Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by You, Z.
Right arrow Articles by Chen, S.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by You, Z.
Right arrow Articles by Chen, S.-Y.
[Cancer Research 61, 197-205, January 1, 2001]
© 2001 American Association for Cancer Research

Immunology

A Retrogen Strategy for Presentation of an Intracellular Tumor Antigen as an Exogenous Antigen by Dendritic Cells Induces Potent Antitumor T Helper and CTL Responses1

Zhaoyang You, Jenny Hester, Lisa Rollins, Giulio C. Spagnoli, Pierre van der Bruggen and Si-Yi Chen2

Center for Cell and Gene Therapy [Z. Y., J. H., L. R., S-Y. C.], Department of Molecular and Human Genetics [Z. Y., J. H., L. R., S-Y. C.], Baylor College of Medicine, Houston, Texas 77030; Department of Surgery and Research, University of Basel, Basel, Switzerland [G. C. S.]; and Ludwig Institute for Cancer Research, B1200 Brussels, Belgium [P. v. d. B.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Induction of an effective antitumor response requires CD4+ helper T (Th) cells to recognize antigens on the same dendritic cells (DCs) that cross-present CTL antigens. Such cross-presentation is difficult to achieve by current tumor vaccine strategies. Here, we develop a novel "Retrogen" strategy for DCs to efficiently cross-present an intracellular tumor antigen, MAGE-3, to both MHC class I and MHC class II in a cognate manner. Specifically, the MAGE-3 gene was linked to a leader sequence at its NH2 terminus for secretion and to a cell-binding domain at its COOH terminus for receptor-mediated internalization. DCs transduced with the modified MAGE-3 gene produced and secreted MAGE-3 proteins, which were efficiently taken up by DCs via receptor-mediated internalization and presented as exogenous antigens to class I and class II molecules. Immunization of mice with the transduced DCs expressing the MAGE-3 fusion protein, termed "Retrogen" for its retrograde transport/internalization after secretion, efficiently induced all arms of the adaptive antitumor immune responses. Thus, this retrogen strategy of using a unifying mechanism for DCs to cross-present an intracellular tumor antigen in a cognate manner could be generally used to improve the efficacy of tumor vaccines and immunotherapies.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A critical contribution by tumor-specific CD4+ Th3 cells in the development of an effective antitumor response has been clearly demonstrated in murine tumor models (1, 2, 3) . Such cells exert helper activity for the induction and maintenance of CD8+ CTLs. They also have an effector function against tumors via macrophage activation, cytokine production, or direct killing of MHC class II-positive tumors (3, 4, 5, 6, 7, 8) . Dissection of cellular interactions reveals that Th cells must recognize antigens on the same APCs that cross-present the CTL epitopes in a cognate manner, indicating the requirement for epitope linkage between Th epitopes and CTL epitopes for induction of potent antitumor immune responses (9, 10, 11, 12) .

For activation of CD4+ Th responses, exogenous antigens are taken up by APCs and processed in the endosomal pathway, where the antigenic peptides are associated with MHC class II. Endogenous cytosolic and nuclear proteins, such as MAGE-3, usually cannot be processed and presented to class II for induction of CD4+ Th responses, although some endogenous proteins containing a targeting sequence can enter the endogenous class II processing pathway (13 , 14) . The intracellular MAGE-3 tumor antigen is specifically expressed in many tumors, including melanomas, non-small cell lung carcinomas, head and neck squamous cell carcinomas, and hepatocellular carcinoma (15) . At least five antigenic peptides presented by class I (16 , 17) and four peptides by class II (18 , 19) have been identified in the MAGE-3 protein. Clinical trials with synthetic peptides or peptide-pulsed DCs demonstrated that immune responses to MAGE-3 can be induced, and modest antitumor effects can be transiently achieved, in some melanoma patients (20, 21, 22) . Inclusion of nonspecific immunogenic helper proteins in peptide-pulsed DCs enhanced antitumor activity, probably by recruiting and activating Th cells to sites where CTLs are primed (21) . These studies indicate that the efficacy of current tumor vaccines could be further improved by optimizing tumor antigen presentation.

In this study, we developed a novel retrogen strategy to induce potent CD4+ Th and CD8+ CTL responses by genetically modifying DCs to present an intracellular tumor antigen to both class I and class II in a cognate manner. Specifically, an intracellular tumor antigen gene is linked to a leader sequence at its NH2 terminus for secretion and to a cell-binding domain at its COOH terminus for receptor-mediated internalization. The modified gene is then transduced into DCs to produce and secrete the fusion proteins (retrogens), which can be taken up by DCs via receptor-mediated internalization, processed in the endosomal pathway, and presented as exogenous antigens by class II to activate CD4+ Th cells. More importantly, the internalized exogenous antigens can be directly presented by the same DCs to class I (cross-priming) for activation of CTLs (12 , 23, 24, 25, 26, 27) . Antigen presentation by DCs through receptor-mediated internalization can be enhanced up to 10,000-fold over fluid-phase antigen pinocytosis (28, 29, 30, 31) . Thus, the secretion of an intracellular tumor antigen and subsequent receptor-mediated internalization by DCs can exploit the endosomal class II pathway and cross-priming pathway to cross-present the antigen to both class I and class II in a cognate manner. The results of this study demonstrate that the model intracellular tumor antigen, MAGE-3, can be genetically modified and efficiently presented by the same transduced DCs to both Th cells and CTLs, acting as an intermediary for the delivery of helper activity to CTLs, which leads to the induction of potent antitumor immune responses in mice.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice and Cell Lines.
Female C57BL/6 or BALB/c mice, 4–6 weeks of age, were purchased from Harlan. All mice were maintained in the animal facility of Baylor College of Medicine, and this animal study was approved by the Institutional Animal Care and Use Committee. The tumor cell line EL4 (C57BL/6, H-2b thymoma; American Type Culture Collection) was transfected with the plasmid pcDNA3.1-MAGE-3 using Lipofectin (Life Technologies, Inc.) and then selected in the presence of 1 mg/ml Zeocin (Invitrogen). The Zeocin-resistant clones were subcloned and then screened for MAGE-3 expression by immunoprecipitation and PCR. The positive EL4-MAGE-3 cells were maintained at 37°C in 5% CO2 in DMEM containing 10% heat-inactivated horse serum and 1 mg/ml Zeocin. The EL4-HBcAg cell line expressing HBcAg was established after transfection with an HBcAg expression vector (pRc/CMV) and G418 selection. H293 and PA317 cell lines were obtained from American Type Culture Collection.

