| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Departments of Cell Biology [C. A. Z., D. M., J. M. R.] and Pathology [R. L.] and The Methodist Hospital [R. L.], Baylor College of Medicine, Houston, Texas 77030, and Center for Comparative Medicine, University of California at Davis, Davis, California 95616 [R. D. C.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
C/EBPß is a member of the C/EBP family of transcription factors that
bind to specific DNA sequences as homo- and heterodimers and affect the
transcription of target genes involved in proliferation and
differentiation. Six C/EBP genes have thus far been
identified (C/EBP
, C/EBPß,
C/EBP
, C/EBP
, C/EBP
, and
C/EBP
), and all of the genes are intronless except for
C/EBP and C/EBP. Transcription of C/EBPß
results in a single mRNA that can be translated into four isoforms: LAP
(full-length LAP-Mr 38,000 and
LAP-Mr 35,000); LIP
(LIP-Mr 20,000); and a smaller
Mr 16,000 isoform. The
predominant isoforms expressed in the mouse mammary gland are the
Mr 35,000 and
Mr 20,000 family members. Several
different mechanisms have been described to account for the
differential expression of the C/EBPß isoforms: (a) a
leaky ribosome scanning mechanism (1)
;
(b) the interaction of a CUG repeat binding protein (CUGBP1)
with the 5' region of C/EBPß mRNA (2)
; (c) a
mechanism involving the evolutionary conserved upstream open reading
frame of the 5' region of C/EBPß mRNA and the eukaryotic translation
initiation factors eIF-2 and eIF-4E (3)
; and
(d) specific proteolytic cleavage in hematopoietic
progenitor cells present in mouse liver (4)
. All C/EBPß
family members share a strong homology in the COOH-terminal,
leucine-rich dimerization domain (bZIP) and the DNA-binding basic
region. The truncated C/EBPß-LIP isoform, translated from the third
AUG, lacks most of the trans-activation domain and can,
therefore, dimerize and bind to DNA but is unable to activate gene
transcription. Because of an increased DNA affinity of the C/EBPß-LIP
isoform, this inhibition of transcriptional activity can occur even at
substoichiometric ratios of LIP:C/EBP, thereby suggesting a
dominant-negative function for C/EBPß-LIP (1)
. Thus,
the LAP:LIP ratio, rather than their absolute amounts, may be an
important indicator of transcriptional activity by C/EBPß.
Dimerization of bZIP proteins can occur in the absence of DNA but is a
prerequisite for DNA binding (5)
. Additionally, dimers of
bZIP proteins are usually unstable when not bound to DNA and will
rapidly dissociate back to monomers (6)
.
C/EBPß is vital for development of the mouse mammary gland (7
, 8)
. As demonstrated in the C/EBPß knockout mouse, mammary
glands contain enlarged, undeveloped ducts that have a low
proliferative rate and decreased tertiary branching. C/EBPß-LAP
expression is detectable throughout murine mammary gland development
and is in contrast to C/EBPß-LIP expression levels, which are highest
during pregnancy (proliferative state) and reduced in the virgin (mice
<4 months of age) gland and lactating gland (8
, 9)
. The
C/EBP and C/EBP genes are also expressed in
the murine mammary gland. Although C/EBP mRNA is expressed
throughout mammary development, C/EBP is not essential for mouse
mammary gland development (8)
. Additionally, knockout mice
have been generated for C/EBP (10)
, but a mammary gland
phenotype has not been reported. Nevertheless, the C/EBP transcript
is overexpressed during involution of the mouse mammary gland
(11
, 12)
, and cell culture studies have determined that
its predominant role in mammary gland development is in growth arrest
of mammary epithelial cells (13
, 14)
.
Consequently, the differential expression pattern of the C/EBPß isoforms suggests a dual and opposing role in mammary gland development and the importance of the LAP:LIP ratio as a cell cycle switch, resulting either in cellular differentiation or proliferation. Although C/EPBß-LIP is also overexpressed in breast cancer and is associated with biological predictors of poor survival, such as loss of estrogen and progesterone receptor expression, increased cellular proliferation, aneuploidy, and poor histological and nuclear grades (15) , its role in tumorigenesis is unknown. Taken together, these observations have led to the hypothesis that overexpression of the C/EBPß-LIP isoform in the mammary gland can result in epithelial cell proliferation that may render the mammary gland more susceptible to additional oncogenic hits, resulting in the initiation and progression of neoplasia. Persistent, aberrant expression of the C/EBPß-LIP isoform in these neoplasms may contribute to an increased growth rate and result in a more proliferative or aggressive tumor. To test this hypothesis, complementary approaches have been used to study the overexpression of C/EBPß-LIP in both transgenic mice and mammary epithelial cell lines. Our studies have demonstrated that C/EBPß-LIP overexpression is associated with increased epithelial proliferation, resulting in mammary hyperplasias and the stochastic development of infrequent carcinomas.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
MTS Cell Proliferation Assay.
