| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Biochemistry and Biophysics |
Biochemistry Laboratory, IDI-IRCCS, 
Department of Experimental Medicine, University of Rome Tor Vergata, 00133 Rome, Italy [G. M., F. B., M. V. C., A. R., M. C., S. S.]; Serono Pharmaceutical Research Institute, 1228 Plan-les-Ouates, Switzerland [F. V.]; and Division of Cellular Immunology, La Jolla Institute for Allergy and Immunology, San Diego, California 92121 [D. R. G.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B (12)
, OxyR
(13)
, c-Myb (14)
, and AP-1
(15)
. In addition to nitrosylation, oxidative reactions of
thiol groups are protein modification (e.g., disulfide
formation, thiol oxidation to sulfenic, and sulfinic acid) mediated by
NO-related molecules (16)
.
NO is potentially toxic because of the free-radical structure, making
it highly chemically reactive; it can elicit both apoptosis and
necrosis depending on the intensity of the stimulus and the time of
exposure. Mitochondrial function and intracellular energy levels may
contribute to the determination of the ensuing pathway to either
necrotic or apoptotic cell death (17)
. The mode of
neuronal death, occurring during glutamate excitotoxicity, is
critically dependent on the mitochondrial membrane potential
(18)
; accordingly, mitochondrial and/or glycolytic ATP
depletion switches the type of death in Jurkat T cells stimulated with
anti-CD95 antibody and staurosporin (19)
. We have recently
proposed an alternative mechanism that may inhibit apoptosis and, at
least in some cases, result in necrosis (10)
. We indicated
that NO can inhibit apoptosis, at least in certain cell types, through
S-nitrosylation of some effector apoptotic enzymes, such as caspases
and tTG. Indeed, we demonstrated that exogenous sources of NO prevent
anti-CD95-induced apoptosis in Jurkat T cells by inactivating caspase
3-like protease activity. NO was subsequently shown to inactivate
caspases in apoptotic models, such as tumor necrosis factor
-stimulated endothelial cell lines and rat hepatocytes, and
CD95-ligated human leukocytes (10
, 20
, 21)
. At least seven
members of the caspase family were found to be inhibited by nitroso
compounds (22)
. A recent study has indicated that caspases
are endogenously S-nitrosylated and that CD95 ligation activates
caspase-3 not only by inducing the cleavage of the protease precursor,
but also by stimulating the denitrosylation of its catalytic site
cysteine (23)
.
AP-1, composed of either homodimers of Jun family proteins (c-Jun,
JunB, and Jun D) or heterodimers of Jun proteins and Fos family members
(c-Fos, FosB, Fra-1, and Fra-2), binds to a specific cis
element, the so-called TRE, and initiates transcription of target genes
(24)
. AP-1 is induced via activation of the JNK cascade
(25)
. Although AP-1 seems to be involved in intracellular
signaling pathways to apoptosis, its role is trigger dependent and/or
cell type specific. Indeed, in some models apoptosis does not depend on
the AP-1 pathway (26
, 27)
. Conversely, in other cell
types, AP-1 activation participates in signaling events triggered by
cytokines, such as tumor necrosis factor and CD95L
(28, 29, 30)
, hormone withdrawal (31)
, and
various environmental and pharmacological stresses, such as ceramide,
hydrogen peroxide, 
-irradiation, and UV light (28
, 32, 33, 34, 35)
. A target for AP-1-mediated transcriptional regulation
is the CD95L gene, the promoter of which contains at least
one AP-1-responsive element (36
, 37)
. AP-1 seems to be a
necessary effector in driving CD95L transcription during some forms of
cell death (37)
. Doxorubicin and -irradiation, for
example, were found to increase JNK activity and CD95L expression
(35)
. Moreover, constitutive activation of the JNK cascade
in Jurkat T cells transfected with a dominant active-mitogen-activated
protein kinase kinase kinase (DA-MEKK1) led to apoptosis accompanied by
an enhanced expression of CD95 and CD95L (38)
. More
recently, we have reported that the activation of AP-1 is crucially
involved in DNA damage-induced CD95L expression and apoptosis in T-cell
lines (37)
.