Vector Construction.
A plasmid encoding the full-length MAGE-3 gene (32) was used as a template to amplify the MAGE-3 DNA with a pair of primers: 5'-primer (A), 5'-ACGCGTCGACATGCCTCTTGAGCAGAGGAGTCAG-3', corresponding to the nucleotide sequence 1–24 of the MAGE-3 gene with an additional SalI restriction site; and 3'-primer (B), 5'-CCGCTCGAGTCACTCTTCCCCCTCTCTCAAAAC-3', corresponding to the nucleotide sequence 921–945 of the MAGE-3 with a XhoI site. The addition of the signal leader sequence derived from the human RANTES gene (33) was generated by PCR amplification with a pair of primers: 5'-primer (C), 5'-ACGCGTCGACATGAAGGTCTCCGCGGCAGCCCTCGCTGTCATCCTCATTGCTACTGCCCTCTGCGCTCCTGCATCTGCCATGCCTCTTGAGCAGAGGAGTCAG-3', corresponding to the RANTES leader sequence (33) and to the nucleotide sequence 1–24 of the MAGE-3 gene with a SalI site; and 3'-primer (B). The signal-MAGE-3 fragment (s-MAGE-3) without the stop codon was generated by PCR with 5'-primer (C) and 3'-primer (D), 5'-ATAAGAATGCGGCCGCTCTCTTCCCCCTCTCTCAAAAC-3', corresponding to the nucleotide sequence 921–942 of the MAGE-3 with a NotI site. The human IgG1 cDNA Fc fragment was generated by PCR amplification with the plasmid pEE6/CLL-1 containing human IgG1a heavy chain cDNA (34) as a template. The pair of primers for the PCR reaction is: 5'-primer (E), 5'-ATAAGCGGCCGCTAAAACTCACACATGCCCA-3', corresponding to the nucleotide sequence 785–802 of the heavy chain with an additional NotI site; and 3'-primer (F), 5'-CCGCTCGAGTCATTTACCCGGAGACAGGGAGAG-3', corresponding to the nucleotide sequence 1447–1468 of the heavy chain with a XhoI site. A murine retroviral vector, pFB-Neo (Stratagene), was used for this study. The retroviral vector s-MAGE-3-Fc was constructed by a three-piece ligation of the s-MAGE-3 fragment without the stop codon, Fc, and SalI/XhoI-cut pFB-Neo. The retroviral vector s-MAGE-3 or MAGE-3 was constructed by inserting the s-MAGE-3 or MAGE-3 gene into SalI/XhoI-cut pFB-Neo, respectively. To construct the IgG Fc expression vector, the human IgG Fc cDNA fragment was linked with an immunoglobulin heavy chain (VH) signal leader sequence by two PCR reactions. In the first PCR reaction, the IgG Fc cDNA was used as a template for the amplification with a pair of primers: 5'-primer, 5'-GCAGCTCCCAGATGGGTCCTGTCCAAAACTCACACATGCCCACCGTGCCCAGCAC-3', corresponding to the nucleotide sequence 785–815 of the heavy chain and a partial VH leader sequence; and 3'-primer (F). The second PCR using the product of the first PCR as a template was carried out with a pair of primers: 5'-primer, 5'-ACGCGTCGACATGGGAACATCTGTGGTTCTTCCTTCTCCTGGTGGCAGCTCCCAGATGGGTCCTGTCC-3', corresponding to the NH2-terminal nucleotide sequence of the VH leader sequence with an additional SalI site; and 3'-primer (F). The Fc cDNA with a leader sequence was then cloned into the retroviral vector. The expression vector pcDNA3.1-MAGE-3 was constructed by inserting the MAGE-3 into the XhoI/XbaI-cut pcDNA3.1 (Invitrogen). Each resultant vector was identified by restriction enzyme analysis and confirmed by DNA sequencing.

Production of Retroviruses and Transduction of Bone Marrow-derived DCs.
To produce retroviral vectors, packaging cells (PA317) were cultured in 100-mm culture dishes with DMEM containing 10% heat-inactivated FBS (Life Technologies, Inc.) and transfected with 10–15 µg of retroviral vector plasmids prepared by using endotoxin-free Qiagen kits by Lipofectin (Life Technologies, Inc.). After overnight incubation, the medium was replaced with DMEM containing 5% FBS. Forty-eight h later, the culture medium containing recombinant retroviruses was harvested and filtered (0.22 µm), as described previously (35) . To generate DCs, BM cells were flushed from the bones of mouse limbs, passed through a nylon mesh, and depleted of red cells with ammonium chloride. After extensive washing with RPMI 1640, the cells were incubated with rabbit complements (Calbiochem) and a mixture of mAbs consisting of anti-CD4, anti-CD8, anti-CD45R/B220, and anti-MHC-II (PharMingen and BioSource International) in RPMI 1640 at 37°C for 40–60 min. After extensive washing with RPMI 1640, cells (5 x 105 cells/ml) in RPMI 1640 supplemented with 6% FBS, 80 ng of mSCF/ml (R&D Systems), and 20 units of mIL-6/ml (BioSource International) were plated in 12-well culture plates (2.5 ml/well), incubated at 37°C, 5% CO2 overnight, and then refed with fresh medium. After 48-h incubation, the cells were spun down, resuspended in 1.5 ml of the retrovirus supernatants, placed onto 24-well culture plates coated with Retronectin (PanVera) at a concentration of 10–20 ng/ml, and incubated at 37°C, 5% CO2 for 3–4 h. The supernatants were then replaced with 1.5 ml of RPMI 1640 supplemented with 5% FBS, 10 ng of mSCF/ml, 60 ng of mGM-CSF/ml (BioSource International), and 100 units of mIL-4/ml (R & D Systems) overnight. The transduction procedure was repeated two to three times, and ~30% of BM cells were usually transduced by this procedure. After the final transduction, the cells were washed and cultured in Opti-MEM (Life Technologies, Inc.) containing mGM-CSF and mIL-4 for several days to allow further DC differentiation. DCs were further enriched with a 50% FCS-RPMI 1640 sedimentation procedure, as described previously (36) . The transduced DCs were used for further studies.

Quantitative Western Blot Analysis.
Murine BM cells were transduced with various recombinant retroviral vectors and differentiated into DCs in vitro as described above. After 4 days of culture with mGM-CSF and mIL-4, 1 x 108 DCs transduced with each construct and their culture media were harvested. The transduced DCs were then lysed with a buffer [Boehringer Mannheim; 10 mM Tris, 150 mM NaCl (pH 7.4), 1% TX-100 (Sigma), 0.5 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail tablets] on ice for 10 min. Cell lysates and culture media were then precipitated with a rabbit polyclonal antibody against MAGE-3, followed by incubation with Protein A-Sepharose (Sigma). The precipitates were then resuspended in 20 µl of loading buffer and subjected to Western blot analysis (37) . Briefly, protein samples (20 µl) were loaded onto a 10% SDS-PAGE gel and transferred to a Hybond polyvinylidene difluoride membrane (Amersham Pharmacia Biotech), which was blocked by overnight incubation in PBS (pH 7.5) containing 5% nonfat dried milk (Carnation) and 0.1% (v/v) Tween 20 (Fisher Scientific) at 4°C. After washing with a buffer [PBS containing 0.1% (v/v) Tween 20], the membrane was incubated with a mouse mAb against MAGE-3 (38) diluted in a PBS buffer containing 2.5% nonfat milk and 0.1% Tween 20 (1:400) at room temperature for 1 h. After washing, the membrane was then incubated with a horseradish peroxidase-labeled antimouse IgG (Amersham Pharmacia Biotech) in the buffer (1:10,000) at room temperature for 1 h. After a final wash, the membrane was visualized with an ECL-Plus chemiluminescent detection kit (Amersham Pharmacia Biotech) and exposed on a Kodak film. Protein band intensity of the Western blot on the film was determined and analyzed by a PhosphorImager (Molecular Dynamics) with an Image-Quant software 1.2 version.