Five independent LIP clones and five independent neomycin control
clones were plated in quadruplicate into a 96-well tissue culture
format at a density of 2 x 105
cells/well. The number of viable or proliferative cells was determined
for days 1, 3, 5, 7, 9, and 12 of culture using the CellTiter 96
Aqueous Non-Radioactive Cell Proliferation Assay from Promega,
according to the manufacturer’s instructions. After application of the
MTS reagent, the cells were incubated for 2–3 h at 37°C, and
absorbance at 490 nm was measured using a Dynex Technologies ELISA
plate reader. Data were plotted as fold change in growth rate.
BrdUrd Staining for FACS Analysis.
Two independent LIP clones and two independent neomycin control clones
were plated into 100-mm tissue culture dishes at a density of
1 x 106
cells/plate. At days 3,
7, 10, and 15 of culture, the cells were pulse labeled for 15 min with
10 µM BrdUrd (Amersham Life Science), washed with Hanks’
medium, and removed from the plate using the enzyme Dispase II
(Boehringer Mannheim). The pellet was resuspended in 200 µl of
Hanks’ medium, and the cells were fixed by the addition of 70%
ethanol while vortexing to avoid cell clumping. Cells were stored at
4°C in 70% ethanol until collection of the last time point.
Approximately 4 x 106
cells were
removed from the initial pellet and incubated for 10 min with 3 ml of
pepsin (0.04% in 0.10 N HCl) on a rocker at room
temperature. After centrifugation (1200 rpm for 5 min), the pepsin
supernatant was aspirated, 3 ml of 2 N HCl were added to a
vortexed pellet, and the mixture was incubated for 20 min at 37°C.
After incubation, 6 ml of 0.1 M sodium borate were added
while vortexing, and the cells were pelleted. After aspiration of the
supernatant, 6 ml of PBST-B (PBS with 0.5% Tween 20, 0.5% BSA) were
added while vortexing, the cells were pelleted, the supernatant was
aspirated, and 1 ml of PBS containing 1 unit of DNase-free RNase was
added and incubated for 30 min at 37°C. The nuclei were again
pelleted, the supernatant was removed, and 20 µl of anti-BrdUrd FITC
and 100 µl of PBST were added. The nuclei were incubated for 1 h
in the dark at room temperature, and 3 ml of PBST-B were added while
vortexing, the nuclei were pelleted, the supernatant was aspirated, and
propidium iodide (Sigma) was added for a final concentration of 5 or 10
µg/ml in PBST-B. Nuclei were stored at 4°C overnight and examined 1
day later by FACS analysis.
Active Caspase-3 Determination.
Active-caspase-3 levels were determined both by a fluorogenic assay and
FACS analysis. TM3 cells stably expressing either PCI-neo-LIP or
PCI-neo as control were plated at an equal density of 1.5 x 106
/100-mm plate and cultured for 3, 7,
10, and 15 days. At each time point, cells were harvested and processed
by two methods: scraping and freezing of the cell pellet for the
fluorogenic assay; or digestion with Dispase (Boehringer Mannheim),
followed by fixation with 4% paraformaldehyde for FACS analysis in the
Flow Cytometry Core Lab (Baylor College of Medicine, Houston,
TX). Active caspase-3 was determined using either Ac-DEVD-AMC Caspase-3
(CPP32) fluorogenic substrate or phycoerythrin-conjugated polyclonal
rabbit anti-active caspase-3 according to the manufacturer’s
instructions (PharMingen).
Plasmid Construction: WAP-LIP-WAP.
The first step in the generation of this construct was the
EcoRI linearization and Klenow fill-in of a pBluescript
SKII(+) plasmid containing 843 bp of rat WAP 3' sequence, with a
portion of the third exon, the third intron, all of the fourth exon,
and 70 bp of 3' flanking DNA. The second step included the removal of
865 bp of an NcoI/XhoI cDNA fragment (LIP)
from the COOH-terminal region of rat C/EBPß (MSV/C/EBPß, kindly
provided by Dr. S. McKnight, University of Texas Southwestern,
Dallas, TX). This cDNA insert contains only the third translation
initiation Met codon and encodes a full-length protein for LIP and not
the LAP isoforms. After fill-in with Klenow, the LIP cDNA fragment was
ligated to a position immediately 5' to the 3' WAP sequence in pSCPT
SKII(+). In the third step, the LIP-WAP 3' construct was excised using
both KpnI and SpeI, filled-in with Klenow, and
XbaI linkers were attached. This LIP-WAP3' fragment was then
ligated to an XbaI-linearized WAP 5' fragment, which
consists of 982 bp of a rat WAP 5' promoter fragment (-949 to +1) and
WAP 5' untranslated region (from +1 to +33). The integrity of the
WAP-LIP-WAP construct was confirmed by sequencing the WAP-LIP
boundaries. The WAP-LIP-WAP construct was removed from pSCPT SKII(+) by
digestion with BstXI and KpnI producing a vector
(2.9 kb) and insert fragment (2.75 kb) that were similar in size.
