Cancer Research CTRC-AACR San Antonio Breast Cancer Symposium Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zahnow, C. A.
Right arrow Articles by Rosen, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zahnow, C. A.
Right arrow Articles by Rosen, J. M.
[Cancer Research 61, 261-269, January 1, 2001]
© 2001 American Association for Cancer Research

Immunology

A Role for CCAAT/Enhancer Binding Protein ß-Liver-enriched Inhibitory Protein in Mammary Epithelial Cell Proliferation1

Cynthia A. Zahnow2, Robert D. Cardiff, Rodolfo Laucirica, Daniel Medina and Jeffrey M. Rosen

Departments of Cell Biology [C. A. Z., D. M., J. M. R.] and Pathology [R. L.] and The Methodist Hospital [R. L.], Baylor College of Medicine, Houston, Texas 77030, and Center for Comparative Medicine, University of California at Davis, Davis, California 95616 [R. D. C.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The transcription factor, CCAAT/enhancer binding protein ß (C/EBPß), regulates the expression of genes involved in proliferation and terminal differentiation. Dimerization of the dominant-negative C/EBPß-liver-enriched inhibitory protein (LIP) isoform with the C/EBPß-liver-enriched activating protein (LAP) isoform inhibits the transcriptional activation of genes involved in differentiation. Consequently, an increase in LIP levels may inhibit terminal differentiation and lead to proliferation. C/EBPß-LIP and LAP are crucial for mammary gland development (G. W. Robinson et al., Genes Dev., 12: 1907–1916, 1998; T. N. Seagroves et al., Genes Dev., 12: 1917–1928, 1998) and are also overexpressed in breast cancer (B. Raught et al., Cancer Res., 56: 4382–4386. 1996; C. A. Zahnow et al., J. Natl. Cancer Inst., 89: 1887–1891, 1997); however, little is known about how these isoforms differentially regulate cell cycle progression. To address this question, C/EBPß-LIP was overexpressed in both the mammary glands of transgenic mice and in cultured TM3 mammary epithelial cells. Here we report that the involuted mammary glands from transgenic mice overexpressing C/EBPß-LIP contain both focal and diffuse alveolar hyperplasia and, less frequently, contain mammary intraepithelial neoplasias (high grade) and invasive and noninvasive carcinomas. Likewise, cultured TM3 cells, stably expressing C/EBPß-LIP, showed an increase in proliferation and foci formation attributable to a reentry into S-phase during cellular confluence. These results demonstrate that C/EBPß-LIP can induce epithelial proliferation and the formation of mammary hyperplasias and suggest that a C/EBPß-LIP-initiated growth cascade may be susceptible to additional oncogenic hits, which could result in the initiation and progression of neoplasia.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although a majority of breast cancer research has focused on studies of advanced tumors and metastases, the molecular mechanisms responsible for the regulation of normal mammary gland development and the initiation of premalignant disease are still not well understood. Breast cancer originates primarily in the normal mammary epithelium of the terminal ducts and has been hypothesized to involve the clonal expansion of an initiated cell into an epithelial hyperplasia prior to local invasion of the mammary stroma. The molecular changes that occur during this progression include the amplification and/or overexpression of transcription factors, growth factors, and growth factor receptors or the silencing of tumor suppressor genes, which can then act to disrupt the delicate balance between cellular proliferation, terminal differentiation, and programmed cell death. C/EBP3 ß is one such transcription factor, which has been implicated in cell cycle regulation and plays an important role in mammary gland proliferation and differentiation.

C/EBPß is a member of the C/EBP family of transcription factors that bind to specific DNA sequences as homo- and heterodimers and affect the transcription of target genes involved in proliferation and differentiation. Six C/EBP genes have thus far been identified (C/EBP{alpha}, C/EBPß, C/EBP{gamma}, C/EBP{delta}, C/EBP{epsilon}, and C/EBP{zeta}), and all of the genes are intronless except for C/EBP{epsilon} and C/EBP{zeta}. Transcription of C/EBPß results in a single mRNA that can be translated into four isoforms: LAP (full-length LAP-Mr 38,000 and LAP-Mr 35,000); LIP (LIP-Mr 20,000); and a smaller Mr 16,000 isoform. The predominant isoforms expressed in the mouse mammary gland are the Mr 35,000 and Mr 20,000 family members. Several different mechanisms have been described to account for the differential expression of the C/EBPß isoforms: (a) a leaky ribosome scanning mechanism (1) ; (b) the interaction of a CUG repeat binding protein (CUGBP1) with the 5' region of C/EBPß mRNA (2) ; (c) a mechanism involving the evolutionary conserved upstream open reading frame of the 5' region of C/EBPß mRNA and the eukaryotic translation initiation factors eIF-2{alpha} and eIF-4E (3) ; and (d) specific proteolytic cleavage in hematopoietic progenitor cells present in mouse liver (4) . All C/EBPß family members share a strong homology in the COOH-terminal, leucine-rich dimerization domain (bZIP) and the DNA-binding basic region. The truncated C/EBPß-LIP isoform, translated from the third AUG, lacks most of the trans-activation domain and can, therefore, dimerize and bind to DNA but is unable to activate gene transcription. Because of an increased DNA affinity of the C/EBPß-LIP isoform, this inhibition of transcriptional activity can occur even at substoichiometric ratios of LIP:C/EBP, thereby suggesting a dominant-negative function for C/EBPß-LIP (1) . Thus, the LAP:LIP ratio, rather than their absolute amounts, may be an important indicator of transcriptional activity by C/EBPß. Dimerization of bZIP proteins can occur in the absence of DNA but is a prerequisite for DNA binding (5) . Additionally, dimers of bZIP proteins are usually unstable when not bound to DNA and will rapidly dissociate back to monomers (6) .

C/EBPß is vital for development of the mouse mammary gland (7 , 8) . As demonstrated in the C/EBPß knockout mouse, mammary glands contain enlarged, undeveloped ducts that have a low proliferative rate and decreased tertiary branching. C/EBPß-LAP expression is detectable throughout murine mammary gland development and is in contrast to C/EBPß-LIP expression levels, which are highest during pregnancy (proliferative state) and reduced in the virgin (mice <4 months of age) gland and lactating gland (8 , 9) . The C/EBP{alpha} and C/EBP{delta} genes are also expressed in the murine mammary gland. Although C/EBP{alpha} mRNA is expressed throughout mammary development, C/EBP{alpha} is not essential for mouse mammary gland development (8) . Additionally, knockout mice have been generated for C/EBP{delta} (10) , but a mammary gland phenotype has not been reported. Nevertheless, the C/EBP{delta} transcript is overexpressed during involution of the mouse mammary gland (11 , 12) , and cell culture studies have determined that its predominant role in mammary gland development is in growth arrest of mammary epithelial cells (13 , 14) .

Consequently, the differential expression pattern of the C/EBPß isoforms suggests a dual and opposing role in mammary gland development and the importance of the LAP:LIP ratio as a cell cycle switch, resulting either in cellular differentiation or proliferation. Although C/EPBß-LIP is also overexpressed in breast cancer and is associated with biological predictors of poor survival, such as loss of estrogen and progesterone receptor expression, increased cellular proliferation, aneuploidy, and poor histological and nuclear grades (15) , its role in tumorigenesis is unknown. Taken together, these observations have led to the hypothesis that overexpression of the C/EBPß-LIP isoform in the mammary gland can result in epithelial cell proliferation that may render the mammary gland more susceptible to additional oncogenic hits, resulting in the initiation and progression of neoplasia. Persistent, aberrant expression of the C/EBPß-LIP isoform in these neoplasms may contribute to an increased growth rate and result in a more proliferative or aggressive tumor. To test this hypothesis, complementary approaches have been used to study the overexpression of C/EBPß-LIP in both transgenic mice and mammary epithelial cell lines. Our studies have demonstrated that C/EBPß-LIP overexpression is associated with increased epithelial proliferation, resulting in mammary hyperplasias and the stochastic development of infrequent carcinomas.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Transfection and Maintenance of TM3 Cells.
TM3 cells were grown and maintained using HEPES buffered DMEM/F-12 growth medium containing 2% fetal bovine serum, 10 µg/ml insulin, L-glutamine, 5 ng/ml epidermal growth factor, and 5 µg/ml gentamicin sulfate (16) . At 20–40% confluence, cells were stably transfected with pCIneo-LIP or pCIneo (as control) using Superfect (Qiagen). Stably transfected cells were cloned using cloning cylinders (PGC Scientifics) and maintained with 0.2 mg of G418 per ml growth media.