Flow Cytometric Assay.
BM-derived DCs were preincubated with an anti-CD16/CD32 antibody (2.4G2; PharMingen) for blocking Fc{gamma} receptors at 4°C for 30–60 min. The DCs were then incubated with primary antibodies at 4°C for 30 min, followed by incubation with an antimouse or antirabbit IgG-FITC conjugate. After extensive washing, the DCs were then analyzed by a FACScan (Becton Dickinson) with CellQuest software.

Immunization and Isolation of CD4+ T Cells, CD8+ T Cells, and DCs.
C57BL/6 mice received injections (i.v.) with 0.5–1 x 105 of the transduced DCs in 30 µl of PBS containing 50,000 units of IL-2 (Chiron) per mouse. Four to six weeks after immunization, mice were sacrificed, and peripheral blood, spleens, and other organs were collected. CD4+ or CD8+ T cells were isolated from spleen suspensions with CD4+ or CD8+ T-cell enrichment columns (R & D Systems) and then cultured in RPMI 1640 supplemented with 10% FBS for 24–48 h before further analysis. Draining lymph nodes from immunized mice were digested with a mixture of 0.1% DNase I (fraction IX; Sigma) and 1 mg/ml collagenase (Roche Molecular Biochemicals) at 37°C for 40–60 min. DCs were positively isolated from the cell suspensions of lymph nodes or spleens with anti-CD11c (N418) Micro-Beads (Miltenyi Biotec Inc) for further study.

Cytokine Measurement.
CD4+ T cells from immunized mice were cocultured with DCs at a rate of 1000:1 (T cell:DC, 2 x 105:2 x 102) for various times. Supernatants of the cocultures were harvested and subsequently assayed for cytokine concentrations by ELISA (PharMingen) according to the manufacturer’s instructions (PharMingen).

Cytotoxicity Assays.
The JAM test was used to measure cytotoxic activities (39) . Briefly, mice were sacrificed at different times after immunization, and a single-cell suspension of splenocytes was cultured in RPMI 1640 10% FBS. A total of 4 x 106 splenocytes was restimulated with 8 x 104 {gamma}-irradiated (10,000 rads) syngeneic EL4-MAGE-3 cells or EL4-HBcAg cells/2 ml in 24-well plates (Costar) for 4–6 days in 5% CO2 at 37°C, pooled, and then resuspended to 1 x 107 cells/ml. To label the target cells, [3 H]thymidine was added into 5 x 105/ml EL4-MAGE-3 or EL4-HBcAg cells at a final concentration of 2 µCi/ml. After 6 h incubation, the cells were gently washed once with PBS and resuspended in the culture medium (1 x 105 cells/ml). Different numbers of effector cells were then cocultured with a constant number of target cells (1 x 104/well) in 96-well round-bottomed plates (200 µl/well) for 4 h at 37°C, after which the cells and their media were then aspirated onto fiber glass filters (Filter Mate Harvester; Packard) that were then extensively washed with water. After the filters were dried and placed onto 96-well plates, 25 µl of MicroScint 20 (Packard) were added to each well. The plates were then counted in a TopCount NXT Microplate Scintillation and Luminescence Counter (Packard). In some experiments, the restimulated effector cell populations were incubated with the anti-CD4 or anti-CD8 antibodies (30 µl/well; PharMingen) for 30–60 min to deplete CD4+ or CD8+ T cells before cytotoxicity assays. The percentage of specific killing was defined as: [(Target cell DNA retained in the absence of T cells (spontaneous) - Target cell DNA retained in the presence of T cells)/Spontaneous DNA retained] x 100. The value of total [3 H]thymidine incorporation is often similar to the spontaneous retention.

Antibody Assay.
Anti-MAGE-3 antibodies in the sera of immunized mice were detected by ELISA. Briefly, microtiter plates (Dynatech) coated with recombinant MAGE-3 proteins (Ref. 38 ; 50 ng each/well) were incubated with serially diluted sera in a blocking buffer (KPL, Gaithersburg, MD) at room temperature for 2 h. Bound antibody was detected after incubation with a peroxidase-conjugated antibody against mouse IgG (Sigma) diluted in the blocking buffer. A mAb against MAGE-3 was used as a positive control (38) , and normal mouse serum was used as a negative control. The antibody titer was defined as the highest dilution with an A450 greater than 0.2. The background A450 of normal mouse serum was lower than 0.1.

Tumor Challenge Studies.
C57BL/6 mice were immunized by i.v. injection with 1 x 105 transduced DCs on days 0 and 7 and then intradermally challenged with 1 x 106 exponentially growing EL4-MAGE-3 or EL4-HBcAg cells 1 week after the second immunization. Tumor sizes were measured every 2–3 days, with tumor volumes calculated as follows: (longest diameter) x (shortest diameter)2 (40) .

Statistical Analyses.
All data are presented as means and SEs. ANOVA was used to determine the levels of differences between groups. Different groups were compared by the Student-Newman-Keuls test with SigmaStat 2.03 software (SPSS, Inc.). Ps were considered significant at 0.05.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Construction of Secretory MAGE-3-Fc Fusion Proteins.
MAGE-3 is a cytosolic and nuclear protein lacking a targeting sequence for the endogenous class II presentation pathway (18 , 38) , which makes its presentation on class II unlikely or difficult. Because there is no mouse homologue, a human MAGE-3 gene (32) was linked to a leader sequence derived from a human chemokine RANTES gene (33) to allow the secretion of MAGE-3. DCs, the most potent APCs, express IgG FcRs (Fc{gamma}Rs), which mediate a privileged antigen internalization route for efficient MHC class II-restricted as well as class I-restricted antigen (12 , 23 , 24 , 26 , 27) . Hence, a Fc fragment cDNA derived from a human IgG1 that can efficiently bind to FcRs on murine DCs (41) was fused in-frame with the modified MAGE-3 gene to mediate MAGE-3 internalization by DCs (Fig. 1A)Citation . The secretory MAGE-3 fusion gene (s-MAGE-3-Fc) was then cloned into a murine retroviral vector pFB-Neo (Stratagene; Fig. 1ACitation ). Several control retroviral vectors expressing a native, intracellular MAGE-3, secretory s-MAGE-3, or secretory Fc fragment were also constructed (Fig. 1A)Citation .