Further digestion using PvuI, which cuts only the vector,
allowed complete size fractionation and separation using agarose gel
electrophoresis. The DNA was further purified and concentrated on a
silica matrix (Glassmilk; Geneclean). Transgenic mice (FVB inbred) were
generated by the transgenic core facility at Baylor College of
Medicine.
Plasmid Construction: PCI-neo-LIP.
To construct PCI-neo-LIP, an 865-bp cDNA, which codes only LIP, was
excised from the WAP-LIP-WAP construct using XbaI and
EcoRV and directionally cloned into the PCI-neo plasmid
(Promega) at the XbaI and SmaI restriction sites
using T4 DNA ligase.
Analysis of Tail DNA.
Hot-start PCR reactions (25 µl) were performed using a bottom and top
mix initially separated by a wax barrier. The bottom mix, containing 1
µg of genomic tail DNA, 1 mM MgCl, 0.2 mM
deoxynucleotide triphosphates, 10% DMSO, and 10x Promega thermocycle
buffer in a final volume of 14.5 µl, was heated to 90°C for 10 min
to denature the DNA and melt the wax pellet and then cooled to 4°C.
The top mix, containing 12.5 pmol of each primer, 10x Promega
thermocycle buffer, and 2.5 units of Taq polymerase (Promega) in a
final volume of 10.5 µl, was added to the top of the hardened wax
barrier and allowed to mix with the bottom reagents by heating to
94°C. The reaction profile consisted of 30 cycles of 1 min at 94°C,
2 min at 60°C, and 3 min at 72°C. After the final cycle, the
samples were incubated at 72°C for an additional 5 min. Reactions
were performed in a DNA thermocycler (Perkin-Elmer). The PCR products
were resolved on a 1.5% agarose gel. The sequences of the synthetic
oligonucleotides used in the PCR reactions were as follows (5' to 3'):
rWAP+1 (F), ATCAGTCATCACTTGCCTGCCGCCG; and LIP 1574 (R),
GTGTGTTGCGTCAGTCCCGTGTCCA.
Protein Extraction and Western Blot Analysis.
Tissue and/or cells were disrupted in RIPA buffer [50 mM
Tris-Cl (pH 7.4), 1% NP40, 0.25% desoxycholate, 150 mM
NaCl, 1 mM EGTA, and 0.2% SDS] containing the following
kinase, phosphatase, and protease inhibitors: 1 mM
NaVO3, 1 mM NaF, 1 mM
Na2MoO4, 10 nM
okadaic acid, and 1 µg/ml each of benzamidine, aprotinin, soybean
trypsin inhibitor, and antipain. Aliquots of these lysates containing
100 µg of protein were electrophoresed on denaturing SDS
12%-polyacrylamide minigels and then transferred to polyvinylidene
difluoride membranes (Millipore, Bedford, MA) overnight at 75 mA. Blots
were blocked 90 min in TBST [20 mM Tris (pH 7.5), 150
mM NaCl, and 0.5% Tween 20] containing 3% nonfat dry
milk (Carnation, Glendale, CA) and then incubated for 90 min in this
solution containing antibodies (0.5 ng/ml; Santa Cruz) prepared against
C/EBPß. Blots were washed with TBST (without milk) three times for
5–10 min each, with agitation. Blots were then incubated for 60 min in
blocking solution containing 200 ng/ml biotinylated donkey antirabbit
immunoglobulin (Amersham, Little Chalfont, England) and washed. Lastly,
blots were incubated for 30 min in blocking solution containing 40
ng/ml streptavidin-horseradish peroxidase (Oncogene Science, Uniondale,
NY) and washed as before. Enhanced chemiluminescence (Hyperfilm;
Amersham) and chemifluorescence reagents (Storm Fluoroimager; Molecular
Dynamics) were used for visualization per the manufacturer’s
instructions.
Tissue.
Approximately 43 glands from lactating mice (day 10 of lactation) were
examined. Lactating mothers were separated from pups 2 h prior to
excision of the mammary glands to reduce the variability associated
with suckling and milk stasis. Inguinal glands were fixed in 10%
neutral buffered formalin for 6 h, embedded in paraffin, sectioned
at 5 µm, deparaffinized through a graded series of xylenes and
alcohols, rehydrated in water, and stained with H&E. Involuted,
inguinal, and thoracic mammary glands were removed and examined from 22
transgenic LIP mice and 14 control mice (nontransgenic siblings and
wild-type FVBs), 6–32 months of age. All mice were multiparous, and
most had undergone involution >3 months before biopsy; however, a few
mice were permitted to involute for a shorter interval of 14 days prior
to biopsy. Tissues were processed in a manner identical to that for
lactating tissue. Whole-mount analysis was performed as described by
Seagroves et al. (8)
.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, which preferentially targets high levels of C/EBPß-LIP
expression to the mammary gland in mice, starting at about days 7–10
of pregnancy and extending throughout lactation (17)
.