MTS Cell Proliferation Assay.
Five independent LIP clones and five independent neomycin control clones were plated in quadruplicate into a 96-well tissue culture format at a density of 2 x 105 cells/well. The number of viable or proliferative cells was determined for days 1, 3, 5, 7, 9, and 12 of culture using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay from Promega, according to the manufacturer’s instructions. After application of the MTS reagent, the cells were incubated for 2–3 h at 37°C, and absorbance at 490 nm was measured using a Dynex Technologies ELISA plate reader. Data were plotted as fold change in growth rate.

BrdUrd Staining for FACS Analysis.
Two independent LIP clones and two independent neomycin control clones were plated into 100-mm tissue culture dishes at a density of 1 x 106 cells/plate. At days 3, 7, 10, and 15 of culture, the cells were pulse labeled for 15 min with 10 µM BrdUrd (Amersham Life Science), washed with Hanks’ medium, and removed from the plate using the enzyme Dispase II (Boehringer Mannheim). The pellet was resuspended in 200 µl of Hanks’ medium, and the cells were fixed by the addition of 70% ethanol while vortexing to avoid cell clumping. Cells were stored at 4°C in 70% ethanol until collection of the last time point. Approximately 4 x 106 cells were removed from the initial pellet and incubated for 10 min with 3 ml of pepsin (0.04% in 0.10 N HCl) on a rocker at room temperature. After centrifugation (1200 rpm for 5 min), the pepsin supernatant was aspirated, 3 ml of 2 N HCl were added to a vortexed pellet, and the mixture was incubated for 20 min at 37°C. After incubation, 6 ml of 0.1 M sodium borate were added while vortexing, and the cells were pelleted. After aspiration of the supernatant, 6 ml of PBST-B (PBS with 0.5% Tween 20, 0.5% BSA) were added while vortexing, the cells were pelleted, the supernatant was aspirated, and 1 ml of PBS containing 1 unit of DNase-free RNase was added and incubated for 30 min at 37°C. The nuclei were again pelleted, the supernatant was removed, and 20 µl of anti-BrdUrd FITC and 100 µl of PBST were added. The nuclei were incubated for 1 h in the dark at room temperature, and 3 ml of PBST-B were added while vortexing, the nuclei were pelleted, the supernatant was aspirated, and propidium iodide (Sigma) was added for a final concentration of 5 or 10 µg/ml in PBST-B. Nuclei were stored at 4°C overnight and examined 1 day later by FACS analysis.

Active Caspase-3 Determination.
Active-caspase-3 levels were determined both by a fluorogenic assay and FACS analysis. TM3 cells stably expressing either PCI-neo-LIP or PCI-neo as control were plated at an equal density of 1.5 x 106 /100-mm plate and cultured for 3, 7, 10, and 15 days. At each time point, cells were harvested and processed by two methods: scraping and freezing of the cell pellet for the fluorogenic assay; or digestion with Dispase (Boehringer Mannheim), followed by fixation with 4% paraformaldehyde for FACS analysis in the Flow Cytometry Core Lab (Baylor College of Medicine, Houston, TX). Active caspase-3 was determined using either Ac-DEVD-AMC Caspase-3 (CPP32) fluorogenic substrate or phycoerythrin-conjugated polyclonal rabbit anti-active caspase-3 according to the manufacturer’s instructions (PharMingen).

Plasmid Construction: WAP-LIP-WAP.
The first step in the generation of this construct was the EcoRI linearization and Klenow fill-in of a pBluescript SKII(+) plasmid containing 843 bp of rat WAP 3' sequence, with a portion of the third exon, the third intron, all of the fourth exon, and 70 bp of 3' flanking DNA. The second step included the removal of ~865 bp of an NcoI/XhoI cDNA fragment (LIP) from the COOH-terminal region of rat C/EBPß (MSV/C/EBPß, kindly provided by Dr. S. McKnight, University of Texas Southwestern, Dallas, TX). This cDNA insert contains only the third translation initiation Met codon and encodes a full-length protein for LIP and not the LAP isoforms. After fill-in with Klenow, the LIP cDNA fragment was ligated to a position immediately 5' to the 3' WAP sequence in pSCPT SKII(+). In the third step, the LIP-WAP 3' construct was excised using both KpnI and SpeI, filled-in with Klenow, and XbaI linkers were attached. This LIP-WAP3' fragment was then ligated to an XbaI-linearized WAP 5' fragment, which consists of 982 bp of a rat WAP 5' promoter fragment (-949 to +1) and WAP 5' untranslated region (from +1 to +33). The integrity of the WAP-LIP-WAP construct was confirmed by sequencing the WAP-LIP boundaries. The WAP-LIP-WAP construct was removed from pSCPT SKII(+) by digestion with BstXI and KpnI producing a vector (2.9 kb) and insert fragment (2.75 kb) that were similar in size. Further digestion using PvuI, which cuts only the vector, allowed complete size fractionation and separation using agarose gel electrophoresis. The DNA was further purified and concentrated on a silica matrix (Glassmilk; Geneclean). Transgenic mice (FVB inbred) were generated by the transgenic core facility at Baylor College of Medicine.

Plasmid Construction: PCI-neo-LIP.
To construct PCI-neo-LIP, an 865-bp cDNA, which codes only LIP, was excised from the WAP-LIP-WAP construct using XbaI and EcoRV and directionally cloned into the PCI-neo plasmid (Promega) at the XbaI and SmaI restriction sites using T4 DNA ligase.

Analysis of Tail DNA.
Hot-start PCR reactions (25 µl) were performed using a bottom and top mix initially separated by a wax barrier. The bottom mix, containing 1 µg of genomic tail DNA, 1 mM MgCl, 0.2 mM deoxynucleotide triphosphates, 10% DMSO, and 10x Promega thermocycle buffer in a final volume of 14.5 µl, was heated to 90°C for 10 min to denature the DNA and melt the wax pellet and then cooled to 4°C. The top mix, containing 12.5 pmol of each primer, 10x Promega thermocycle buffer, and 2.5 units of Taq polymerase (Promega) in a final volume of 10.5 µl, was added to the top of the hardened wax barrier and allowed to mix with the bottom reagents by heating to 94°C. The reaction profile consisted of 30 cycles of 1 min at 94°C, 2 min at 60°C, and 3 min at 72°C. After the final cycle, the samples were incubated at 72°C for an additional 5 min. Reactions were performed in a DNA thermocycler (Perkin-Elmer). The PCR products were resolved on a 1.5% agarose gel. The sequences of the synthetic oligonucleotides used in the PCR reactions were as follows (5' to 3'): rWAP+1 (F), ATCAGTCATCACTTGCCTGCCGCCG; and LIP 1574 (R), GTGTGTTGCGTCAGTCCCGTGTCCA.