View larger version (31K):
[in this window]
[in a new window]
  		Fig. 1. Construction and expression of s-MAGE-3-Fc fusion proteins. A, schematic representation of recombinant retroviral vectors. The s-MAGE-3-Fc fusion gene was cloned into a retroviral pFB-Neo vector. The control MAGE-3 (cytosolic) gene, s-MAGE-3 (secretory) gene, or Fc cDNA fragment (secretory) was also cloned into the retroviral vector. S, the signal sequence; IRES, internal ribosome entry site sequence. B, expression of different constructs in DCs. Murine BM cells were transduced by recombinant retroviruses containing s-MAGE-3-Fc, s-MAGE-3, MAGE-3, or vector control and differentiated into DCs in the presence of mGM-CSF and mIL-4 for 4 days. BM-derived DCs (1 x 108) transduced with each construct and their culture media were harvested. Cell lysates (C) and culture media (M) were precipitated with a rabbit polyclonal antibody against MAGE-3, followed by incubation with protein A-Sepharose (Sigma). a, 20 µl of each precipitate were heat denatured and then used for Western blot analysis stained with the mouse anti-MAGE-3 and an antimouse IgG horseradish peroxidase conjugate. Western blots were visualized by chemiluminescent detection (ECL-Plus; Amersham). b, protein band intensity of the Western blot was determined and analyzed by a PhosphorImager (Molecular Dynamics) with an Image-Quant software. C, flow cytometric analysis of transduced DCs. BM-derived DCs transduced with each construct were stained for MHC-II (M5/114.15.2), CD40 (HM40-3), and CD86/B7.2 (GL1; PharMingen) on day 6 of DC culture and analyzed by FACScan. Nontransduced BM-derived DCs on day 5 of DC culture were incubated in the presence of LPS (0.5 µg/ml; Sigma) for 24 h and then subjected to flow cytometric assay. Data were prepared with Cellquest software (Tristar). The transduced DCs were directly stained with a second antibody conjugate as a negative control. s-MAGE-3-Fc-DCs and LPS-treated DCs showed increased surface levels of all three molecules, characteristic of mature DCs.

 
Expression of s-MAGE-3-Fc Fusion Protein and Its Effect on DCs.
To assess the expression of these constructs in DCs, we transduced mouse BM cells in medium supplemented with mSCF and IL-6, using recombinant murine retroviral vectors that express s-MAGE-3-Fc, s-MAGE-3, MAGE-3, or Fc (Fig. 1A)Citation . The transduced cells were then cultured in medium containing mIL-4 and GM-CSF to allow their differentiation into DCs (36 , 40) . After several days of culture, a substantial fraction of the cells showed distinct DC morphology. The s-MAGE-3-Fc, s-MAGE-3, MAGE-3, or Fc gene in the transduced DCs was transcribed, as demonstrated by reverse transcription-PCR assays (data not shown). Quantitative Western blotting analysis was used to demonstrate protein expression and secretion by the constructs in transduced DCs. It was found that the s-MAGE-3-Fc and s-MAGE-3 proteins were efficiently produced and secreted from DCs, whereas MAGE-3 was retained intracellularly (Fig. 1B)Citation . Comparable levels of s-MAGE-3-Fc, s-MAGE-3, and MAGE-3 proteins were expressed in the transduced DCs. The multiple bands of the MAGE-3 protein on the SDS-PAGE may be attributable to posttranslational modifications, as reported previously (42) .

Interaction of Fc with Fc{gamma}Rs on DCs triggers cell activation, causing the up-regulation of cell surface molecules involved in antigen presentation (26 , 28) . To evaluate whether the expression of s-MAGE3-Fc in the transduced DCs could induce DC activation, we examined surface markers of DCs transduced with s-MAGE-3-Fc, s-MAGE-3, or vector by flow cytometric assays. As shown in Fig. 1Citation C, higher levels of MHC class II, CD40, and CD86 were expressed on DCs derived from BM cells transduced with s-MAGE-3-Fc and on DCs in the presence of LPS than on DCs transduced with s-MAGE-3 or vector control. This result suggests that the secretion and subsequent interaction of the fusion protein Fc with Fc{gamma}R activate DCs.

Broad Induction of Potent Th1, CTLs, and Antibody Responses in Vivo.
We next tested whether the secretion and subsequent internalization of MAGE-3 can enhance the immunogenicity of this antigen in vivo. DCs were transduced with s-MAGE-3-Fc, s-MAGE-3, MAGE-3, or Fc by retroviral vectors and then administered (i.v.) once into C57BL/6 mice (1 x 105 DCs/mouse). Four to 6 weeks after immunization, the mice were sacrificed, and peripheral bloods, spleens, and other tissue samples were collected. Lymph nodes were substantially enlarged in the mice immunized with s-MAGE-3-Fc-DCs, reminiscent of pathogen infection, but not in the mice administered with DCs transduced with s-MAGE-3, MAGE-3, or Fc (data not shown).

To determine whether immunization with transduced DCs can induce CD4+ Th responses, we isolated CD4+ T cells from splenocytes of the immunized mice and then cocultured them with BM-derived DCs transduced with s-MAGE-3-Fc. During 2 weeks of coculture with different ratios of CD4+ T cells versus DCs, the CD4+ T cells from mice immunized with s-MAGE-3-DCs, MAGE-3-DCs, or Fc-DCs did not actively proliferate, and only low levels of IL-2, IFN-{gamma}, TNF-{alpha}, and IL-4 were detected in the coculture media (Fig. 2A)Citation . In contrast, in the cocultures with CD4+ T cells from mice immunized with s-MAGE-3-Fc-DCs, high levels of IL-2 and IFN-{gamma} were detected in the coculture media after only 48 h of coculture, even at a 1:1000 (DC:T cell) ratio. Anti-CD4, but not anti-CD8 antibodies, blocked the cytokine production by the cocultured cells (Fig. 2B)Citation . Repeated experiments showed similar results. To further determine the specificity of the T-cell responses, BM-derived DCs transduced with a retroviral vector expressing an irrelevant HBcAg were cocultured with CD4+ T cells from s-MAGE-3-Fc-DC-immunized mice. Only low levels of IFN-{gamma} and other cytokines were detected in the coculture medium (Fig. 2B)Citation . Furthermore, DCs from the lymph nodes of mice 6 weeks after immunization were isolated with anti-CD11c microbeads (Miltenyi Biotec, Inc.) and cocultured with CD4+ T cells from the same immunized mice. As shown in Fig. 2Citation C, high levels of IL-2, IFN-{gamma}, and TNF-{alpha} were only detected in the cocultures of the cells from s-MAGE-3-Fc-DC-immunized mice. These results indicate that the DCs transduced with s-MAGE-3-Fc can home to lymphoid organs or tissues and activate Th1 responses more efficiently than do DCs transduced with the native MAGE-3 or s-MAGE-3.



View larger version (17K):
[in this window]
[in a new window]
  		Fig. 2. In vivo induction of CD4+ Th1 responses. Mice immunized with DCs transduced with different vectors were sacrificed 6 weeks after immunization. CD4+ T cells were isolated from pooled splenocytes of six immunized mice (each group) by using a CD4+ T-cell enrichment column (R&D Systems). A, the CD4+ T cells were then cocultured in duplicate with s-MAGE-3-Fc-transduced BM-derived DCs from naïve mice. The concentrations of IL-2, IL-4, IFN-{gamma}, and TNF-{alpha} in the media were determined by ELISA after 48 h of coculture. B, the CD4+ T cells from the s-MAGE-3-Fc-DCs immunized mice were cocultured with s-MAGE-3-Fc-DCs in the presence or absence of anti-CD4 or anti-CD8 antibodies (top panel) or cocultured with HBcAg-transduced DCs (bottom panel). IFN-{gamma} levels in the coculture media were then determined. C, CD4+ T cells isolated from pooled splenocytes of six immunized mice (each group) were cocultured with DCs isolated from draining lymph nodes of the same immunized mice at a ratio of 1000:1 (T:DC). The cytokine levels in the coculture media are presented. P < 0.05, s-MAGE-3-Fc-DCs compared with other transduced DCs. Data represent the means of two independent assays of one representative experiment of three (six mice/group); bars, SE.

