the epigenetic modifications of the ARR may be involved in directing a cell toward cancerous growth. Examination of differential allelic methylation in fetal kidney DNA (Fig. 1b)Citation reveals a prevalence of hypomethylation (increased intensity of the 542-bp band) and a lesser degree of hypermethylation (731-bp band). This was also evident in three other fetal kidney samples, with densitometric analysis indicating a 731-bp band:542-bp band ratio of 0.19 (± 0.04; n = 4; data not shown). As predicted by this epigenotype, biallelic expression of the WT1-AS was detectable in fetal kidney (Fig. 2b)Citation . Normal kidneys display a 731-bp band:542-bp band ratio of 0.96 (± 0.29; n = 9). Comparison of differential methylation and allele-specific expression in fetal kidney with that in normal kidney and WTs suggests that tumor cells fail to either acquire or maintain the methylation imprint prerequisite for normal nephrogenesis, depending on which epigenotypic subset of fetal kidney cells progress along the tumorigenic pathway. We therefore prefer the term relaxation of imprinting, rather than loss of imprinting. It will clearly be of great interest to examine the methylation and imprinting status of premalignant lesions such as nephrogenic rests.

Low WT1 protein levels are observed in normal kidney, contrasting with high levels in fetal kidney and WTs (1 , 2) , indicating that imprinting of the ARR may represent a genetic switch controlling WT1 expression such that hypermethylation correlates with low protein and hypomethylation with high protein. In support of this, we have observed previously that altering WT1-AS levels can, surprisingly, lead to increased WT1 protein in vitro (14) . Although the mechanism by which this can occur remains to be elucidated, it is possible to envisage a situation in vivo whereby expression of WT1-AS may stabilize the sense transcript. Such a mechanism may facilitate the rapid increase and attenuation of WT1 levels that parallel the progression of metanephric mesenchymal cells toward an immature epithelial cell phenotype, and the subsequent maturation of epithelial cells (1 , 2) .

Although the elevated levels of WT1 in WTs are thought to reflect the arrested differentiation status of tumor cells (1 , 2) , our work suggests an intriguing functional equivalence between relaxation of imprinting and LOH at the WT1 locus. Because LOH usually arises from mitotic recombination and is accompanied by duplication of the paternal copy (1) , the net effect of both genetic and epigenetic defects would be increased antisense RNA from the paternal allele, a situation analogous to the deregulation of IGF2 in Beckwith-Wiedemann syndrome and WTs (1 , 7) . Thus, if relaxation of imprinting can result in increased WT1 gene expression via altered levels of WT1-AS, the LOH "second hit" required for Wilms’ tumorigenesis may, paradoxically, also lead to overexpression of WT1. Given the potential interaction of WT1 with downstream target genes, it can be envisaged that the loss or alteration of mechanisms controlling WT1 gene expression could have pleiotropic deleterious effects on regulated cellular growth and differentiation. Quantitative perturbations may, therefore, be alternative or additive to qualitative defects such as deletions and mutations when assessing the role of WT1 dysfunction in tumorigenesis, and WT1/WT1-AS may be considered as potentially oncogenic when inappropriately expressed. In this regard, we note with interest that ectopic expression of WT1 can increase the tumorigenic potential of adenovirus-transformed baby rat kidney cells (23) , and that elevated WT1 expression has also been observed in other neoplasias, including acute leukemias and malignant mesotheliomas (1 , 2) . Furthermore, WT1 expression has been shown to be altered in breast cancers (24) . Our characterization of ARR imprinting identifies a switch that, when deregulated, may contribute to the development of WTs and other cancers.


    ACKNOWLEDGMENTS
 
We thank Wolf Reik and Jorn Walter for advice on bisulfite sequencing and Anthony Dallosso for valuable technical support.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was funded by the Cancer and Leukaemia in Childhood Trust and a Medical Research Council (United Kingdom) Studentship (to A. S.). Back

2 To whom requests for reprints should be addressed, at Cancer and Leukaemia in Childhood Research Unit, Department of Pathology and Microbiology, School of Medical Sciences, University Walk, University of Bristol, Bristol BS8 1TD, United Kingdom. Phone: 44-117-9288603; Fax: 44-117-9287896; E-mail: k.t.a.malik{at}bris.ac.uk Back

3 The abbreviations used are: WT, Wilms’ tumor; IGF, insulin-like growth factor; LOH, loss of heterozygosity; ARR, antisense regulatory region; RT-PCR, reverse transcription-PCR; CCSK, clear cell sarcoma of the kidney; PNET, primitive neuroectodermal tumor; DMR, differentially methylated region. Back