Protein Extraction and Western Blot Analysis.
Tissue and/or cells were disrupted in RIPA buffer [50 mM Tris-Cl (pH 7.4), 1% NP40, 0.25% desoxycholate, 150 mM NaCl, 1 mM EGTA, and 0.2% SDS] containing the following kinase, phosphatase, and protease inhibitors: 1 mM NaVO3, 1 mM NaF, 1 mM Na2MoO4, 10 nM okadaic acid, and 1 µg/ml each of benzamidine, aprotinin, soybean trypsin inhibitor, and antipain. Aliquots of these lysates containing 100 µg of protein were electrophoresed on denaturing SDS 12%-polyacrylamide minigels and then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA) overnight at 75 mA. Blots were blocked 90 min in TBST [20 mM Tris (pH 7.5), 150 mM NaCl, and 0.5% Tween 20] containing 3% nonfat dry milk (Carnation, Glendale, CA) and then incubated for 90 min in this solution containing antibodies (0.5 ng/ml; Santa Cruz) prepared against C/EBPß. Blots were washed with TBST (without milk) three times for 5–10 min each, with agitation. Blots were then incubated for 60 min in blocking solution containing 200 ng/ml biotinylated donkey antirabbit immunoglobulin (Amersham, Little Chalfont, England) and washed. Lastly, blots were incubated for 30 min in blocking solution containing 40 ng/ml streptavidin-horseradish peroxidase (Oncogene Science, Uniondale, NY) and washed as before. Enhanced chemiluminescence (Hyperfilm; Amersham) and chemifluorescence reagents (Storm Fluoroimager; Molecular Dynamics) were used for visualization per the manufacturer’s instructions.

Tissue.
Approximately 43 glands from lactating mice (day 10 of lactation) were examined. Lactating mothers were separated from pups 2 h prior to excision of the mammary glands to reduce the variability associated with suckling and milk stasis. Inguinal glands were fixed in 10% neutral buffered formalin for ~6 h, embedded in paraffin, sectioned at 5 µm, deparaffinized through a graded series of xylenes and alcohols, rehydrated in water, and stained with H&E. Involuted, inguinal, and thoracic mammary glands were removed and examined from 22 transgenic LIP mice and 14 control mice (nontransgenic siblings and wild-type FVBs), 6–32 months of age. All mice were multiparous, and most had undergone involution >3 months before biopsy; however, a few mice were permitted to involute for a shorter interval of 14 days prior to biopsy. Tissues were processed in a manner identical to that for lactating tissue. Whole-mount analysis was performed as described by Seagroves et al. (8) .


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Overexpression of C/EBPß-LIP in Transgenic Mice.
Sequences in the rat WAP promoter and 3' untranslated region were used to create a transgenic construct, WAP-LIP-WAP (Fig. 1A)Citation , which preferentially targets high levels of C/EBPß-LIP expression to the mammary gland in mice, starting at about days 7–10 of pregnancy and extending throughout lactation (17) . Seven WAP-LIP-WAP founder mice were generated. One female founder did not produce live offspring, and the other three female founders were mosaic and did not express the LIP transgene in their mammary glands. The six remaining founders were bred further, and transgene expression was detected in lactating glands of the F1 generation from three of the six founder lines (6067, 6074, and 6070) by Western blot analysis (Fig. 1B)Citation and by reverse transcription-PCR (data not shown). Unfortunately, because of limitations of the currently available C/EBPß antibodies, transgenic LIP expression could not be detected via immunocytochemistry for two reasons: (a) the antibody recognizes the COOH terminus and cannot distinguish between the C/EBPß-LIP and LAP isoforms; and (b) the antibody cannot discriminate between endogenous mouse C/EBPß-LIP and transgenic rat C/EBPß-LIP because the proteins are >98% similar in amino acid identity. The level of transgene expression was relatively constant in subsequent generations, as evidenced by the similar levels of transgene expression observed in the F1 as well as in the F5 generation (data not shown). Although the construct is not epitope-tagged, the transgenic C/EBPß-LIP protein is developmentally distinguishable from endogenous C/EBPß-LIP during lactation, because the native LIP isoform is not expressed during lactation and is primarily expressed during pregnancy (Fig. 1Citation B, FVB lane). Consequently, it was hypothesized that any phenotypic effects resulting from the overexpression of C/EBPß-LIP would, therefore, be most readily detected during lactation and subsequent involution.



View larger version (29K):
[in this window]
[in a new window]
  		Fig. 1. Structure of the WAP transgenic construct and detection of expression by Western blot analysis. A, the transgene was constructed using 949 bp of rat WAP 5' noncoding sequence and the first 33 bp of the open reading frame, followed by 865 bp of a C/EBPß rat cDNA fragment that codes only for the C/EBPß-LIP isoform. An additional 843 bp of rat WAP sequence containing part of exon III, intron C, and exon IV plus 70 bp of 3' flanking DNA was positioned immediately 3' to the cDNA (see "Materials and Methods" for further details). B, representative Western blot of mammary gland extracts prepared from (10-day) lactating, F1 generation, female mice from the following transgenic founder lines: 6067, 6074, 6070, 6060, and 6065. The transgenic (LIP) construct was detected in three lines (6067, 6074, and 6070), and the endogenous (LAP) isoform was detectable in all mice. A nontransgenic (FVB) mouse was included in the Western blot to demonstrate that endogenous C/EBPß-LIP protein levels are not detectable during lactation. Cross-reactive material (CRM), which is observed in mammary gland extracts from C/EBPß knockout mice (8) , serves as an internal loading standard.

 
The mammary glands from ~22 C/EBPß-LIP transgenic mice and 21 control mice (nontransgenic siblings and wild-type FVBs) corresponding to days 1–18 of lactation were examined at both the gross and microscopic levels. C/EBPß-LIP transgenic mice did not experience any difficulties in nursing their pups, and no histological abnormalities were observed in the mammary glands of lactating mice. Next, involuted glands from 22 transgenic and 14 control mice (nontransgenic siblings and wild-type FVBs), 6–32 months of age, were examined for abnormalities. Mammary gland neoplasia was observed in 9% (2 of 22) of transgenic mice and included two invasive carcinomas (Fig. 2A)Citation and three MINs (high grade; Fig. 2BCitation ) from one 27-month-old mouse. MINs comprise a variety of intraluminal epithelial proliferations with atypical cytology, including in situ carcinomas (18) . Additionally, the gland from a 20-month-old mouse contained a highly proliferative, poorly differentiated carcinoma (Fig. 2D)Citation , and the gland contralateral to the tumor contained diffuse alveolar hyperplasia (Fig. 2C)Citation . A more thorough, blind examination (by two independent researchers, R. D. C. and D. M.) of a subset of the 22 involuted glands revealed that 30–40% (3 of 10 or 4 of 10) of transgenic mice contained two distinct forms of mammary hyperplasias known as focal hyperplastic alveoli or HAN (Fig. 3, A and B)Citation and diffuse alveolar hyperplasia (Fig. 3, C and D)Citation . The epithelial cells in these hyperplasias are characterized by their large shape and active nuclei with open chromatin, large nucleoli, and a high rate of mitosis, as evidenced by an abundance of mitotic figures. In contrast to normal epithelial cells that have undergone a delayed involution, hyperplastic cells contain very little lipid and are not actively secreting. The described neoplasias and hyperplasias were observed in both the 6067 and 6074 lines, and no tumors or hyperplasias were observed in age-matched, nontransgenic siblings or wild-type FVB mice.