Seven WAP-LIP-WAP founder mice were generated. One female founder did
not produce live offspring, and the other three female founders were
mosaic and did not express the LIP transgene in their
mammary glands. The six remaining founders were bred further, and
transgene expression was detected in lactating glands of the
F1 generation from three of the six founder lines
(6067, 6074, and 6070) by Western blot analysis (Fig. 1B)
and by reverse transcription-PCR (data not shown). Unfortunately,
because of limitations of the currently available C/EBPß antibodies,
transgenic LIP expression could not be detected via immunocytochemistry
for two reasons: (a) the antibody recognizes the COOH
terminus and cannot distinguish between the C/EBPß-LIP and LAP
isoforms; and (b) the antibody cannot discriminate between
endogenous mouse C/EBPß-LIP and transgenic rat C/EBPß-LIP because
the proteins are >98% similar in amino acid identity. The level of
transgene expression was relatively constant in subsequent generations,
as evidenced by the similar levels of transgene expression observed in
the F1 as well as in the F5
generation (data not shown). Although the construct is not
epitope-tagged, the transgenic C/EBPß-LIP protein is developmentally
distinguishable from endogenous C/EBPß-LIP during lactation, because
the native LIP isoform is not expressed during lactation and is
primarily expressed during pregnancy (Fig. 1
B, FVB lane).
Consequently, it was hypothesized that any phenotypic effects resulting
from the overexpression of C/EBPß-LIP would, therefore, be most
readily detected during lactation and subsequent involution.
|
22 C/EBPß-LIP transgenic mice and 21
control mice (nontransgenic siblings and wild-type FVBs) corresponding
to days 1–18 of lactation were examined at both the gross and
microscopic levels. C/EBPß-LIP transgenic mice did not experience any
difficulties in nursing their pups, and no histological abnormalities
were observed in the mammary glands of lactating mice. Next, involuted
glands from 22 transgenic and 14 control mice (nontransgenic siblings
and wild-type FVBs), 6–32 months of age, were examined for
abnormalities. Mammary gland neoplasia was observed in 9% (2 of 22) of
transgenic mice and included two invasive carcinomas (Fig. 2A)
and three MINs (high grade; Fig. 2B
) from one
27-month-old mouse. MINs comprise a variety of intraluminal epithelial
proliferations with atypical cytology, including in situ
carcinomas (18)
. Additionally, the gland from a
20-month-old mouse contained a highly proliferative, poorly
differentiated carcinoma (Fig. 2D)
, and the gland
contralateral to the tumor contained diffuse alveolar hyperplasia (Fig. 2C)
. A more thorough, blind examination (by two independent
researchers, R. D. C. and D. M.) of a subset of the 22 involuted
glands revealed that 30–40% (3 of 10 or 4 of 10) of transgenic mice
contained two distinct forms of mammary hyperplasias known as focal
hyperplastic alveoli or HAN (Fig. 3, A and B)
and diffuse alveolar hyperplasia (Fig. 3, C and D)
. The epithelial cells in these
hyperplasias are characterized by their large shape and active nuclei
with open chromatin, large nucleoli, and a high rate of mitosis, as
evidenced by an abundance of mitotic figures. In contrast to normal
epithelial cells that have undergone a delayed involution, hyperplastic
cells contain very little lipid and are not actively secreting. The
described neoplasias and hyperplasias were observed in both the 6067
and 6074 lines, and no tumors or hyperplasias were observed in
age-matched, nontransgenic siblings or wild-type FVB mice.
|
|
The TM3 cell line was stably transfected with either CMV-driven
PCIneo-LIP or PCIneo (the vector without LIP cDNA insert, as control),
and stable cellular clones were generated. In the parental,
nontransfected cells, endogenous C/EBPß protein levels were observed
to change with growth. The expression of the native LIP isoform was
consistently observed to be higher when the cells were exponentially
growing than when the cells were contact inhibited or confluent (Fig. 4
, left panel). Consequently, CMV-driven expression of
C/EBPß-LIP from the PCIneo-LIP construct was easily detected during
confluence (Fig. 4
, middle panel). Passage number had little
effect on loss or gain of endogenous C/EBPß expression, as shown by
comparison of the first panel containing the earlier passage parental
TM3 line and the last panel (Fig. 4)
, which represents a late-passage
TM3 clonal line expressing only neomycin. Endogenous C/EBPß-LAP
levels were more variable during confluence, but endogenous
C/EBPß-LIP levels were usually low and were never observed to exceed
the expression levels for C/EBPß-LAP during confluence in TM3 cells.