 
To determine whether immunization with s-MAGE-3-Fc-DCs can induce strong CTL responses, we performed the JAM test (39) . Splenocytes from immunized mice were restimulated in vitro in RPMI 1640, 10% FBS with syngeneic cells EL4-MAGE-3, and then cocultivated with [3 H]thymidine-labeled EL4-MAGE-3 cells at various E:T ratios to measure the specific killing. EL4-MAGE-3 cells were established by transfection with the MAGE-3 expression vector (pcDNA3.1-MAGE-3) and Zeocin (Invitrogen) selection and shown to express MAGE-3 by PCR and immunoprecipitation assays (data not shown). Splenocytes from mice immunized with s-MAGE-3-Fc-DCs killed target cells much more efficiently than those from mice immunized with s-MAGE-3, MAGE-3, or Fc (Fig. 3A)Citation . The specificity of killing was further demonstrated by the inability of the splenocytes of s-MAGE-3-Fc-DCs-immunized mice to kill EL4-HBcAg cells that express the irrelevant HBcAg and by the inhibition of killing with the anti-CD8, but not the anti-CD4 antibody (Fig. 3A)Citation . Thus, these results demonstrate the superior ability of s-MAGE-3-Fc-DCs to induce CTL responses, probably because of the enhanced Th1 and cross-priming of receptor-mediated antigen internalization.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 3. A, in vivo induction of cytotoxicity responses. Splenocytes taken from six mice/group 6 weeks after immunization were restimulated in vitro with irradiated EL4-MAGE-3 cells for 5 days. The restimulated splenocytes (E) were cocultured for 4 h with the [3H]thymidine-labeled target cells, EL4-MAGE-3 or EL4-HBcAg (control; T; top panel). The restimulated splenocytes (E) from sMAGE3-Fc-DC-immunized mice were cocultured for 4 h with the [3H]thymidine-labeled EL4-MAGE-3 cells (T) in the presence of anti-CD4 or anti-CD8 antibodies (bottom panel). Percentages of target cell killing by the splenocytes from different immunized mice are shown; P < 0.05, s-MAGE-3-Fc compared with others. Data represent the means of triplicate samples from one representative experiment of three (six mice/group); bars, SE. B, induction of high-titer antibody responses. The titers of MAGE-3-specific IgG antibodies from the individual mice at week 6 after DC immunization were determined by ELISA.

 
Because antibodies can also play a role in antitumor immunity (43) , we measured anti-MAGE-3 antibody titers in the sera of immunized mice by ELISA. Anti-MAGE-3 antibodies were induced 2 weeks after DC immunization and reached peak 4–6 weeks after immunization. As shown in Fig. 3Citation B, significantly higher titers of anti-MAGE-3 antibodies were detected in the sera of s-MAGE-3-Fc-DC-immunized mice than in mice immunized with s-MAGE-3-DCs or MAGE-3-DCs. The specificity of the antibody responses was demonstrated by the lack of antibody against the irrelevant HBcAg in the immunized mice (data not shown). Taken together, the findings indicate that s-MAGE-3-Fc-DCs are superior to MAGE-3-DCs or s-MAGE-3-DCs in inducing CD4+ Th, CD8+ CTL, as well as B-cell responses.

Enhanced Interaction of Th Cells with Transduced DCs.
Primed CD4+ Th cells that recognize their specific peptides in the context of MHC class II on DCs greatly increase their interaction with conditioned DCs (10) . This interaction via CD40-CD40L can trigger DC production of IL-12 and is critical for generating T-cell helper for CTL responses (10, 11, 12 , 44) . To test whether this approach can enhance CD4+ Th interaction with s-MAGE-3-Fc-DCs, IL-12 production by transduced DCs in coculture with primed CD4+ T cells was measured. Primed CD4+ T cells were isolated from mice immunized with s-MAGE-3-Fc-DCs and then cocultured with BM-derived DCs transduced with s-MAGE-3-Fc, s-MAGE-3, MAGE-3, or Fc. As shown in Fig. 4Citation , a significant increase in IL-12 production was observed in the CD4+ T-cell coculture with s-MAGE-3-Fc-DCs but not in the cocultures with s-MAGE-3-DCs or MAGE-3-DCs. The IL-12 production by s-MAGE-3-Fc-DCs was inhibited by blocking with CD40L on the primed CD4+ T cells. The expression of Fc in DCs also nonspecifically enhanced IL-12 production to a lesser degree. These results, together with our in vivo data, indicate that the secretion and subsequent Fc{gamma}R-mediated internalization of MAGE-3 lead to the cross-presentation of MAGE-3 on DCs for the induction of Th1 and CTL responses.



View larger version (6K):
[in this window]
[in a new window]
  		Fig. 4. Enhanced interaction of T cells with s-MAGE-3-Fc-DCs. Primed CD4+ T cells isolated from splenocytes of mice immunized with s-MAGE-3-Fc-DCs (5 x 105/ml) were cocultured with BM-derived DCs transduced with s-MAGE-3-Fc, s-MAGE-3, MAGE-3, or Fc (5 x 105/ml) for 24 h. IL-12 levels in the coculture in the presence or absence of an anti-CD40L antibody (MR1; PharMingen) were measured by ELISA. For antibody blocking, primed CD4+ T cells were preincubated with an anti-CD40L (10 µg/ml) at 4°C for 60 min and then cocultured with DCs. Bars, SE.