View larger version (181K):
[in this window]
[in a new window]
  		Fig. 2. The mammary glands from transgenic C/EBPß-LIP mice develop invasive carcinoma and high-grade MIN. A, representative photomicrograph (x20) of one of two invasive carcinomas from mouse (7869, case 1). These H&E-stained lesions contained extensive fibrosis, infiltrated by small cords of atypical epithelial cells (see arrow) with large pleomorphic nuclei and scattered mitoses. B, the same gland from mouse (7869, case 1) also contained three high-grade MINs. The lesion represented in B (x20) consists of several expanded alveoli (large arrow) filled with hyperchromatic, atypical nuclei with prominent nucleoli and abnormal mitotic figures. The oval profiles typically form a cribriform-like pattern (small arrows), as is often observed in ductal carcinoma in situ, and a dense lymphocytic infiltrate (*) is present in the upper portions of the micrograph. (C and D, x20). Mouse (case 35) developed a mammary carcinoma with some foci of squamous metaplasia. C, the gland contralateral to the tumor and depicts a profile of incomplete involution or diffuse hyperplasia. The contours of the residual alveoli are described as rounded (arrows), as opposed to the angulated acini present in a normally regressed gland (see Fig. 3Citation , C and D). Duct ectasia was also commonly observed in involuted glands. The large carcinoma (D) is composed of nests (short arrow) and cords (long arrow) of very hyperchromatic cells in a dense connective tissue stroma. The sizes of the cords vary. The tumor cells have large, pleomorphic nuclei with prominent and multiple nucleoli but with delicate chromatin. The cytoplasm is amphophilic, and the mitotic rate is very high.

 


View larger version (161K):
[in this window]
[in a new window]
  		Fig. 3. Involution in the mammary glands of transgenic CEBPß-LIP mice is incomplete and characterized by diffuse and focal hyperplasia. A, whole-mount analysis of the involuted mammary gland from mouse 8/98#2, case 15, showing both focal and diffuse hyperplasia. The focal hyperplasia or HAN is evident as a grape-like cluster on the right side of the photo (arrow). H&E analysis of the HAN (arrow) is presented in B (x20). The diffuse hyperplasia resembles a delayed or incomplete regression. The residual alveoli are characterized by an abnormally round appearance as opposed to the more normal, collapsed, and angulated acini observed after a normal regression. C (x20) shows a normal pattern of mammary gland regression (mouse 2160, case 16) with collapsed and angulated acini, often containing lipid droplets (arrow; inset, x40). D (x20), a diffuse alveolar hyperplasia (mouse 6074 invT, case 19). The rounded alveoli do not contain lipid (arrow; inset, x40) and are either filled with cells or contain multilayers of epithelial cells possessing large, active nuclei with an open chromatin and large nucleolus (not visible in this magnification).

 
Overexpression of C/EBPß-LIP in Cultured Mammary Epithelial Cells.
To investigate the molecular mechanisms responsible for the proliferation and hyperplasias associated with C/EBPß-LIP overexpression, cell cycle studies were initiated in cultured mammary epithelial cells. Two considerations helped to determine which mammary epithelial cell line was used for testing the effects of overexpression of C/EBPß-LIP on cell growth and tumorigenicity: (a) that the endogenous levels of C/EBPß-LIP were low; and (b) that the cell line should exhibit normal, nontumorigenic growth patterns. The TM cell lines were established from hyperplastic alveolar outgrowths, which resulted from the in vivo transplantation of FSK cell lines (16) . These lines are maintained both in culture (in vitro) and as mammary transplants, which grow (in vivo) either as hyperplastic outgrowths or tumors. TM3 (HOG) is a slow-growing, hyperplastic alveolar outgrowth that is ovarian hormone dependent and infrequently progresses into tumors when maintained beyond transplant generation 16 (19) . In contrast, (low passage, <10) TM3 in vitro cultures do not produce successful outgrowths after transplantation into cleared mammary fat pads, have low endogenous C/EBPß levels as compared with a more neoplastic TM line (TM6; Ref. 20 ), exhibit a marked dependence on epidermal growth factor for growth (21) , and contain a mutant p53 (Ser233 ins; Refs. 22 and 23 ), which has been associated with a higher rate (4–7%) of apoptosis (19) . Consequently, both the TM3 outgrowths and the TM3 cell line fit the necessary criteria for containing relatively low levels of endogenous C/EBPß and exhibiting normal or weakly tumorigenic growth patterns.

The TM3 cell line was stably transfected with either CMV-driven PCIneo-LIP or PCIneo (the vector without LIP cDNA insert, as control), and stable cellular clones were generated. In the parental, nontransfected cells, endogenous C/EBPß protein levels were observed to change with growth. The expression of the native LIP isoform was consistently observed to be higher when the cells were exponentially growing than when the cells were contact inhibited or confluent (Fig. 4Citation , left panel). Consequently, CMV-driven expression of C/EBPß-LIP from the PCIneo-LIP construct was easily detected during confluence (Fig. 4Citation , middle panel). Passage number had little effect on loss or gain of endogenous C/EBPß expression, as shown by comparison of the first panel containing the earlier passage parental TM3 line and the last panel (Fig. 4)Citation , which represents a late-passage TM3 clonal line expressing only neomycin. Endogenous C/EBPß-LAP levels were more variable during confluence, but endogenous C/EBPß-LIP levels were usually low and were never observed to exceed the expression levels for C/EBPß-LAP during confluence in TM3 cells.



View larger version (43K):
[in this window]
[in a new window]
  		Fig. 4. C/EBPß-LIP and LAP levels are elevated in exponentially growing TM3 cells but are decreased as the cells become contact inhibited during confluence. Western blot analysis of whole-cell protein extracts from TM3 cells, which were either exponentially growing (exp) or confluent and contact inhibited (conf), is shown. The parental TM3 cells represent the early-passage cells from which the LIP and Neo clones were derived. LIP and Neo clones refer to clonal TM3 lines that stably express either C/EBPß-LIP or neomycin (Neo) as the control.

 
TM3 clones stably expressing CMV-driven LIP and vector-only, neomycin controls were randomly chosen and tested for proliferative potential using an MTS cell proliferation kit. The clones displayed different growth rates, but the five clonal lines expressing LIP were, on average, twice as proliferative as the five control (Neo) clonal lines (Fig. 5)Citation . The fold change in growth was determined by dividing the number of proliferating, viable cells (as measured by the amount of absorbance at 490 nm) at days 12, 9, 7, 5, and 3 by the value for proliferation at day 1 for each clone. To determine whether this increase in cell number or growth was attributable to an increase in the number of cells entering S phase, cells were pulse labeled with BrdUrd at 3, 7, 10, and 15 days of culture and analyzed by flow cytometric (FACS) analysis (Fig. 6B)Citation . The data indicate that expression of LIP in TM3 cells facilitates entry into S-phase and DNA synthesis. Both the LIP-expressing cells and the control cells exhibited similar levels of BrdUrd incorporation during exponential growth (day 3) and early confluence (day 7); however, the LIP-expressing cells did not remain contact inhibited, and by day 15 of culture, at least 10% of the cells had re-entered the cell cycle, were proliferating, and formed foci as compared with the neomycin control cells, which remained a monolayer (Fig. 6, A and B)Citation . Interestingly, CMV-driven LIP expression does not coincide, temporally, with the renewed growth and reentry of the LIP clones into the cell cycle (Fig. 6C)Citation . Nuclear LIP expression, as well as the LIP:LAP ratio, was higher in the LIP-expressing clones during the first week of culture than during the second week (Fig. 6C)Citation . It is highly unlikely that the proliferation observed in these cells can be attributed to clonal variation, because foci formation was observed in at least four clonal lines stably expressing C/EBPß-LIP and was never observed in the control cells. In addition, the increase in cellular proliferation was not accompanied by a decrease in apoptosis. The TM3 clones were assayed for changes in caspase-3 activity using two independent methods (see "Methods and Materials"), and the levels of active caspase-3 were found not to be significantly decreased in the proliferating LIP-expressing cells as compared with the control (Neo) cells (data not shown).