We investigated the possibility that NO may interfere, through AP-1, with cell death induced by several apoptotic stimuli by regulating CD95L expression. To test this hypothesis, we examined the effects of S-nitrosothiols and NO-donor compounds on cell death triggered by etoposide and ceramide. We then explored whether NO-related species released in the culture medium can inhibit in vivo AP-1-binding activity and transactivation of the AP-1-responsive CD95L promoter.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Cell Cultures.
Jurkat T cells were maintained in a 1:1 mixture of MEM and Ham’s F-12
medium supplemented with 10% heat-inactivated FCS, 1.2 g/liter
Na-bicarbonate, 1% nonessential amino acids, and 15 mM
HEPES at 37°C in a humidified atmosphere of 5%
CO2 in air.
Measurement of Free NO Concentrations.
The amount of NO released from several NO-donor compounds was
determined by direct measurements of free NO, performed with the Iso-NO
meter (WPI, World Precision Instruments Inc., Sarasota, FL), according
to the manufacturer’s instructions. Different concentrations (0.1, 1,
and 10 mM) of NO-donors were added to the culture medium
supplemented with 10% FCS at 37°C, and measurements of free NO
concentrations were taken over 24 h.
Determination of Cell Death.
To estimate DNA fragmentation, cells were fixed with 1:1 PBS and
methanol-acetone (4:1 v/v) solution at -20°C before analysis. The
cell cycle was evaluated by flow cytometry using a PI staining
(39
, 40)
in the presence of RNase A (20-min incubation at
37°C) on a FACS-Calibur flow cytometer (Becton Dickinson, San
José, CA). Cells were excited at 488 nm using a 15-mW
Argon laser. Ten thousand events were evaluated using the Cell Quest
Program (ibid). Electronic gating FSC-a/vs/FSC-h was used to eliminate
cell aggregates. For analysis of nuclear morphology by fluorescence
microscopy, cell cultures were stained for 5 min at 37°C with Hoechst
33342 and immediately observed with a Nikon Diaphot fluorescence
microscopy. For DNA gel electrophoresis, cell pellets were lysed in
lysis buffer [5 mM Tris-HCl (pH 7.5), 5 mM
EDTA, and 0.5% Triton X-100] for 30 min at 4°C. After
centrifugation at 13,000 x g for 20 min, DNA
from supernatant fractions was isolated by phenol/chloroform
extraction, analyzed by electrophoresis through 1.5% agarose gels in
TAE buffer, and then visualized by ethidium bromide staining.
PARP Western Blotting.
Cells were lysed in lysis buffer [50 mM Tris (pH 6.8), 6 M
urea, 10% glycerol, 2% SDS, and 5% 2-mercaptoethanol] and sonicated
on ice, before Bradford protein determination. Proteins (100 µg/lane)
were separated on 8% SDS-polyacrylamide gels and blotted onto
nitrocellulose membranes. Membranes were washed (PBS/0.1% Tween 20)
before blocking with PBS/5% BSA, 0.5% gelatin. The mouse anti-PARP
antibody (clone C-2–10, 1:1000 in PBS + 5% BSA, 0.5%
gelatin) was added and incubated overnight at 4°C. Nitrocellulose
membranes were subsequently washed and developed with horseradish
peroxidase-conjugated goat antimouse monoclonal antibody (1:2500) for
1 h at room temperature, using chemiluminescence (ECL; Amersham).
EMSA.
Nuclear mini-extracts were prepared according to Schreiber et
al. (41)
, with the modifications reported by Lee
et al. (42)
. Mobility shift experiments were
performed as described (42)
. The AP-1 consensus
oligonucleotide was CGCTTGATGAGTCAGCCGGAA, and the AP-1 mutant
oligonucleotide was CGCTTGATTAGTTAGCCGGAA. The complexes were resolved
on nondenaturing 6% polyacrylamide gels in 0.5 x Tris-borate EDTA buffer for 1 h at 14 V/cm and autoradiographed
overnight.
For supershift analysis, mini-extracts were preincubated with a panel of antisera against different Jun/Fos family members, for 2 h at 4°C before the addition of 32P-labeled oligonucleotide. Complexes were then processed as described above.