 
Protective Immunity Induced by s-MAGE-3-Fc-DCs.
Finally, we examined whether the enhanced anti-MAGE-3 immune responses could lead to effective antitumor immunity. The EL4-MAGE-3 cell line was derived from the parental tumor EL-4 line that grows rapidly in syngeneic mice (40) and used for challenge experiments. When intradermally implanted into syngeneic C57BL/6 mice, EL4-MAGE-3 cells (0.5 to 1 x 106 cells) showed aggressive tumor growth similar to that of parental EL-4 cells, producing visible tumors in mice by only 3–5 days after inoculation and resulting in mouse death usually within 1 month after inoculation. To test the ability of s-MAGE-3-Fc-DCs to inhibit EL4-MAGE-3 tumor growth, we immunized mice i.v. twice (7-day interval) with 1 x 105 DCs transduced with s-MAGE-3-Fc, s-MAGE-3, MAGE-3, or Fc, followed by challenge with the EL4-MAGE-3 cells (1 x 106). As shown in Fig. 5Citation A, tumor growth was inhibited to a much greater extent in mice immunized with s-MAGE-3-Fc-DCs, although immunization with s-MAGE-3-DCs, MAGE-3-DCs, or even Fc-DCs (a nonspecific immune stimulator) did confer some degree of protection. Repeated experiments showed similar results. The potency of the antitumor activity shown by these constructs correlated with their abilities to induce immune responses. Consistently, the mice immunized with s-MAGE-3-Fc-DCs survived considerably longer than mice immunized with other vector-transduced DCs (Fig. 5B)Citation . In the s-MAGE-3-Fc-DC-immunized group, 28% of mice (10 of 36 total immunized mice) were tumor free and completely protected. Mice that developed tumor survived longer in comparison with mice immunized with other constructs. All mice (100%) that were immunized with s-MAGE-3-DCs (18 mice), MAGE-3-DCs (18 mice), Fc-DCs (18 mice), or PBS (18 mice) developed tumor and were dead within 2 months after tumor challenge. The antitumor activity induced by the s-MAGE-3-Fc-DCs was specific, because mice immunized with s-MAGE-3-Fc-DCs and challenged with wild-type EL4 or EL4-HBcAg cells also developed lethal tumors and died within 1 month (data not shown). s-MAGE-3-Fc-DCs also partially inhibited the growth of established EL4-MAGE-3 tumors in mice (data not shown), although the immune system may not have sufficient response time to effectively control rapidly lethal tumor growth in this model.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 5. Antitumor immunity. C57BL/6 mice were immunized by i.v. injection with 1 x 105 DCs transduced with different constructs on days 0 and 7. On day 7 after the second immunization, the mice were intradermally inoculated with 1 x 106 exponentially growing EL4-MAGE-3 tumor cells. Tumor sizes were measured every 3 days. A, tumor volumes in each group are presented. Data represent the means of one of three independent experiments; bars, SE. B, the survival rates were calculated from the survival data of total three independent experiments; P < 0.05, s-MAGE-3-Fc compared with other groups.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Increasing numbers of tumor-specific and -associated antigens have been identified and used as targets for tumor therapy (15 , 45 , 46) . Inadequate antigen presentation by APCs is a major factor for the failure of the immune system to mount effective immune responses against these tumor antigens (6 , 9 , 47, 48, 49) . Thus, an approach with the capacity to generate both antigen-specific CD4+ Th and CD8+ CTL responses in a cognate manner may provide optimal immunization against tumors. Many tumor-specific or -associated intracellular antigens, such as MAGE-3, lack targeting sequences for the endogenous class II pathway and cannot be presented or are difficult to present to MHC class II, thus precluding the activation of critical CD4+ Th cells (Fig. 6)Citation . Here we describe a novel retrogen strategy that can efficiently cross-present an intracellular tumor antigen to both MHC class II and class I by DCs in a cognate manner, leading to the activation of both antigen-specific Th and CTL responses (Fig. 6)Citation . Thus, this unifying antigen presentation strategy that can induce broad and potent antitumor immunity could be generally used to improve the efficacy of tumor vaccines and immunotherapies.



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 6. Schematic representation of retrogen strategy for enhancement of antitumor immune responses. Intracellular tumor antigens such as MAGE-3 are difficult to be processed and presented to MHC class II for induction of CD4+ Th responses. Even a modified, secreted MAGE-3 cannot be efficiently taken up and presented by DCs via fluid-phase antigen pinocytosis. However, the MAGE-3 retrogen is secreted and then internalized by DCs via receptor-mediated endocytosis. The receptor-mediated internalization of the retrogen by DCs activates DCs and efficiently presents it to both MHC class II and class I in a cognate manner by using the endosomal class II antigen presentation pathway and cross-priming pathway to efficiently activate CD4+ and CD8+ T cells.

 
Increasing efforts have been made to enhance the crucial CD4+ Th responses to intracellular tumor antigens. For example, several investigators have used the invariant chain of MHC class II complexes and the sorting sequence of lysosome-associated membrane protein to target intracellular antigens to the endogenous class II pathway (50 , 51) . The retrogen approach we have developed has several unique and advantageous features: (a) this approach can efficiently allow DCs to cross-present intracellular antigens as exogenous to both class II via the endosomal class II pathway and class I via the cross-priming pathway in a cognate manner, leading to the generation of both antigen-specific Th and CTL responses; (b) the receptor-mediated antigen internalization activates DCs, which is important because an optimal DC antigen presentation requires the antigen processing and a maturation signal to DCs (24 , 26 , 30 , 52) ; (c) secreted tumor antigens that are natively located inside the cell can be efficiently captured by DCs in both autocrine and paracrine modes to further enhance Th and CTLs responses; (d) this approach can elicit strong antibody responses because of the efficient protein secretion from transduced cells and the enhanced Th responses. This advantage may be important because antibody responses were shown to be responsible for antitumor activities and a combined T-cell and antibody-based immunotherapy may be optimal (43 , 53) ; (e) this strategy should be superior to transient peptide-pulse of DCs, because the transduced DCs can continuously produce as well as process tumor antigens; and (f) our approach should be adaptable to any intracellular antigen or many cell-binding domains, allowing its incorporation into the design of virtually any vaccine or immunotherapy. We are aware that MAGE-3 is not a self-antigen to mice, and it would be more difficult to induce antitumor immunity against autologous antigens. Nevertheless, the superior ability of this strategy to induce broad immune responses against the model antigen was demonstrated clearly. Indeed, Th and CTL responses against pathogens such as HBV are also dramatically enhanced by using this strategy (54) . Thus, this novel retrogen approach with the ability to efficiently induce all arms of the adaptive immunity against any intracellular antigen may provide a generic and powerful means for the development of more potent vaccines and immunotherapies against tumors and other pathogens.


   ACKNOWLEDGMENTS
 
We thank Drs. M. Brenner, R. Cook, J. Rodgers, and M. Barry for helpful suggestions.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grants AI41959 and RR13272 from the NIH and the North Carolina Baptist Hospital Technology Developmental Award. J. H. is supported by a United States Army Breast Cancer Predoctoral Fellowship. Back

2 To whom requests for reprints should be addressed, at Center for Cell and Gene Therapy, N1004, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. Phone: (713) 798-1236; Fax: (713) 798-1230; E-mail: sychen{at}bcm.tmc.edu Back

3 The abbreviations used are: Th, T helper; DC, dendritic cell; APC, antigen-presenting cell; HBcAg, hepatitis B virus core antigen; FBS, fetal bovine serum; mAb, monoclonal antibody; BM, bone marrow; mGM-CSF, murine granulocyte/macrophage-colony stimulating factor; IL, interleukin; mIL, murine IL; FcR, Fc receptor; mSCF, murine stem cell factor; LPS, lipopolysaccharide; TNF, tumor necrosis factor. Back