View larger version (20K):
[in this window]
[in a new window]
  		Fig. 5. Overexpression of LIP causes TM3 cell proliferation. TM3 clones stably expressing LIP (n = 5; L1, L3, LL5, L6, and L9) and vector-only controls (n = 5; N2, N3, N5, N6, and N10) were randomly chosen, plated at equal density, and tested for proliferative potential using an MTS cell proliferation kit (Promega). The various clones displayed different growth rates, but the clones overexpressing LIP were, on average, twice as proliferative as the cells without exogenous LIP. The fold change in growth was determined by dividing the number of proliferating viable cells (as measured by the amount of absorbance at 490 nm) at days 12, 9, 7, 5, and 3 by the value for proliferation at day 1 for each clone. Bars, SE.

 


View larger version (60K):
[in this window]
[in a new window]
  		Fig. 6. Overexpression of C/EBPß-LIP in TM3 mammary epithelial cells results in increased growth and foci formation. A, micrographs (x4) of confluent TM3 monolayers grown on plastic at days 10 and 15 of culture. Note the presence of foci in the LIP-expressing clonal line (upper panels) and the absence of foci in the control lines (Neo, neomycin-expressing only; lower panels). The LIP-expressing cells are also smaller and more crowded in appearance than the control cells. B, LIP and Neo clonal lines (n = 2, each) were plated at equal density, and at days 3, 7, 10, and 15 of culture, the cells were pulse labeled for 15 min with 10 µM BrdUrd, harvested, and analyzed by FACS analysis for percentage of BrdUrd incorporation. Although foci formation was also observed in at least four other LIP-expressing clones, the BrdUrd analysis was conducted with only two of these clones, and consequently SEs could not be determined. C, Western blot analysis of cytoplasmic (Lanes C) and nuclear (Lanes N) extracts from LIP expressing TM3 clone (LIP1) and control clone (Neo 10) at 7 and 15 days of culture. TM6 cells serve as a positive control (+) for C/EBPß-LIP and LAP, and cross-reactive material (CRM) is indicated on the blot.

 
Transplantation of LIP-overexpressing TM 3 Cells into the Fat Pads of BALB/c Mice.
To determine whether the TM3 cells maintained their proliferative growth potential in vivo, stably expressing LIP and vector control (Neo) cells (1 x 106 cells) were transplanted into the right and left inguinal mammary fat pads, respectively, of virgin, syngeneic BALB/c mice. An inherent difficulty in cell line/transplantation experiments is that many nontransfected, high-passage mammary epithelial cell lines will spontaneously form tumors after transplantation into a cleared mammary fat pad.4 This may be attributable to the fact that during immortalization, these cells have lost expression of p16, p53, or other cell cycle regulators. Thus, this experiment was not designed to examine the oncogenic capacity of C/EBPß-LIP but rather to test the reproducibility of LIP-overexpressing cells to proliferate in the mammary fat pad in vivo as well as on plastic. Because clonal selection of the TM3 cells resulted in higher passage lines, it was expected that the CMV-driven LIP expression might generate larger more proliferative tumors with a decreased latency. Accordingly, palpable tumors were detectable in the LIP but not the Neo transplants 6 weeks after transplantation. Although not palpable, the Neo cells also formed some histologically identifiable small tumors. Examination of the transplanted fat pads, via H&E staining of paraffin-embedded sections, revealed that the LIP-expressing transplants either grew out into large, undifferentiated tumors that completely filled the fat pad (four of seven) or did not grow out at all (three of seven). In contrast, the vector control (Neo) transplants grew as small palpable tumors (three of seven) or undifferentiated cell masses that did not fill the fat pad but with additional time could generate palpable tumors (four of seven). Analysis of the transplants demonstrated that the LIP tumors were approximately four times larger, as determined by tumor volume (mm3 ) and wet weight (g, data not shown) than the vector control (Neo) outgrowths and tumors (Fig. 7C)Citation . The larger size is suggestive of a more proliferative tumor. This was confirmed by the detection of 10-fold more mitotic figures in the LIP than in the control tumors or outgrowths (Fig. 7, A and B)Citation . Thus, evidence from both in vitro tissue culture and in vivo transplantation studies demonstrate that overexpression of C/EBPß-LIP in mammary epithelial cells results in increased proliferation.



View larger version (107K):
[in this window]
[in a new window]
  		Fig. 7. Transplantation of TM3 cells stably overexpressing C/EBPß-LIP result in more proliferative tumors in vivo. Approximately 1 x 106 TM3 cells stably expressing C/EBPß-LIP were transplanted into the right, cleared inguinal fat pad of BALB/c mice, and an equal number of non-LIP-expressing control cells (Neo/control) were transplanted into the contralateral gland. Mammary glands were harvested 6 weeks after transplantation, fixed overnight in 10% neutral buffered formalin, and processed via standard methods for paraffin sectioning. A, H&E micrograph (x40) of a C/EBPß-LIP-expressing transplant that grew out as a poorly differentiated tumor. Numerous mitotic figures (boxed) are visible within this one high-powered field. The tumors derived from C/EBPß-LIP-expressing cells were approximately four times larger, as determined by tumor volume or wet weight (C), and contained 10 times more mitotic figures/10 high-powered fields than the outgrowths and smaller tumors derived from the control cells (B). The total number of mitotic figures/10 high-powered fields (HPF) was determined by a pathologist (R. L.) as a blind comparative study. Bars, SE.

 

   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
These results have demonstrated that overexpression of C/EBPß-LIP in the mammary glands of transgenic mice as well as in mammary epithelial cells cultured on plastic results in increased epithelial cell proliferation. These mammary hyperplasias may, therefore, be inherently more susceptible to additional oncogenic "hits" resulting in the stochastic formation of infrequent tumors, as was observed in 9% of the C/EBPß-LIP transgenic mice. Expression of C/EBPß-LIP has been observed in many rodent mammary tumors and some human breast cancers and may increase the number of proliferative cells, potentially resulting in more highly proliferative and aggressive tumors. Consequently, overexpression of C/EBPß-LIP may be an important indicator for breast epithelium at risk for hyperplasia and cancer.

The incidence of hyperplastic and neoplastic lesions in our WAP-LIP-WAP mice are in agreement with several other published reports of genetically engineered mice bearing WAP-driven transgenes. For example, in WAP-stromelysin transgenic mice, 6–24 months of age, 20% of mice contained atypical proliferative lesions and 7.4% developed mammary carcinomas (24) . Transgenes driven by the WAP promoter are preferentially expressed in alveolar epithelial cells and, to a lesser extent, in ductal epithelial cells in the mammary gland (17 , 25 , 26) . The rat WAP promoter used in our transgenic study is minimally active during each estrous cycle in virgin as well as in multiparous females but is maximally expressed starting at day 10 of pregnancy and extending throughout lactation (17 , 26 , 27) . Consequently, the induction of hyperplasias by WAP-LIP-WAP probably occurs during pregnancy and/or lactation but may be detectable only after involution, following the regression of the surrounding normal alveolar epithelium. Attempts to detect an early, LIP-induced, proliferative response during pregnancy were unsuccessful because it was difficult to distinguish small increases in proliferation from the highly proliferative background during pregnancy (data not shown). WAP-driven C/EBPß expression after involution was not detectable by Western blots and could not be localized by immunohistochemistry as discussed previously. Thus, the hyperplasias observed in the involuted tissue are either no longer dependent on LIP expression or are maintained by the expression of LIP in a small subset of cells, possibly as a result of limited transgene expression that may occur during each estrous cycle. Likewise, in the cell culture studies, CMV-driven LIP expression was higher during exponential growth (day 3) and early confluence (day 7) than during days 10 and 15 of confluence, when LIP-induced proliferation is evident. Although these TM3 cells have been isolated as subclones that stably express C/EBPß-LIP, it is possible that the subset of cells that forms foci and proliferate during late confluence has higher levels of C/EBPß-LIP expression than the adjacent cells, which are less proliferative.