|
. The fold change in growth was determined by dividing the number of
proliferating, viable cells (as measured by the amount of absorbance at
490 nm) at days 12, 9, 7, 5, and 3 by the value for proliferation at
day 1 for each clone. To determine whether this increase in cell number
or growth was attributable to an increase in the number of cells
entering S phase, cells were pulse labeled with BrdUrd at 3, 7, 10, and
15 days of culture and analyzed by flow cytometric (FACS) analysis
(Fig. 6B)
. The data indicate that expression of LIP in TM3 cells
facilitates entry into S-phase and DNA synthesis. Both the
LIP-expressing cells and the control cells exhibited similar levels of
BrdUrd incorporation during exponential growth (day 3) and early
confluence (day 7); however, the LIP-expressing cells did not remain
contact inhibited, and by day 15 of culture, at least 10% of the cells
had re-entered the cell cycle, were proliferating, and formed foci as
compared with the neomycin control cells, which remained a monolayer
(Fig. 6, A and B)
. Interestingly, CMV-driven LIP
expression does not coincide, temporally, with the renewed growth and
reentry of the LIP clones into the cell cycle (Fig. 6C)
.
Nuclear LIP expression, as well as the LIP:LAP ratio, was higher in the
LIP-expressing clones during the first week of culture than during the
second week (Fig. 6C)
. It is highly unlikely that the
proliferation observed in these cells can be attributed to clonal
variation, because foci formation was observed in at least four clonal
lines stably expressing C/EBPß-LIP and was never observed in the
control cells. In addition, the increase in cellular proliferation was
not accompanied by a decrease in apoptosis. The TM3 clones were assayed
for changes in caspase-3 activity using two independent methods (see
"Methods and Materials"), and the levels of active caspase-3 were
found not to be significantly decreased in the proliferating
LIP-expressing cells as compared with the control (Neo) cells (data not
shown).
|
|
. The larger size is suggestive of a more proliferative
tumor. This was confirmed by the detection of 10-fold more mitotic
figures in the LIP than in the control tumors or outgrowths (Fig. 7, A and B)
. Thus, evidence from both in
vitro tissue culture and in vivo transplantation
studies demonstrate that overexpression of C/EBPß-LIP in mammary
epithelial cells results in increased proliferation.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The incidence of hyperplastic and neoplastic lesions in our WAP-LIP-WAP mice are in agreement with several other published reports of genetically engineered mice bearing WAP-driven transgenes. For example, in WAP-stromelysin transgenic mice, 6–24 months of age, 20% of mice contained atypical proliferative lesions and 7.4% developed mammary carcinomas (24) . Transgenes driven by the WAP promoter are preferentially expressed in alveolar epithelial cells and, to a lesser extent, in ductal epithelial cells in the mammary gland (17 , 25 , 26) . The rat WAP promoter used in our transgenic study is minimally active during each estrous cycle in virgin as well as in multiparous females but is maximally expressed starting at day 10 of pregnancy and extending throughout lactation (17 , 26 , 27) . Consequently, the induction of hyperplasias by WAP-LIP-WAP probably occurs during pregnancy and/or lactation but may be detectable only after involution, following the regression of the surrounding normal alveolar epithelium. Attempts to detect an early, LIP-induced, proliferative response during pregnancy were unsuccessful because it was difficult to distinguish small increases in proliferation from the highly proliferative background during pregnancy (data not shown). WAP-driven C/EBPß expression after involution was not detectable by Western blots and could not be localized by immunohistochemistry as discussed previously. Thus, the hyperplasias observed in the involuted tissue are either no longer dependent on LIP expression or are maintained by the expression of LIP in a small subset of cells, possibly as a result of limited transgene expression that may occur during each estrous cycle. Likewise, in the cell culture studies, CMV-driven LIP expression was higher during exponential growth (day 3) and early confluence (day 7) than during days 10 and 15 of confluence, when LIP-induced proliferation is evident. Although these TM3 cells have been isolated as subclones that stably express C/EBPß-LIP, it is possible that the subset of cells that forms foci and proliferate during late confluence has higher levels of C/EBPß-LIP expression than the adjacent cells, which are less proliferative.
Targeted dominant-negative constructs are especially difficult to overexpress in transgenic mice, because the transgene has the potential to negatively regulate its own promoter. In fact, only one other transgenic study thus far has successfully overexpressed a dominant-negative, C/EBP-related protein (28) . Consequently, WAP regulatory sequences were chosen to target transgene expression to the mammary gland in this study because these sequences did not contain any known, functional C/EBP consensus sites. However, subsequent analysis of milk protein gene expression from the mammary glands of C/EBPß knockout mice has demonstrated that loss of C/EBPß can dramatically reduce the levels of both WAP mRNA and protein (7 , 8) . Similarly, when our WAP-LIP-WAP mice were crossed with C/EBPß-knockout mice, expression of the LIP transgene was reduced or was nondetectable (data not shown). Taken together, these data demonstrate that C/EBPß is indeed important in the regulation of WAP, and that autoregulatory effects of LIP may account for the moderate levels of transgene expression and subtle phenotype observed in these mice. Additionally, variegated or sectored localization of gene expression in transgenic mice can also account for variations in the level of transgene expression (29) . Several different transgenic mouse studies, including our studies with WAP-driven transgenes, have demonstrated that cells expressing the transgene often appear as scattered clusters, leading to a variegated pattern of gene expression (30 , 31) . This may also account, in part, for the focal versus diffuse pattern of hyperplasia observed in the WAP-LIP-WAP mice. Furthermore, the timing of transgene expression may also be an important factor because WAP-driven transgenes are not expressed until puberty. If it were possible to selectively target C/EBPß-LIP expression to the mammary gland either during early ductal development or in virgin transgenic mice, one might expect to observe a very different or more severe phenotype.