Received 7/21/00. Accepted 11/ 9/00.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Greenberg P. D., Cheever M. A., Fefer A. Eradication of disseminated murine leukemia by chemoimmunotherapy with cyclophosphamide and adoptively transferred immune syngeneic Lyt-1+2- lymphocytes. J. Exp. Med., 154: 952-963, 1981.[Abstract/Free Full Text]
  2. Hung K., Hayashi R., Lafond-Walker A., Lowenstein C., Pardoll D., Levitsky H. The central role of CD4(+) T cells in the antitumor immune response. J. Exp. Med., 188: 2357-2368, 1998.[Abstract/Free Full Text]
  3. Ossendorp F., Mengede E., Camps M., Filius R., Melief C. J. Specific T helper cell requirement for optimal induction of cytotoxic T lymphocytes against major histocompatibility complex class II negative tumors. J. Exp. Med., 187: 693-702, 1998.[Abstract/Free Full Text]
  4. Abbas A. K., Murphy K. M., Sher A. Functional diversity of helper T lymphocytes. Nature (Lond.), 383: 787-793, 1996.[Medline]
  5. Kalams S. A., Walker B. D. The critical need for CD4 help in maintaining effective cytotoxic T lymphocyte responses. J. Exp. Med., 188: 2199-2204, 1998.[Free Full Text]
  6. Pardoll D. M., Topalian S. L. The role of CD4+ T cell responses in antitumor immunity. Curr. Opin. Immunol., 10: 588-594, 1998.[Medline]
  7. James R. F., Edwards S., Hui K. M., Bassett P. D., Grosveld F. The effect of class II gene transfection on the tumourigenicity of the H-2K-negative mouse leukaemia cell line K36. 16. Immunology, 72: 213-218, 1991.[Medline]
  8. Mumberg D., Monach P. A., Wanderling S., Philip M., Toledano A. Y., Schreiber R. D., Schreiber H. CD4(+) T cells eliminate MHC class II-negative cancer cells in vivo by indirect effects of IFN-{gamma}. Proc. Natl. Acad. Sci. USA, 96: 8633-8638, 1999.[Abstract/Free Full Text]
  9. Bennett S. R., Carbone F. R., Karamalis F., Miller J. F., Heath W. R. Induction of a CD8+ cytotoxic T lymphocyte response by cross-priming requires cognate CD4+ T cell hel. p. J. Exp. Med., 186: 65-70, 1997.[Abstract/Free Full Text]
  10. Ridge J. P., Di Rosa F., Matzinger P. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature (Lond.), 393: 474-478, 1998.[Medline]
  11. Bennett S. R., Carbone F. R., Karamalis F., Flavell R. A., Miller J. F., Heath W. R. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature (Lond.), 393: 478-480, 1998.[Medline]
  12. Schoenberger S. P., Toes R. E., van der Voort E. I., Offringa R., Melief C. J. T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions [see comments]. Nature (Lond.), 393: 480-483, 1998.[Medline]
  13. Nuchtern J. G., Biddison W. E., Klausner R. D. Class II MHC molecules can use the endogenous pathway of antigen presentation. Nature (Lond.)., 343: 74-76, 1990.[Medline]
  14. Vijayasaradhi S., Xu Y., Bouchard B., Houghton A. N. Intracellular sorting and targeting of melanosomal membrane proteins: identification of signals for sorting of the human brown locus protein, gp75. J. Cell Biol., 130: 807-820, 1995.[Abstract/Free Full Text]
  15. Van den Eynde B. J., van der Bruggen P. T cell defined tumor antigens. Curr. Opin. Immunol., 9: 684-693, 1997.[Medline]
  16. van der Bruggen P., Bastin J., Gajewski T., Coulie P. G., Boel P., De Smet C., Traversari C., Townsend A., Boon T. A peptide encoded by human gene MAGE-3 and presented by HLA-A2 induces cytolytic T lymphocytes that recognize tumor cells expressing MAGE-3. Eur. J. Immunol., 24: 3038-3043, 1994.[Medline]
  17. Tanaka F., Fujie T., Tahara K., Mori M., Takesako K., Sette A., Celis E., Akiyoshi T. Induction of antitumor cytotoxic T lymphocytes with a MAGE-3-encoded synthetic peptide presented by human leukocytes antigen-A24. Cancer Res., 57: 4465-4468, 1997.[Abstract/Free Full Text]
  18. Chaux P., Vantomme V., Stroobant V., Thielemans K., Corthals J., Luiten R., Eggermont A. M., Boon T., van der Bruggen P. Identification of MAGE-3 epitopes presented by HLA-DR molecules to CD4(+) T lymphocytes. J. Exp. Med., 189: 767-778, 1999.[Abstract/Free Full Text]
  19. Manici S., Sturniolo T., Imro M. A., Hammer J., Sinigaglia F., Noppen C., Spagnoli G., Mazzi B., Bellone M., Dellabona P., Protti M. P. Melanoma cells present a MAGE-3 epitope to CD4(+) cytotoxic T cells in association with histocompatibility leukocyte antigen DR11 [see comments]. J. Exp. Med., 189: 871-876, 1999.[Abstract/Free Full Text]
  20. Weber J. S., Hua F. L., Spears L., Marty V., Kuniyoshi C., Celis E. A Phase I trial of an HLA-A1 restricted MAGE-3 epitope peptide with incomplete Freund’s adjuvant in patients with resected high-risk melanoma. J. Immunother., 22: 431-440, 1999.
  21. Nestle F. O., Alijagic S., Gilliet M., Sun Y., Grabbe S., Dummer R., Burg G., Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med., 4: 328-332, 1998.[Medline]
  22. Reynolds S. R., Oratz R., Shapiro R. L., Hao P., Yun Z., Fotino M., Vukmanovic S., Bystryn J. C. Stimulation of CD8+ T cell responses to MAGE-3 and Melan A/MART-1 by immunization to a polyvalent melanoma vaccine. Int. J. Cancer, 72: 972-976, 1997.[Medline]
  23. Albert M. L., Sauter B., Bhardwaj N. Dendritic cells acquire antigen from apoptotic cells and induce class I-restricted CTLs. Nature (Lond.), 392: 86-89, 1998.[Medline]
  24. Huang A. Y., Golumbek P., Ahmadzadeh M., Jaffee E., Pardoll D., Levitsky H. Role of bone marrow-derived cells in presenting MHC class I-restricted tumor antigens. Science (Washington DC), 264: 961-965, 1994.[Abstract/Free Full Text]
  25. Kovacsovics-Bankowski M., Rock K. L. A phagosome-to-cytosol pathway for exogenous antigens presented on MHC class I molecules. Science (Washington DC), 267: 243-246, 1995.[Abstract/Free Full Text]
  26. Regnault A., Lankar D., Lacabanne V., Rodriguez A., Thery C., Rescigno M., Saito T., Verbeek S., Bonnerot C., Ricciardi-Castagnoli P., Amigorena S. Fc{gamma} receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J. Exp. Med., 189: 371-380, 1999.[Abstract/Free Full Text]
  27. Sigal L. J., Crotty S., Andino R., Rock K. L. Cytotoxic T-cell immunity to virus-infected non-haematopoietic cells requires presentation of exogenous antigen. Nature (Lond.), 398: 77-80, 1999.[Medline]
  28. Daeron M. Fc receptor biology. Annu. Rev. Immunol., 15: 203-234, 1997.[Medline]
  29. Steinman R. M., Cohn Z. A. The interaction of soluble horseradish peroxidase with mouse peritoneal macrophages in vitro. J. Cell Biol., 55: 186-204, 1972.[Abstract/Free Full Text]