Targeted dominant-negative constructs are especially difficult to overexpress in transgenic mice, because the transgene has the potential to negatively regulate its own promoter. In fact, only one other transgenic study thus far has successfully overexpressed a dominant-negative, C/EBP-related protein (28) . Consequently, WAP regulatory sequences were chosen to target transgene expression to the mammary gland in this study because these sequences did not contain any known, functional C/EBP consensus sites. However, subsequent analysis of milk protein gene expression from the mammary glands of C/EBPß knockout mice has demonstrated that loss of C/EBPß can dramatically reduce the levels of both WAP mRNA and protein (7 , 8) . Similarly, when our WAP-LIP-WAP mice were crossed with C/EBPß-knockout mice, expression of the LIP transgene was reduced or was nondetectable (data not shown). Taken together, these data demonstrate that C/EBPß is indeed important in the regulation of WAP, and that autoregulatory effects of LIP may account for the moderate levels of transgene expression and subtle phenotype observed in these mice. Additionally, variegated or sectored localization of gene expression in transgenic mice can also account for variations in the level of transgene expression (29) . Several different transgenic mouse studies, including our studies with WAP-driven transgenes, have demonstrated that cells expressing the transgene often appear as scattered clusters, leading to a variegated pattern of gene expression (30 , 31) . This may also account, in part, for the focal versus diffuse pattern of hyperplasia observed in the WAP-LIP-WAP mice. Furthermore, the timing of transgene expression may also be an important factor because WAP-driven transgenes are not expressed until puberty. If it were possible to selectively target C/EBPß-LIP expression to the mammary gland either during early ductal development or in virgin transgenic mice, one might expect to observe a very different or more severe phenotype.

It is generally accepted that breast cancer originates in the terminal duct lobular unit (32) . Although the mouse mammary gland does not contain a terminal duct lobular unit, an equivalent structure would be the tertiary branches that give rise to the alveoli. HANs can form in this region, as was observed in the WAP-LIP-WAP transgenic mice. HAN is a low-grade, focal alveolar hyperplasia that persists in the involuted mammary gland and has been experimentally proven via transplantation experiments to be a precancerous, clonal lesion with high malignant potential (33, 34, 35) . Squamous metaplasia, inflammation, or lymphocytic infiltration, also frequently present in the involuted glands of WAP-LIP-WAP mice, has been proposed to be a normal repair response of the mammary gland to the hormonal challenges and damage caused by multiple pregnancies (18) .

Numerous reports in tissues other than the mammary gland support the observation that C/EBPß-LIP plays a proliferative role in cell cycle control. In adipocytes, C/EBPß and C/EBP{delta} have been shown to induce C/EBP{alpha} expression, which arrests the ongoing proliferation and facilitates terminal cell differentiation (36 , 37) . Moreover, overexpression of C/EBPß-LIP results in continued proliferation and is able to inhibit the adipocyte conversion into the differentiated phenotype (38) . Similarly, a recent study has demonstrated that the introduction of C/EBPß-LIP via retroviral gene transfer into 3T3-L1 cells results in proliferation, foci formation, and a loss of contact inhibition (3) . Although C/EBP{alpha} is primarily responsible for regulating terminal differentiation in hepatocytes (39) , cellular proliferation in Hep G2 hepatoma cells is not blocked by C/EBP{alpha} expression but is abrogated by C/EBPß-LAP (40) . In adult hepatocytes, differentiation and proliferation are mutually exclusive (40) , and during rat postnatal development, the levels of LAP in liver nuclei are elevated much more than those of LIP (1) . This is suggestive that the LAP:LIP ratio is important for differential regulation of gene expression and differentiation in the adult liver. In contrast, during hepatocyte proliferation after partial hepatectomy, C/EBP{alpha} levels decline, but both C/EBP{delta} and C/EBPß levels increase. In fact, C/EBP{alpha}:C/EBPß heterodimers are replaced with C/EBPß homodimers during the early G1 period after partial hepatectomy (41 , 42) .

C/EBP family members have been historically described as DNA-binding proteins; however, the C/EBPs are also capable of protein-protein interactions with cell cycle proteins such as Rb and p21. The C/EBPß-LIP and LAP isoforms can directly interact with the SV40T antigen domain of hypophosphorylated Rb (43) . This transient but direct interaction with Rb increases DNA binding and transactivation potential of the C/EBPß isoforms, and depending on the ratio of LIP:LAP, may inhibit the transactivation potential of LAP to transcribe genes involved in cellular differentiation (43) . Additionally, an in vivo analysis in the liver of C/EBP{alpha} knockout mice showed that C/EBP{alpha} and p21 interact via protein-protein interactions to stabilize p21 levels (44) . At the transcriptional level, studies in rat hepatoma cells have demonstrated that C/EBP{alpha} can bind to the canonical C/EBP DNA binding site in the p21 cyclin-dependent kinase inhibitor gene, resulting in the elevation of p21 expression, the inhibition of cyclin-dependent kinase-dependent Rb phosphorylation, and the induction of cell cycle arrest at G1 (45, 46, 47) . Similarly, in human colorectal cancer cell lines, C/EBPß has been shown to increase p21 transcription, but it was not determined whether the C/EBPß isoforms have opposing effects on p21 regulation (48) . However, in primary cultures of keratinocytes, the deletion of the C/EBPß gene did not alter expression of p21 (49) . Consequently, the regulation of p21 by C/EBPß may be a tissue-specific process. Further investigation of p21 regulation by LIP in mammary epithelial cells is clearly warranted. These observations are important, because the canonical C/EBP DNA binding site in the p21 gene promoter should be capable of binding all of the C/EBPs, including C/EBPß. The C/EBPs have identical binding specificities, and the hierarchy of DNA binding affinities for the C/EBP consensus sequence is C/EBPß > C/EBP{alpha} > C/EBP{delta} (50) . If C/EBPß-LIP were to dimerize with C/EBP{alpha} or form homodimers with itself, the transcriptional regulation of p21 might be inhibited, resulting in phosphorylation of Rb and progression through the G1-S transition. This provides a potential mechanism by which C/EBPß-LIP might induce entry into S-phase.

Alternatively, alterations in p21 or other cyclin-dependent kinase inhibitors may result in changes in apoptosis. Although no decreases in apoptosis were observed in the clonally selected TM3 cells, modulation of the LIP:LAP ratio may result in increased apoptosis in mammary epithelial cells5 or a rescue from apoptosis by matrix detachment in intestinal epithelial cells.6 Effects on apoptosis may be tissue specific and dependent on the amount of LIP present in the cells. Failure to obtain TM3 clones that highly express LIP, may be the result of induction of apoptoin in induction of apoptosis in these clones during selection. Thus, LIP expression may potentially regulate cell proliferation and/or apoptosis, depending on the cell type and cell-substratum interactions.

In conclusion, these studies indicate that the overexpression of C/EBPß-LIP in mammary epithelial cells promotes proliferation and the development of hyperplasias. The data also support the hypothesis that LIP overexpression may stimulate a growth cascade, which may be susceptible to additional oncogenic hits and result in the stochastic formation of tumors. The elucidation of the molecular mechanisms by which C/EBPß-LIP regulates cell cycle progression may, therefore, be critical for defining protein targets associated with premalignancy and neoplastic progression.