Transient Transfections of Jurkat T Cells.
Jurkat T cells were cotransfected with a reporter construct consisting
of the luciferase gene under the control of the human CD95L promoter
and the pCAT control vector (1 µg DNA/106
cells) using Superfect Transfection Reagent (Qiagen, Inc., Hilden,
Germany). The formation of Superfect-DNA complexes (ratio,
Superfect:DNA 20:1) were allowed to proceed for 10 min at room
temperature. Then, diluted complexes were applied to cells and
incubation continued for 48 h before treatment with apoptotic
stimuli and NO-donors. Transfected Jurkat T cells were incubated either
with 25 µM etoposide for 6 h or 30 µM
C6-ceramide for 2 h, in the presence or
absence of NO-donors. After incubation, cells were harvested, washed in
PBS, and lysed in 200 µl of Reporter Lysis Buffer (Promega). For the
gene expression assay, 20 µl of cell extracts were mixed with 100
µl of Luciferase Assay Reagent (Promega) and light emission was
measured using a highly sensitive LUMI-A (SEAS) luminometer
(43)
. Differences in transfection efficiency were
normalized by chloramphenicol acetyl transferase activity, as described
(44)
.
Titration of Thiol Groups and Protein Sequencing.
The reactive cysteine residues were titrated with
Nbs2. Reaction mixtures containing 0.5 µg of
c-Jun, 30 mM Tris-HCl (pH 8.0), and 2 mM EDTA
were incubated with excess Nbs2. One experiment
was performed at pH 7.4 (as for all cellular experiments), producing
comparable results, but with a different time-response. The course of
the reaction was followed at 412 nm. A molar extinction coefficient of
13600 M-1 cm-1 for the
anion of thionitrobenzoic acid was used to determine the number of
moles of thiol groups reacted. When the effect of NO was studied, the
NO-donor SNAP was added to the reaction mixture at a final
concentration of 0.1 mM and incubated for 5 min. Before the
initiation of the reaction with Nbs2, samples
were subjected to gel filtration by using Chroma Spin-10 columns
(Clontech Laboratories, Inc., Palo Alto, CA) according to the
manufacturer’s instructions. To study the reversibility of NO
reaction, 1 mM DTT was added 30 min after SNAP and
immediately before the initiation of the reaction with
Nbs2.
For sequencing by tandem MS, the protein samples were partially digested with trypsin. All analyses were performed on a Q-TOF mass spectrometer (Micromass, Manchester, England) equipped with a Z-spray interface and a nano-electrospray ion source. The instrument was calibrated over the m/z range 50–2400 using horse heart myoglobin and a series of fragment ions obtained by collision-induced dissociation of the peptide Glu-fibrinopeptide B. For nano-electrospray tandem MS analyses, peptide solutions were desalted, concentrated, and eluted into nanospray capillaries (Protana, Odense, Denmark), as described (45) . For each sample a peptide mass map was obtained in the single MS mode, followed by in-turn fragmentation of observed peptide ions in the tandem MS mode. Argon was used as the collision gas, and the collision energy was tuned for each peptide to obtain the best possible collision-induced dissociation spectra.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Different NO-donors displayed distinct kinetics of NO release: SNAP
released NO within 3 h; SPER-NO and GSNO showed maximum peaks of
release at 2- and 3-h incubation, then producing relatively stable free
NO concentrations over a period of 24 h; and, finally, SIN-1 was
less efficacious in releasing NO. Fig. 1
shows that different NO-donors
behave quite differently, as, for example, shown by the release of free
NO; the chemical reactions of each individual donor could be quite
different. On this simple rationale, we have decided to use four
different donors for the experiments.
|
. Treatment with SNAP in the absence of etoposide had no
effect on DNA fragmentation. These results were confirmed by DNA ladder
(Fig. 2B)
and Hoechst staining of the nuclei (Fig. 3)
. Indeed, both methods have shown that SNAP alone did not significantly
affect apoptotic cell death (Fig. 2B
, Lanes 2–4,
and Fig. 3, B-D
), whereas its combination with the
chemotherapic drug was able to reduce etoposide-stimulated apoptosis
(Fig. 2B
, Lanes 5–8, and Fig. 3,
E-H
).