4 K. Malik and A, Salpekar, unpublished data. Back

Received 9/27/99. Accepted 3/16/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Hastie N. D. The genetics of Wilms’ tumor–a case of disrupted development. Annu. Rev. Genet., 28: 523-558, 1994.[Medline]
  2. Menke A. L., van der Eb A. J., Jochemsen A. G. The Wilms’ tumor 1 gene: oncogene or tumor suppressor gene?. Int. Rev. Cytol., 181: 151-212, 1998.[Medline]
  3. Malik K. T. A., Wallace J. I., Ivins S. M., Brown K. W. Identification of an antisense WT1 promoter in intron 1: implications for WT1 gene regulation. Oncogene, 11: 1598-1595, 1995.
  4. Campbell C. E., Huang A., Gurney A. L., Kessler P. M., Hewitt J. A., Williams B. R. G. Antisense transcripts and protein binding motifs within the Wilms tumour (WT1) locus. Oncogene, 9: 583-595, 1994.[Medline]
  5. Eccles M. R., Grubb G., Ogawa O., Szeto J., Reeve A. E. Cloning of novel Wilms tumor gene (WT1) cDNAs: evidence for antisense transcription of WT1. Oncogene, 9: 2059-2063, 1994.[Medline]
  6. Kriedberg J. A., Sariola H., Loring J. M., Maeda M., Pelletier J., Housman D., Jaenisch R. WT-1 is required for early kidney development. Cell, 74: 679-691, 1993.[Medline]
  7. Feinberg A. P. Imprinting of a genomic domain of 11p15 and loss of imprinting in cancer: an introduction. Cancer Res., 59(Suppl): 1743s-1746s, 1999.
  8. Schroeder W. T., Chao L. Y., Dao D. D., Strong L. C., Pathak S. Non-random loss of maternal chromosome 11 alleles in Wilms’ tumors. Am. J. Hum. Genet., 40: 413-420, 1987.[Medline]
  9. Little M. H., Dunn R., Byrne J. A., Seawright A., Smith P. J., Pritchard-Jones K., van Heyningen V., Hastie N. D. Equivalent expression of paternally and maternally inherited WT1 alleles in normal fetal tissue and Wilms’ tumours. Oncogene, 7: 635-641, 1992.[Medline]
  10. Jinno Y., Yun K., Nishiwaki K., Kubota T., Ogawa O., Reeve A. E., Niikawa N. Mosaic and polymorphic imprinting of the WT1 gene in humans. Nat. Genet., 6: 305-309, 1994.[Medline]
  11. Ward A., Dutton J. R. Regulation of the Wilms’ tumour suppressor (WT1) gene by an antisense RNA: a link with genomic imprinting?. J. Pathol., 185: 342-344, 1998.[Medline]
  12. Huang T. H-M., Laux D. E., Hamlin B. C., Tran P., Tran H., Lubahn D. B. Identification of DNA methylation markers for human breast carcinomas using the methylation-sensitive restriction fingerprinting technique. Cancer Res., 57: 1030-1034, 1997.[Abstract/Free Full Text]
  13. Wutz A., Smrzka O. W., Schweifer N., Schellander K., Wagner E. F., Barlow D. P. Imprinted expression of the Igf2r gene depends on an intronic CpG island. Nature (Lond.), 389: 745-749, 1997.[Medline]
  14. Moorwood K., Charles A. K., Salpekar A., Wallace J. I., Brown K. W., Malik K. Antisense WT1 transcription parallels sense mRNA and protein expression in fetal kidney and can elevate protein levels in vitro. J. Pathol., 185: 352-359, 1998.[Medline]
  15. Powlesland R. M., Charles A. K., Malik K. T. A., Reynolds P. A., Pires S., Boavida M., Brown K. W. Loss of heterozygosity at 7p in Wilms’ tumour development. Br. J. Cancer, 82: 323-329, 2000.[Medline]
  16. Grubb G. R., Yun K., Reeve A. E., Eccles M. R. Exclusion of the Wilms tumour gene (WT1) promoter as a site of frequent mutation in Wilms’ tumour. Oncogene, 10: 1677-1681, 1995.[Medline]
  17. Baird P. N., Pritchard J., Cowell J. K. Molecular genetic analysis of chromosome 11p in familial Wilms’ tumour. Br. J. Cancer, 69: 1072-1077, 1994.[Medline]
  18. Haber D. A., Buckler A. J., Glaser T., Call K. M., Pelletier J., Sohn R. L., Douglass E. C., Housman D. E. An internal deletion within an 11p13 zinc finger gene contributes to the development of Wilms’ tumor. Cell, 61: 1257-1269, 1990.[Medline]
  19. Olek A., Oswald J., Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res., 24: 5064-5066, 1996.[Abstract/Free Full Text]
  20. Gessler M., Bruns G. A. P. Sequence of the WT1 upstream region including the Wit-1 gene. Genomics, 17: 499-501, 1993.[Medline]