   ACKNOWLEDGMENTS
 
We thank Liz Hopkins for assistance with histology, Jeff Scott for help with FACS analysis, Jason Gay for assistance with surgical techniques, Shirley Small for mouse husbandry, and Frances Kittrell for helpful discussions about techniques related to mammary epithelial cell lines and mice.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This research was supported by Grant CA 16303 from the National Cancer Institute (to J. M. R.), Grant JB-0014 from the State of California Breast Cancer Research Program (to R. D. C.), and Contract DAMD17-96-1-6086, a postdoctoral fellowship from the Department of Defense (to C. A. Z.). Back

2 To whom requests for reprints should be addressed, at Johns Hopkins Comprehensive Cancer Center, Room 542, 1650 Orleans Street, Baltimore, MD 21231. Back

3 The abbreviations used are: C/EBP, CCAAT/enhancer binding protein; WAP, whey acidic protein; LAP, liver-enriched activating protein; LIP, liver-enriched inhibitory protein; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxy-phenyl)-2-(4-sulfonyl)-2H-tetrazolium; BrdUrd, bromodeoxyuridine; FACS, fluorescence-activated cell sorter; MIN, mammary intra-epithelial neoplasia; HAN, hyperplastic alveolar nodule; CMV, cytomegalovirus; Rb, retinoblastoma; HOG, hyperplastic outgrowth. Back