|
|
, the significant increase in AP-1-binding activity, after
treatment with 25 µM etoposide for 4 h
(Lane 2), was blocked by SNAP in a concentration-dependent
manner (Lanes 3–5). As shown in Fig. 4B
, the
complex present in unstimulated Jurkat T cells contained c-Jun
(Lane 2), as well as JunD (Lane 3), JunB
(Lane 4), and c-Fos (Lane 5). To determine the
effect of NO on AP-1-dependent gene transactivation, Jurkat T cells
were transiently transfected with a reporter construct consisting of
the luciferase gene under the control of the human CD95L promoter
(37)
. Forty-eight h after-transfection, cells were
stimulated either with increasing concentrations (0.01–5
mM) of the NO-donors alone or in combination with
the DNA-damaging agent. As shown in Fig. 5A
, treatment of transfected cells with 25
µM etoposide for 6 h led to an increase in
CD95L promoter-driven luciferase transcription of 
2.3-fold over
control (arbitrarily set to 100%). The presence of NO-related species
resulted in a decreased response, with 100% inactivation occurring at
5 mM NO-donor. Therefore, exogenously added NO
was able to block apoptosis by inhibiting AP-1-mediated transactivation
of CD95L. The induction of luciferase activity has not been observed
with the reporter vector lacking the promoter sequence or with a
mutated sequence (37)
. We also assessed the action of NO
on the basal activity: transactivation of the luciferase gene was
powerfully blocked by the four NO-donors used, in a
concentration-dependent manner, resulting in a complete inhibition at 5
mM NO-donor (Fig. 5B)
.
|
|
, whereas 2 mM SNAP effectively
protected from C6-ceramide-triggered apoptosis.
The reduction of apoptosis was confirmed by Hoechst 33342 staining and
DNA laddering (data not shown).
|
shows that the Mr 116,000
enzyme was partially cleaved into the
Mr 85,000 fragment 18 h after
treatment (Lane 2) and this effect was completely reversed
with high concentrations of SNAP (Lane 5).
We then examined whether AP-1 DNA-binding activity was increased in
nuclear mini-extracts prepared from Jurkat T cells stimulated with
C6-ceramide. We found that
C6-ceramide (Fig. 6C
, Lane
2) increased the binding of nuclear extracts to synthetic
oligonucleotides containing the AP-1 consensus sequence, 2 h after
treatment. We examined the induction of AP-1 activity in cells treated
with C6-ceramide and SNAP (0.1–5
mM). As shown in Fig. 6C
(Lanes
3–5), the addition of the NO-donor decreased the AP-1 activity in
a dose-dependent manner. Competition studies, using 50-fold molar
excess of unlabeled AP-1 consensus oligonucleotide (Lane 6)
or AP-1 mutant oligonucleotide (Lane 7), confirmed the
specificity of the binding.
Similarly, to the apoptotic model described for etoposide,
AP-1-regulated gene transactivation could be inhibited by NO-releasing
agents. Transient transfection studies, performed with the CD95L
promoter, showed that a 2-h stimulation of Jurkat T cells with
C6-ceramide caused a significant increase (about
2.5-fold over control cells, arbitrarily set to 100%) in CD95L
promoter-regulated luciferase activity, which was nevertheless
inhibited by all NO-donors tested (Fig. 6D)
.
Tritation of Thiol Groups of c-Jun and Protein Sequencing.
To determine the mechanism of AP-1 inhibition by NO, we titrated
the reactive cysteine residues of c-Jun with
Nbs2. The incubation of the purified recombinant
c-Jun with SNAP (0.1 mM) resulted in a decreased number of
titratable cysteines per monomer of protein. Indeed, Fig. 7A
shows that the NO-treated protein lacked one thiol group
when compared with the native c-Jun. To determine whether the effect of
NO on c-Jun can be reversed, 1 mM DTT was added
to the reaction mixture. The results indicated that the addition of DTT
almost entirely restored the number of titratable cysteines to the
control levels (Fig. 7A)
. These data, together with the
existing correlation between the NO-induced reduction of c-Jun
titratable thiol groups and the loss of AP-1 DNA-binding activity,
indicate that the mechanism by which NO inhibits AP-1 involves the
partially reversible chemical modification of a cysteine residue.
|
. To identify the residue modified by NO, or the
chemical modification that was induced, c-Jun was analyzed by
nano-electrospray tandem MS to analyze the entire primary sequence.