It is generally accepted that breast cancer originates in the terminal duct lobular unit (32) . Although the mouse mammary gland does not contain a terminal duct lobular unit, an equivalent structure would be the tertiary branches that give rise to the alveoli. HANs can form in this region, as was observed in the WAP-LIP-WAP transgenic mice. HAN is a low-grade, focal alveolar hyperplasia that persists in the involuted mammary gland and has been experimentally proven via transplantation experiments to be a precancerous, clonal lesion with high malignant potential (33, 34, 35) . Squamous metaplasia, inflammation, or lymphocytic infiltration, also frequently present in the involuted glands of WAP-LIP-WAP mice, has been proposed to be a normal repair response of the mammary gland to the hormonal challenges and damage caused by multiple pregnancies (18) .
Numerous reports in tissues other than the mammary gland support the
observation that C/EBPß-LIP plays a proliferative role in cell cycle
control. In adipocytes, C/EBPß and C/EBP have been shown to induce
C/EBP expression, which arrests the ongoing proliferation and
facilitates terminal cell differentiation (36
, 37)
.
Moreover, overexpression of C/EBPß-LIP results in continued
proliferation and is able to inhibit the adipocyte conversion into the
differentiated phenotype (38)
. Similarly, a recent study
has demonstrated that the introduction of C/EBPß-LIP via retroviral
gene transfer into 3T3-L1 cells results in proliferation, foci
formation, and a loss of contact inhibition (3)
. Although
C/EBP is primarily responsible for regulating terminal
differentiation in hepatocytes (39)
, cellular
proliferation in Hep G2 hepatoma cells is not blocked by C/EBP
expression but is abrogated by C/EBPß-LAP (40)
. In adult
hepatocytes, differentiation and proliferation are mutually exclusive
(40)
, and during rat postnatal development, the levels of
LAP in liver nuclei are elevated much more than those of LIP
(1)
. This is suggestive that the LAP:LIP ratio is
important for differential regulation of gene expression and
differentiation in the adult liver. In contrast, during hepatocyte
proliferation after partial hepatectomy, C/EBP levels decline, but
both C/EBP and C/EBPß levels increase. In fact, C/EBP:C/EBPß
heterodimers are replaced with C/EBPß homodimers during the early
G1 period after partial hepatectomy (41
, 42)
.
C/EBP family members have been historically described as DNA-binding
proteins; however, the C/EBPs are also capable of protein-protein
interactions with cell cycle proteins such as Rb and p21. The
C/EBPß-LIP and LAP isoforms can directly interact with the SV40T
antigen domain of hypophosphorylated Rb (43)
. This
transient but direct interaction with Rb increases DNA binding and
transactivation potential of the C/EBPß isoforms, and depending on
the ratio of LIP:LAP, may inhibit the transactivation potential of LAP
to transcribe genes involved in cellular differentiation
(43)
. Additionally, an in vivo analysis in the
liver of C/EBP knockout mice showed that C/EBP and p21 interact
via protein-protein interactions to stabilize p21 levels
(44)
. At the transcriptional level, studies in rat
hepatoma cells have demonstrated that C/EBP can bind to the
canonical C/EBP DNA binding site in the p21 cyclin-dependent kinase
inhibitor gene, resulting in the elevation of p21 expression, the
inhibition of cyclin-dependent kinase-dependent Rb phosphorylation, and
the induction of cell cycle arrest at G1
(45, 46, 47)
. Similarly, in human colorectal cancer cell
lines, C/EBPß has been shown to increase p21 transcription, but it
was not determined whether the C/EBPß isoforms have opposing effects
on p21 regulation (48)
. However, in primary cultures of
keratinocytes, the deletion of the C/EBPß gene did not
alter expression of p21 (49)
. Consequently, the regulation
of p21 by C/EBPß may be a tissue-specific process. Further
investigation of p21 regulation by LIP in mammary epithelial cells is
clearly warranted. These observations are important, because the
canonical C/EBP DNA binding site in the p21 gene promoter
should be capable of binding all of the C/EBPs, including C/EBPß. The
C/EBPs have identical binding specificities, and the hierarchy of DNA
binding affinities for the C/EBP consensus sequence is
C/EBPß > C/EBP > C/EBP
(50)
. If C/EBPß-LIP were to dimerize with C/EBP or
form homodimers with itself, the transcriptional regulation of p21
might be inhibited, resulting in phosphorylation of Rb and progression
through the G1-S transition. This provides a
potential mechanism by which C/EBPß-LIP might induce entry into
S-phase.