4 D. Medina, personal communication. Back

5 M. Bissell, personal communication. Back

6 J. Brugge, personal communication. Back

Received 6/23/00. Accepted 10/26/00.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Descombes P., Schibler U. A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell, 67: 569-579, 1991.[Medline]
  2. Timchenko N. A., Welm A. L., Lu X., Timchenko L. T. CUG repeat binding protein (CUGBP1) interacts with the 5' region of C/EBPß mRNA and regulates translation of C/EBPß isoforms. Nucleic Acids Res, 27: 4517-4525, 1999.[Abstract/Free Full Text]
  3. Calkhoven C. F., Muller C., Leutz A. Translational control of C/EBP{alpha} and C/EBPß isoform expression. Genes Dev., 14: 1920-1932, 2000.[Abstract/Free Full Text]
  4. Welm A. L., Timchenko N. A., Darlington G. J. C/EBP{alpha} regulates generation of C/EBPß isoforms through activation of specific proteolytic cleavage. Mol. Cell. Biol., 19: 1695-1704, 1999.[Abstract/Free Full Text]
  5. Turner R., Tjian R. Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers. Science (Washington DC), 243: 1689-1694, 1989.[Abstract/Free Full Text]
  6. Patel L. R., Curran T., Kerppola T. K. Energy transfer analysis of Fos-Jun dimerization and DNA binding. Proc. Natl. Acad. Sci. USA, 91: 7360-7364, 1994.[Abstract/Free Full Text]
  7. Robinson G. W., Johnson P. F., Hennighausen L., Sterneck E. The C/EBPß transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland. Genes Dev., 12: 1907-1916, 1998.[Abstract/Free Full Text]
  8. Seagroves T. N., Krnacik S., Raught B., Gay J., Burgess-Beusse B., Darlington G. J., Rosen J. M. C/EBPß, but not C/EBP{alpha}, is essential for ductal morphogenesis, lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes Dev., 12: 1917-1928, 1998.[Abstract/Free Full Text]
  9. Raught B., Liao W. S. L., Rosen J. M. Developmentally- and hormonally-regulated C/EBP isoforms influence ß-casein gene expression. Mol. Endocrinol., 9: 1223-1232, 1995.[Abstract]
  10. Tanaka T., Yoshida N., Kishimoto T., Akira S. Defective adipocyte differentiation in mice lacking the C/EBPß and/or C/EBP{delta} gene. EMBO J., 16: 7432-7443, 1997.[Medline]
  11. Gigliotti A. P., DeWille J. W. Lactation status influences expression of CCAAT/enhancer binding protein isoform mRNA in the mouse mammary gland. J. Cell. Physiol., 174: 232-239, 1998.[Medline]
  12. Sabatakos G., Davies G. E., Grosse M., Cryer A., Ramji D. P. Expression of the genes encoding CCAAT-enhancer binding protein isoforms in the mouse mammary gland during lactation and involution. Biochem. J., 334: 205-210, 1998.
  13. O’Rourke J., Yuan R., DeWille J. CCAAT/enhancer-binding protein-{delta} (C/EBP-{delta}) is induced in growth- arrested mouse mammary epithelial cells. J. Biol. Chem., 272: 6291-6296, 1997.[Abstract/Free Full Text]
  14. O’Rourke J. P., Newbound G. C., Hutt J. A., DeWille J. CCAAT/enhancer-binding protein {delta} regulates mammary epithelial cell G0 growth arrest and apoptosis. J. Biol. Chem., 274: 16582-16589, 1999.[Abstract/Free Full Text]
  15. Zahnow C. A., Younes P., Laucirica R., Rosen J. M. Overexpression of C/EBPß-LIP, a naturally occurring, dominant- negative transcription factor, in human breast cancer. J. Natl. Cancer Inst., 89: 1887-1891, 1997.[Abstract/Free Full Text]
  16. Kittrell F. S., Oborn C. J., Medina D. Development of mammary preneoplasias in vivo from mouse mammary epithelial cell lines in vitro.. Cancer Res., 52: 1924-1932, 1992.[Abstract/Free Full Text]
  17. Bayna E. M., Rosen J. M. Tissue-specific, high level expression of the rat whey acidic protein gene in transgenic mice. Nucleic Acids Res., 18: 2977-2985, 1990.[Abstract/Free Full Text]
  18. Cardiff R. D., Anver M. R., Gusterson B. A., Hennighausen L., Jensen R. A., Merino M. J., Rehm S., Russo J., Tavassoli F. A., Wakefield L. M., Ward J. M., Green J. E. The mammary pathology of genetically engineered mice: the consensus report and recommendations from the Annapolis meeting. Oncogene, 19: 968-988, 2000.[Medline]
  19. Bonnette S. G., Kittrell F. S., Stephens L. C., Meyn R. E., Medina D. Interactions of apoptosis, proliferation and host age in the regression of the mouse mammary preneoplasia, TM3, carrying an unusual mutation in p53. Carcinogenesis (Lond.), 20: 1715-1720, 1999.[Abstract/Free Full Text]
  20. Raught B., Gingras A-C., James A., Medina D., Sonenberg N., Rosen J. M. Expression of a translationally regulated, dominant-negative CCAAT/enhancer-binding protein ß isoform and up-regulation of the eukaryotic translation initiation factor 2a are correlated with neoplastic transformation of mammary epithelial cells. Cancer Res., 56: 4382-4386, 1996.[Abstract/Free Full Text]
  21. Medina D., Kittrell F. S., Oborn C. J., Schwartz M. Growth factor dependency and gene expression in preneoplastic mouse mammary epithelial cells. Cancer Res., 53: 668-674, 1993.[Abstract/Free Full Text]
  22. Jerry D. J., Ozbun M. A., Kittrell F. S., Lane D. P., Medina D., Butel J. S. Mutations in p53 are frequent in the preneoplastic stage of mouse mammary tumor development. Cancer Res., 53: 3374-3381, 1993.[Abstract/Free Full Text]
  23. Ozbun M. A., Jerry D. J., Kittrell F. S., Medina D., Butel J. S. p53 mutations selected in vivo when mouse mammary epithelial cells form hyperplastic outgrowths are not necessary for establishment of mammary cell lines in vitro. Cancer Res., 53: 1646-1652, 1993.[Abstract/Free Full Text]
  24. Sternlicht M. D., Lochter A., Sympson C. J., Huey B., Rougier J. P., Gray J. W., Pinkel D., Bissell M. J., Werb Z. The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell, 98: 137-146, 1999.[Medline]
  25. Li B., Greenberg N., Stephens L. C., Meyn R., Medina D., Rosen J. M. Preferential overexpression of a 172Arg[arrow]Leu mutant p53 in the mammary gland of transgenic mice results in altered lobuloalveolar development. Cell Growth Differ, 5: 711-721, 1994.[Abstract]
  26. Kordon E. C., McKnight R. A., Jhappan C., Hennighausen L., Merlino G., Smith G. H. Ectopic TGF ß1 expression in the secretory mammary epithelium induces early senescence of the epithelial stem cell population. Dev. Biol., 168: 47-61, 1995.[Medline]
  27. Robinson G. W., McKnight R. A., Smith G. H., Hennighausen L. Mammary epithelial cells undergo secretory differentiation in cycling virgins but require pregnancy for the establishment of terminal differentiation. Development (Camb.), 121: 2079-2090, 1995.[Abstract]
  28. Moitra J., Mason M. M., Olive M., Krylov D., Gavrilova O., Marcus-Samuels B., Feigenbaum L., Lee E., Aoyama T., Eckhaus M., Reitman M. L., Vinson C. Life without white fat: a transgenic mouse. Genes Dev., 12: 3168-3181, 1998.[Abstract/Free Full Text]
  29. Dobie K., Mehtali M., McClenaghan M., Lathe R. Variegated gene expression in mice. Trends Genet, 13: 127-130, 1997.[Medline]
  30. Dobie K. W., Lee M., Fantes J. A., Graham E., Clark A. J., Springbett A., Lathe R., McClenaghan M. Variegated transgene expression in mouse mammary gland is determined by the transgene integration locus. Proc. Natl. Acad. Sci. USA, 93: 6659-6664, 1996.[Abstract/Free Full Text]
  31. Festenstein R., Tolaini M., Corbella P., Mamalaki C., Parrington J., Fox M., Miliou A., Jones M., Kioussis D. Locus control region function and heterochromatin-induced position effect variegation. Science (Washington DC), 271: 1123-1125, 1996.[Abstract]
  32. Cardiff R. D., Wellings S. R. The comparative pathology of human and mouse mammary glands. J. Mammary Gland Biol. Neoplasia, 4: 105-122, 1999.[Medline]
  33. DeOme K. B., Faulkin L. J., Jr., Bern H. A., Blair P. E. Development of mammary tumors from hyperplastic alveolar nodules transplanted into gland-free mammary fat pads of female C3H mice. Cancer Res., 19: 515-520, 1959.
  34. Beuving L. J. Mammary tumor formation within outgrowths of transplanted HANS from carcinogen treated rats. J. Natl. Cancer Inst., 40: 1287-1289, 1968.
  35. Medina D. Preneoplasia in mammary tumorigenesis Lippman R. D. A. M. eds. . Mammary Tumor Cell Cycle, Differentiation and Metastasis, : 37-69, Kluwer Academic Publishers Norwell, MA 1996.
  36. Cao Z., Umek R. M., McKnight S. L. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3–L1 cells. Genes Dev., 5: 1538-1552, 1991.[Abstract/Free Full Text]
  37. Umek R. M., Friedman A. D., McKnight S. L. CCAAT-enhancer binding protein: a component of a differentiation switch. Science (Washington DC), 251: 288-292, 1991.[Abstract/Free Full Text]
  38. Yeh W-C., Cao Z., Classon M., McKnight S. L. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev., 9: 168-181, 1995.[Abstract/Free Full Text]
  39. Lekstrom-Himes J., Xanthopoulos K. G. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J. Biol. Chem., 273: 28545-28548, 1998.[Abstract/Free Full Text]
  40. Buck M., Turler H., Chojkier M. LAP (NF-IL6), a tissue-specific transcriptional activator, is an inhibitor of hepatoma cell proliferation. EMBO J., 13: 851-860, 1994.[Medline]
  41. Diehl A. M., Yang S. Q. Regenerative changes in C/EBP {alpha} and C/EBP ß expression modulate binding to the C/EBP site in the c-fos promoter. Hepatology, 19: 447-456, 1994.[Medline]
  42. Rana B., Xie Y., Mischoulon D., Bucher N. L., Farmer S. R. The DNA binding activity of C/EBP transcription factor is regulated in the G1 phase of the hepatocyte cell cycle. J. Biol. Chem., 270: 18123-18132, 1995.[Abstract/Free Full Text]
  43. Chen P. L., Riley D. J., Chen-Kiang S., Lee W-H. Retinoblastoma protein directly interacts with and activates the transcription factor NF-IL6. Proc. Natl. Acad. Sci. USA, 93: 465-469, 1996.[Abstract/Free Full Text]
  44. Timchenko N. A., Harris T. E., Wilde M., Bilyeu T. A., Burgess-Beusse B. L., Finegold M. J., Darlington G. J. CCAAT/enhancer binding protein alpha regulates p21 protein and hepatocyte proliferation in newborn mice. Mol. Cell. Biol., 17: 7353-7361, 1997.[Abstract]
  45. Ramos R. A., Nishio Y., Maiyar A. C., Simon K. E., Ridder C. C., Ge Y., Firestone G. L. Glucocorticoid-stimulated CCAAT/enhancer-binding protein {alpha} expression is required for steroid-induced G1 cell cycle arrest of minimal-deviation rat hepatoma cells. Mol. Cell. Biol., 16: 5288-5301, 1996.[Abstract]
  46. Cha H. H., Cram E. J., Wang E. C., Huang A. J., Kasler H. G., Firestone G. L. Glucocorticoids stimulate p21 gene expression by targeting multiple transcriptional elements within a steroid responsive region of the p21waf1/cip1 promoter in rat hepatoma cells. J. Biol. Chem., 273: 1998-2007, 1998.[Abstract/Free Full Text]
  47. Cram E. J., Ramos R. A., Wang E. C., Cha H. H., Nishio Y., Firestone G. L. Role of the CCAAT/enhancer binding protein-{alpha} transcription factor in the glucocorticoid stimulation of p21waf1/cip1 gene promoter activity in growth-arrested rat hepatoma cells. J. Biol. Chem., 273: 2008-2014, 1998.[Abstract/Free Full Text]
  48. Chinery R., Brockman J. A., Peeler M. O., Shyr Y., Beauchamp R. D., Coffey R. J. Antioxidants enhance the cytotoxicity of chemotherapeutic agents in colorectal cancer: a p53-independent induction of p21WAF1/CIP1 via C/EBPß [see comments]. Nat. Med., 3: 1233-1241, 1997.[Medline]
  49. Zhu S., Oh H. S., Shim M., Sterneck E., Johnson P. F., Smart R. C. C/EBPß modulates the early events of keratinocyte differentiation involving growth arrest and keratin 1 and keratin 10 expression. Mol. Cell. Biol., 19: 7181-7190, 1999.[Abstract/Free Full Text]
  50. Osada S., Yamamoto H., Nishihara T., Imagawa M. DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. J. Biol. Chem., 271: 3891-3896, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
T. Yokota, T. Bui, Y. Liu, M. Yi, K. K. Hunt, and K. Keyomarsi
Differential Regulation of Elafin in Normal and Tumor-Derived Mammary Epithelial Cells Is Mediated by CCAAT/Enhancer Binding Protein
Cancer Res., December 1, 2007; 67(23): 11272 - 11283.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. M. Dudaronek, S. A. Barber, and J. E. Clements
CUGBP1 Is Required for IFNbeta-Mediated Induction of Dominant-Negative CEBPbeta and Suppression of SIV Replication in Macrophages
J. Immunol., December 1, 2007; 179(11): 7262 - 7269.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
C. Guerzoni, M. Bardini, S. A. Mariani, G. Ferrari-Amorotti, P. Neviani, M. L. Panno, Y. Zhang, R. Martinez, D. Perrotti, and B. Calabretta
Inducible activation of CEBPB, a gene negatively regulated by BCR/ABL, inhibits proliferation and promotes differentiation of BCR/ABL-expressing cells
Blood, May 15, 2006; 107(10): 4080 - 4089.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. Berberich-Siebelt, I. Berberich, M. Andrulis, B. Santner-Nanan, M. K. Jha, S. Klein-Hessling, A. Schimpl, and E. Serfling
SUMOylation Interferes with CCAAT/Enhancer-Binding Protein beta-Mediated c-myc Repression, but Not IL-4 Activation in T Cells.
J. Immunol., April 15, 2006; 176(8): 4843 - 4851.