However, the DNA-binding site was fully degraded during the limited
proteolysis required by this technique and was, therefore, unable to be
evaluated by MS. Indeed, the sequence (KCRKRK) containing the conserved
cysteine of the DNA-binding site of c-Jun is entirely composed of basic
residues, and, therefore, it was completely digested even when
performing a partial proteolysis with trypsin. Nonetheless, the
sequencing data obtained from the partial digestion of SNAP-treated
c-Jun indicated that none of the other two cysteine residues (Cys 99
and Cys 320) and none of the other amino acid residues covered by MS
was modified by NO (Fig. 7B)
. Because the protein has only
three cysteines, and most of the other residues were not modified,
these data strongly indicate that Cys 269, on the DNA binding site, has
reacted with NO. |
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
NO can interfere with the downstream apoptotic machinery either by
acting at the level of caspase 3-like protease activation (10
, 11
, 20, 21, 22)
and tTG (10)
, or upstream of these
events by preventing AP-1 function. Although it is difficult to comment
on the reaction occurring in vivo, inactivation by NO may
proceed through direct S-nitrosylation of catalytic cysteine residues
or through other reversible chemical modifications, such as disulfide
or sulfenic acid formation, which could be equally achieved by reaction
with NO (16)
. Fig. 8
shows a partial schematic pathway of the apoptotic machinery activated
by the two models reported in the present study, etoposide (see path 1)
and ceramide (see path 2). Both seem to proceed, in part, via AP-1
activation and CD95L expression (35
, 37)
, which can be
blocked by NO-related species.
|
was found to
down-regulate the DNA-binding activity of AP-1 in human brain-derived
cells through a NO-dependent mechanism (49)
. NO has also
been shown to inhibit DNA-binding activity of c-Jun by reversibly
targeting the formation of a mixed disulfide with glutathione to the
conserved cysteine residue in the DNA-binding site of the transcription
factor (50)
. Nevertheless, the NO-mediated inhibition of AP-1 DNA-binding activity has not been previously correlated with cell death regulation. The apoptotic stimuli used enhanced the binding activity of AP-1 transcription factor, an effect that was completely reversed by the NO-donors. Furthermore, we have demonstrated that induction of AP-1 DNA-binding activity leads to an increased transactivation of CD95L gene transcription (37) . Indeed, two different apoptotic stimuli were found to induce the transcription of the luciferase gene through the activation of the AP-1-responsive CD95L promoter; the NO-generating compounds strongly down-regulated both basal and inducible transcriptional activity. Titration of the thiol groups, reversibility of the reaction with the reducing agent DTT, and sequencing data of the partially digested NO-exposed c-Jun protein, indicated that NO inhibits the DNA-binding activity of AP-1 by reversibly modifying a cysteine residue, through S-nitrosylation or other NO-primed reactions (16) .
We have shown that NO can inhibit apoptosis either downstream, by inactivating caspase/tTG enzymes, or upstream, by modifying primary components of the AP-1 complex and, thus, inhibiting CD95L expression.
As the transcription factor AP-1 regulates the expression of genes (e.g., CD95, CD95L) involved in cancer and tumor sensitivity to chemotherapy, the inhibitory effect exerted on AP-1 and apoptosis by NO-related species in cancer cells may be relevant in modulating cancer therapy.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by CNR-Biotecnologie and AIDS Project
(Min. Sanitá) to A. Finazzi-Agró, Consiglio Nazionale delle
Ricerche, Associazione Italiana per la Ricerca sul Cancro, Ministero
dell’Universitá e della Ricerca Scientifica e Tecnologica-cofin,
Ministero Sanitá, EU Grant QLG1-1999-00739, and Telethon (E872)
to G. M. F. B. is a recipient of a fellowship from FIRC. 