  30. Watts C. Capture and processing of exogenous antigens for presentation on MHC molecules. Annu. Rev. Immunol., 15: 821-850, 1997.[Medline]
  31. Serre K., Machy P., Grivel J. C., Jolly G., Brun N., Barbet J., Leserman L. Efficient presentation of multivalent antigens targeted to various cell surface molecules of dendritic cells and surface Ig of antigen-specific B cells. J. Immunol., 161: 6059-6067, 1998.[Abstract/Free Full Text]
  32. Gaugler B., Van den Eynde B., van der Bruggen P., Romero P., Gaforio J. J., De Plaen E., Lethe B., Brasseur F., Boon T. Human gene MAGE-3 codes for an antigen recognized on a melanoma by autologous cytolytic T lymphocytes. J. Exp. Med., 179: 921-930, 1994.[Abstract/Free Full Text]
  33. Yang A. G., Bai X., Huang X. F., Yao C., Chen S. Phenotypic knockout of HIV type 1 chemokine coreceptor CCR-5 by intrakines as potential therapeutic approach for HIV-1 infection. Proc. Natl. Acad. Sci. USA, 94: 11567-11572, 1997.[Abstract/Free Full Text]
  34. Hu P., Glasky M. S., Yun A., Alauddin M. M., Hornick J. L., Khawli L. A., Epstein A. L. A human-mouse chimeric Lym-1 monoclonal antibody with specificity for human lymphomas expressed in a baculovirus system. Hum. Antibodies Hybridomas, 6: 57-67, 1995.[Medline]
  35. Chen J. D., Bai X., Yang A. G., Cong Y., Chen S. Y. Inactivation of HIV-1 chemokine co-receptor CXCR-4 by a novel intrakine strategy. Nat. Med., 3: 1110-1116, 1997.[Medline]
  36. Inaba K., Inaba M., Romani N., Aya H., Deguchi M., Ikehara S., Muramatsu S., Steinman R. M. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med., 176: 1693-1702, 1992.[Abstract/Free Full Text]
  37. Gallagher, S., Winston, S. E., Fuller, S. A., and Hurrell, J. G. R. Immunoblotting and immunodetection. In: R. Coico (ed.), Current Protocols in Immunology (Supplement 26), Vol. 2, pp. 8.100.1–8.10.21. New York: John Wiley & Sons, Inc., 1998.
  38. Kocher T., Schultz-Thater E., Gudat F., Schaefer C., Casorati G., Juretic A., Willimann T., Harder F., Heberer M., Spagnoli G. C. Identification and intracellular location of MAGE-3 gene product. Cancer Res., 55: 2236-2239, 1995.[Abstract/Free Full Text]
  39. Matzinger P. The JAM test. A simple assay for DNA fragmentation and cell death. J. Immunol. Methods, 145: 185-192, 1991.[Medline]
  40. De Veerman M., Heirman C., Van Meirvenne S., Devos S., Corthals J., Moser M., Thielemans K. Retrovirally transduced bone marrow-derived dendritic cells require CD4+ T cell help to elicit protective and therapeutic antitumor immunity. J. Immunol., 162: 144-151, 1999.[Abstract/Free Full Text]
  41. Haeffner-Cavaillon N., Klein M., Dorrington K. J. Studies on the Fc{gamma} receptor of the murine macrophage-like cell line P388D1. I. The binding of homologous and heterologous immunoglobulin G1. J. Immunol., 123: 1905-1913, 1979.[Abstract/Free Full Text]
  42. Valmori D., Gileadi U., Servis C., Dunbar P. R., Cerottini J. C., Romero P., Cerundolo V., Levy F. Modulation of proteasomal activity required for the generation of a cytotoxic T lymphocyte-defined peptide derived from the tumor antigen MAGE-3. J. Exp. Med., 189: 895-906, 1999.[Abstract/Free Full Text]
  43. Syrengelas A. D., Levy R. DNA vaccination against the idiotype of a murine B cell lymphoma: mechanism of tumor protection. J. Immunol., 162: 4790-4795, 1999.[Abstract/Free Full Text]
  44. Mackey M. F., Gunn J. R., Ting P. P., Kikutani H., Dranoff G., Noelle R. J., Barth R. J., Jr. Protective immunity induced by tumor vaccines requires interaction between CD40 and its ligand, CD154. Cancer Res., 57: 2569-2574, 1997.[Abstract/Free Full Text]
  45. Rosenberg S. A. A new era for cancer immunotherapy based on the genes that encode cancer antigens. Immunity, 10: 281-287, 1999.[Medline]
  46. Gilboa E. The makings of a tumor rejection antigen. Immunity, 11: 263-270, 1999.[Medline]
  47. Banchereau J., Steinman R. M. Dendritic cells and the control of immunity. Nature (Lond.), 392: 245-252, 1998.[Medline]
  48. Bona C. A., Casares S., Brumeanu T. D. Towards development of T-cell vaccines. Immunol. Today, 19: 126-133, 1998.[Medline]
  49. Mellman I., Turley S. J., Steinman R. M. Antigen processing for amateurs and professionals. Trends Cell Biol., 8: 231-237, 1998.[Medline]
  50. Sanderson S., Frauwirth K., Shastri N. Expression of endogenous peptide-major histocompatibility complex class II complexes derived from invariant chain-antigen fusion proteins. Proc. Natl. Acad. Sci. USA, 92: 7217-7221, 1995.[Abstract/Free Full Text]
  51. Wu T. C., Guarnieri F. G., Staveley-O’Carroll K. F., Viscidi R. P., Levitsky H. I., Hedrick L., Cho K. R., August J. T., Pardoll D. M. Engineering an intracellular pathway for major histocompatibility complex class II presentation of antigens. Proc. Natl. Acad. Sci. USA, 92: 11671-11675, 1995.[Abstract/Free Full Text]
  52. Steinman R. M., Swanson J. The endocytic activity of dendritic cells [see comments]. J. Exp. Med., 182: 283-288, 1995.[Free Full Text]
  53. Cyster J. G., Hartley S. B., Goodnow C. C. Competition for follicular niches excludes self-reactive cells from the recirculating B-cell repertoire. Nature (Lond.), 371: 389-395, 1994.[Medline]
  54. You Z., Huang X., Hester J., Rollins L., Rooney C., Chen S-Y. Induction of vigorous helper and cytotoxic T-cell as well as B cells responses by dendritic cells expressing a modified antigen targeting receptor-mediated internalization pathway. J. Immunol., 165: 4581-4592, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
Y. Inoue, T. Kaifu, A. Sugahara-Tobinai, A. Nakamura, J.-I. Miyazaki, and T. Takai
Activating Fc{gamma} Receptors Participate in the Development of Autoimmune Diabetes in NOD Mice
J. Immunol., July 15, 2007; 179(2): 764 - 774.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Akiyama, S. Ebihara, A. Yada, K. Matsumura, S. Aiba, T. Nukiwa, and T. Takai
Targeting Apoptotic Tumor Cells to Fc{gamma}R Provides Efficient and Versatile Vaccination Against Tumors by Dendritic Cells
J. Immunol., February 15, 2003; 170(4): 1641 - 1648.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by You, Z.
Right arrow Articles by Chen, S.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by You, Z.
Right arrow Articles by Chen, S.-Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online