  21. Lee M. P., DeBaun M. R., Mitsuya K., Galonek H. L., Brandenburg S., Oshimura M., Feinberg A. P. Loss of imprinting of a paternally expressed transcript, with antisense orientation to KvLQT1, occurs frequently in Beckwith-Wiedemann syndrome and is independent of insulin-like growth factor II imprinting. Proc. Natl. Acad. Sci. USA, 96: 5203-5208, 1999.[Abstract/Free Full Text]
  22. Schlimlich N. J., Day C. D., Fitzpatrick G. V., Caldwell G. M., Lossie A. C., Cooper P. R., Smallwood A. C., Joyce J. A., Schofield P. N., Reik W., Nicholls R. D., Weksberg R., Driscoll D. J., Maher E. R., Shows T. B., Higgins M. J. A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith-Wiedemann syndrome. Proc. Natl. Acad. Sci. USA, 96: 8064-8069, 1999.[Abstract/Free Full Text]
  23. Menke A. L., Riteco N., van Ham R. C. A., de Bruyne C., Rauscher F. J., III, van der Eb A. J., Jochemsen A. G. Wilms’ tumor 1 splice variants have opposite effects on the tumorigenicity of adenovirus-transformed baby-rat kidney cells. Oncogene, 12: 537-546, 1996.[Medline]
  24. Silberstein G. B., van Horn K., Strickland P., Roberts C. T., Jr., Daniel C. W. Altered expression of the WT1 Wilms’ tumor suppressor gene in human breast cancer. Proc. Natl. Acad. Sci. USA, 94: 8132-8137, 1997.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
K. W. Brown, F. Power, B. Moore, A. K. Charles, and K. T.A. Malik
Frequency and Timing of Loss of Imprinting at 11p13 and 11p15 in Wilms' Tumor Development
Mol. Cancer Res., July 1, 2008; 6(7): 1114 - 1123.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
A. R. Dallosso, A. L. Hancock, S. Malik, A. Salpekar, L. King-Underwood, K. Pritchard-Jones, J. Peters, K. Moorwood, A. Ward, K. T.A. Malik, et al.
Alternately spliced WT1 antisense transcripts interact with WT1 sense RNA and show epigenetic and splicing defects in cancer
RNA, December 1, 2007; 13(12): 2287 - 2299.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. L. Hancock, K. W. Brown, K. Moorwood, H. Moon, C. Holmgren, S. H. Mardikar, A. R. Dallosso, E. Klenova, D. Loukinov, R. Ohlsson, et al.
A CTCF-binding silencer regulates the imprinted genes AWT1 and WT1-AS and exhibits sequential epigenetic defects during Wilms' tumourigenesis
Hum. Mol. Genet., February 1, 2007; 16(3): 343 - 354.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
C. Tufarelli
The silence RNA keeps: cis mechanisms of RNA mediated epigenetic silencing in mammals
Phil Trans R Soc B, January 29, 2006; 361(1465): 67 - 79.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
P. P. Luedi, A. J. Hartemink, and R. L. Jirtle
Genome-wide prediction of imprinted murine genes
Genome Res., June 1, 2005; 15(6): 875 - 884.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Clement, F. T. Bosman, C. Fontolliet, and J. Benhattar
Monoallelic Methylation of the APC Promoter Is Altered in Normal Gastric Mucosa Associated with Neoplastic Lesions
Cancer Res., October 1, 2004; 64(19): 6867 - 6873.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. R. Dallosso, A. L. Hancock, K. W. Brown, A. C. Williams, S. Jackson, and K. Malik
Genomic imprinting at the WT1 gene involves a novel coding transcript (AWT1) that shows deregulation in Wilms' tumours
Hum. Mol. Genet., February 15, 2004; 13(4): 405 - 415.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
C. Loirat, J. L. Andre, J. Champigneulle, C. Acquaviva, D. Chantereau, R. Bourquard, J. Elion, and E. Denamur
WT1 splice site mutation in a 46,XX female with minimal-change nephrotic syndrome and Wilms' tumour
Nephrol. Dial. Transplant., April 1, 2003; 18(4): 823 - 825.
[Full Text] [PDF]


Home page
J. Med. Genet.Home page
J. F Costello and C. Plass
Methylation matters
J. Med. Genet., May 1, 2001; 38(5): 285 - 303.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
D. Baudry, M. Hamelin, M.-O. Cabanis, J.-C. Fournet, M.-F. Tournade, S. Sarnacki, C. Junien, and C. Jeanpierre
WT1 Splicing Alterations in Wilms' Tumors
Clin. Cancer Res., October 1, 2000; 6(10): 3957 - 3965.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malik, K.
Right arrow Articles by Brown, K. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malik, K.
Right arrow Articles by Brown, K. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online