2 To whom requests for reprints should be
addressed, at IDI-IRCCS, Biochemistry Lab, c/o Department of
Experimental Medicine, D26/F153, University of Rome Tor Vergata, Via
Tor Vergata 135, 00133 Rome, Italy. Phone: 39-6-20427299; Fax:
39-6-20427290; E-mail: gerry.melino{at}uniroma2.it
3 The abbreviations used are: NO, nitric oxide;
CD95L, CD95 ligand; AP-1, activator protein-1; JNK, c-Jun
NH2-terminal kinase; EMSA, electrophoretic mobility shift
assay; Nbs2, 5,5'-dithiobis (2-nitrobenzoate); SNAP,
S-nitroso-N-acetylpenicillamine ; SPER-NO, spermine-NO; SIN-1,
3-morpholinosydnonimine; GSNO, S-nitrosoglutathione; PI, propidium
iodide; tTG, tissue transglutaminase; MS, mass spectrometry;
PARP, poly (ADP-ribose)polymerase; TAE, Tris, acetic acid, EDTA.
Received 7/22/99. Accepted 3/ 3/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B DNA binding by nitric oxide. Nucleic Acids Res., 24: 2236-2242, 1996. radiation. J. Biol. Chem., 271: 31929-31936, 1996. inhibits AP-1 binding activity in human brain-derived cells through a nitric oxide dependent mechanism. J. Neuroimmunol., 88: 39-44, 1998.[Medline]
This article has been cited by other articles:
|
|
 |
|
  J. Zhang, S. Wang, R. A. Wesley, and R. L. Danner Adjacent Sequence Controls the Response Polarity of Nitric Oxide-sensitive Sp Factor Binding Sites J. Biol. Chem., August 1, 2003; 278(31): 29192 - 29200. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Weller, A. Schwentker, T. R. Billiar, and Y. Vodovotz Autologous nitric oxide protects mouse and human keratinocytes from ultraviolet B radiation-induced apoptosis Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1140 - C1148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-K. LEONG, R.-S. RUAN, and Z. ZHANG A Critical Assessment of the Neurodestructive and Neuroprotective Effects of Nitric Oxide Ann. N.Y. Acad. Sci., May 1, 2002; 962(1): 161 - 181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Almeida, J. Almeida, J. P. Bolanos, and S. Moncada Different responses of astrocytes and neurons to nitric oxide: The role of glycolytically generated ATP in astrocyte protection PNAS, December 6, 2001; (2001) 261560998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Feger, H. Ferry-Dumazet, M. M. Matsuda, J. Bordenave, M. Dupouy, A. K. Nussler, M. Arock, L. Devevey, J. Nafziger, J.-J. Guillosson, et al. Role of Iron in Tumor Cell Protection from the Pro-Apoptotic Effect of Nitric Oxide Cancer Res., July 1, 2001; 61(13): 5289 - 5294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Almeida, J. Almeida, J. P. Bolanos, and S. Moncada Different responses of astrocytes and neurons to nitric oxide: The role of glycolytically generated ATP in astrocyte protection PNAS, December 18, 2001; 98(26): 15294 - 15299. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
, 1 mM SNAP; x,
1 mM SPER-NO; 
, 1 mM SIN-1.
, control cells; 
, Jurkat T cells incubated with 25
µM etoposide. B, prevention of
etoposide-induced DNA ladder (Lane 5) by 0.1, 1, and 5
mM SNAP, 6 h after treatment (Lanes
6–8). Lanes 1–4, untreated and SNAP-stimulated
Jurkat cells.
). Purified c-Jun showed three reactive
thiol groups (cysteine residues), one of which reacted with NO. The
reaction was also carried out in the presence of 1 mM DTT,
added 30 min later to evaluate the reversibility of the reaction.
B, protein sequence of c-Jun. Boxed
residues were covered in the mass spectrometric analyses of the tryptic
digest of SNAP-treated c-Jun. Cys 99 and Cys 320 are marked in
bold.