Alternatively, alterations in p21 or other cyclin-dependent kinase inhibitors may result in changes in apoptosis. Although no decreases in apoptosis were observed in the clonally selected TM3 cells, modulation of the LIP:LAP ratio may result in increased apoptosis in mammary epithelial cells5 or a rescue from apoptosis by matrix detachment in intestinal epithelial cells.6 Effects on apoptosis may be tissue specific and dependent on the amount of LIP present in the cells. Failure to obtain TM3 clones that highly express LIP, may be the result of induction of apoptoin in induction of apoptosis in these clones during selection. Thus, LIP expression may potentially regulate cell proliferation and/or apoptosis, depending on the cell type and cell-substratum interactions.
In conclusion, these studies indicate that the overexpression of C/EBPß-LIP in mammary epithelial cells promotes proliferation and the development of hyperplasias. The data also support the hypothesis that LIP overexpression may stimulate a growth cascade, which may be susceptible to additional oncogenic hits and result in the stochastic formation of tumors. The elucidation of the molecular mechanisms by which C/EBPß-LIP regulates cell cycle progression may, therefore, be critical for defining protein targets associated with premalignancy and neoplastic progression.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 This research was supported by Grant CA 16303
from the National Cancer Institute (to J. M. R.), Grant JB-0014 from
the State of California Breast Cancer Research Program (to R. D. C.),
and Contract DAMD17-96-1-6086, a postdoctoral fellowship from the
Department of Defense (to C. A. Z.). 
2 To whom requests for reprints should be
addressed, at Johns Hopkins Comprehensive Cancer Center, Room 542, 1650
Orleans Street, Baltimore, MD 21231.
3 The abbreviations used are: C/EBP,
CCAAT/enhancer binding protein; WAP, whey acidic protein; LAP,
liver-enriched activating protein; LIP, liver-enriched inhibitory
protein; MTS,
3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfonyl)-2H-tetrazolium;
BrdUrd, bromodeoxyuridine; FACS, fluorescence-activated cell
sorter; MIN, mammary intra-epithelial neoplasia; HAN, hyperplastic
alveolar nodule; CMV, cytomegalovirus; Rb, retinoblastoma; HOG,
hyperplastic outgrowth.
4 D. Medina, personal communication.
5 M. Bissell, personal communication.
6 J. Brugge, personal communication.
Received 6/23/00. Accepted 10/26/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and C/EBPß isoform expression. Genes Dev., 14: 1920-1932, 2000. regulates generation of C/EBPß isoforms through activation of specific proteolytic cleavage. Mol. Cell. Biol., 19: 1695-1704, 1999., is essential for ductal morphogenesis, lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes Dev., 12: 1917-1928, 1998. gene. EMBO J., 16: 7432-7443, 1997.[Medline]
(C/EBP-) is induced in growth- arrested mouse mammary epithelial cells. J. Biol. Chem., 272: 6291-6296, 1997. regulates mammary epithelial cell G0 growth arrest and apoptosis. J. Biol. Chem., 274: 16582-16589, 1999. and C/EBP ß expression modulate binding to the C/EBP site in the c-fos promoter. Hepatology, 19: 447-456, 1994.[Medline]
expression is required for steroid-induced G1 cell cycle arrest of minimal-deviation rat hepatoma cells. Mol. Cell. Biol., 16: 5288-5301, 1996. transcription factor in the glucocorticoid stimulation of p21waf1/cip1 gene promoter activity in growth-arrested rat hepatoma cells. J. Biol. Chem., 273: 2008-2014, 1998.This article has been cited by other articles:
|
|
 |
|
  C. S. Chen, C. M. Nelson, D. Khauv, S. Bennett, E. S. Radisky, Y. Hirai, M. J. Bissell, and D. C. Radisky Homology with Vesicle Fusion Mediator Syntaxin-1a Predicts Determinants of Epimorphin/Syntaxin-2 Function in Mammary Epithelial Morphogenesis J. Biol. Chem., March 13, 2009; 284(11): 6877 - 6884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yokota, T. Bui, Y. Liu, M. Yi, K. K. Hunt, and K. Keyomarsi Differential Regulation of Elafin in Normal and Tumor-Derived Mammary Epithelial Cells Is Mediated by CCAAT/Enhancer Binding Protein Cancer Res., December 1, 2007; 67(23): 11272 - 11283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Dudaronek, S. A. Barber, and J. E. Clements CUGBP1 Is Required for IFNbeta-Mediated Induction of Dominant-Negative CEBPbeta and Suppression of SIV Replication in Macrophages J. Immunol., December 1, 2007; 179(11): 7262 - 7269. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Guerzoni, M. Bardini, S. A. Mariani, G. Ferrari-Amorotti, P. Neviani, M. L. Panno, Y. Zhang, R. Martinez, D. Perrotti, and B. Calabretta Inducible activation of CEBPB, a gene negatively regulated by BCR/ABL, inhibits proliferation and promotes differentiation of BCR/ABL-expressing cells Blood, May 15, 2006; 107(10): 4080 - 4089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Berberich-Siebelt, I. Berberich, M. Andrulis, B. Santner-Nanan, M. K. Jha, S. Klein-Hessling, A. Schimpl, and E. Serfling SUMOylation Interferes with CCAAT/Enhancer-Binding Protein beta-Mediated c-myc Repression, but Not IL-4 Activation in T Cells. J. Immunol., April 15, 2006; 176(8): 4843 - 4851. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Grimm, A. Contreras, M.-H. Barcellos-Hoff, and J. M. Rosen Cell Cycle Defects Contribute to a Block in Hormone-induced Mammary Gland Proliferation in CCAAT/Enhancer-binding Protein (C/EBP{beta})-null Mice J. Biol. Chem., October 28, 2005; 280(43): 36301 - 36309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gery, A. F. Gombart, W. S. Yi, C. Koeffler, W.-K. Hofmann, and H. P. Koeffler Transcription profiling of C/EBP targets identifies Per2 as a gene implicated in myeloid leukemia Blood, October 15, 2005; 106(8): 2827 - 2836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Jundt, N. Raetzel, C. Muller, C. F. Calkhoven, K. Kley, S. Mathas, A. Lietz, A. Leutz, and B. Dorken A rapamycin derivative (everolimus) controls proliferation through down-regulation of truncated CCAAT enhancer binding protein {beta} and NF-{kappa}B activity in Hodgkin and anaplastic large cell lymphomas Blood, September 1, 2005; 106(5): 1801 - 1807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Timchenko, G.-L. Wang, and L. T. Timchenko RNA CUG-binding Protein 1 Increases Translation of 20-kDa Isoform of CCAAT/Enhancer-binding Protein {beta} by Interacting with the {alpha} and {beta} Subunits of Eukaryotic Initiation Translation Factor 2 J. Biol. Chem., May 27, 2005; 280(21): 20549 - 20557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Tilli, R. Reiter, A. S. Oh, R. T. Henke, K. McDonnell, G. I. Gallicano, P. A. Furth, and A. T. Riegel Overexpression of an N-Terminally Truncated Isoform of the Nuclear Receptor Coactivator Amplified in Breast Cancer 1 Leads to Altered Proliferation of Mammary Epithelial Cells in Transgenic Mice Mol. Endocrinol., March 1, 2005; 19(3): 644 - 656. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Zhang, H. Zhang, L. Lee, and M. M. Ip The Liver-Enriched Inhibitory Protein Isoform of CCAAT/Enhancer-Binding Protein {beta}, But Not Nuclear Factor-{kappa}B, Mediates the Transcriptional Inhibition of {beta}-Casein by Tumor Necrosis Factor-{alpha} Endocrinology, June 1, 2004; 145(6): 2833 - 2844. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. R. Baldwin, N. A. Timchenko, and C. A. Zahnow Epidermal Growth Factor Receptor Stimulation Activates the RNA Binding Protein CUG-BP1 and Increases Expression of C/EBP{beta}-LIP in Mammary Epithelial Cells Mol. Cell. Biol., May 1, 2004; 24(9): 3682 - 3691. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gagliardi, S. Maynard, T. Miyake, N. Rodrigues, S. L. Tjew, E. Cabannes, and P.-A. Bedard Opposing Roles of C/EBP{beta} and AP-1 in the Control of Fibroblast Proliferation and Growth Arrest-specific Gene Expression J. Biol. Chem., October 31, 2003; 278(44): 43846 - 43854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. L. Kagan, R. T. Henke, R. Cabal-Manzano, G. E. Stoica, Q. Nguyen, A. Wellstein, and A. T. Riegel Complex Regulation of the Fibroblast Growth Factor-binding Protein in MDA- MB-468 Breast Cancer Cells by CCAAT/Enhancer-binding Protein {beta} Cancer Res., April 1, 2003; 63(7): 1696 - 1705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. Tepera, P. D. McCrea, and J. M. Rosen A {beta}-catenin survival signal is required for normal lobular development in the mammary gland J. Cell Sci., March 15, 2003; 116(6): 1137 - 1149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Okazaki, J. Li, H. Yu, N. Fukui, and L. J. Sandell CCAAT/Enhancer-binding Proteins beta and delta Mediate the Repression of Gene Transcription of Cartilage-derived Retinoic Acid-sensitive Protein Induced by Interleukin-1beta J. Biol. Chem., August 23, 2002; 277(35): 31526 - 31533. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
