| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Carcinogenesis |
Departments of Molecular Cell Biology [H. O., I. Z., A. F., M. M., N. G., V. R.] and Biological Chemistry [G. B., M. R.], Weizmann Institute of Science, Rehovot 76100, Israel
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-irradiation
were distributed evenly in the various cell cycle populations (analyzed
by the PAb-248 anti-p53 monoclonal antibody). However, both the
dephosphorylation of serine 376 of p53 (contained in the PAb-421
epitope) and the specific DNA binding activity, as well as apoptosis,
were enhanced toward the G2-M populations. Furthermore,
inactivation of wild-type p53, mediated by mutant p53 expression,
abolished the alterations in the BER pattern and showed no induction of
a G2-M-associated apoptosis after -irradiation. These
results suggest that after genotoxic stress, stabilized p53 enhances
the G0-G1-associated BER activity, whereas it
predominantly reduces BER activity at the G2-M-enriched
populations and instead induces apoptosis. After genotoxic stress, p53
functions as a modulator that determines the pattern of BER activity
and apoptosis in a cell cycle-specific manner. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
p53 plays a central role in the G0-G1 checkpoint, where it has been suggested to induce cell growth arrest and apoptosis, and in the G2-M checkpoint, where it is involved in the control of apoptosis and DNA repair induction (reviewed in Refs. 10 , 15, and 16 ). The involvement of p53 in the DNA damage-dependent delay in the G2 phase of the cell cycle and its contribution to DNA repair in this phase were described by several studies (17, 18, 19, 20) . Knockout of either p53 or p21/waf1 gene expression in human colorectal cancer cell lines caused premature exit from DNA damage-dependent G2 arrest and failure of cytokinesis, resulting in endoreduplication of the tetraploid cells and formation of polyploid giant cells. High levels of p53 can modulate the G2 growth arrest prior to mitotic chromosomal condensation (21) .
To further decipher the molecular cross-talk between the p53 protein and the DNA repair machinery, we studied their activities at specific phases in the cell cycle. In our work, we focused on the role of p53 in BER, a DNA repair pathway that is in charge of the removal of modified bases induced by endogenous and exogenous stress (11) . We have chosen to examine these parameters in two different cell lines. One is the pre-B-lymphoid cell line 70Z/3, which expresses wild-type p53 and seems to exhibit a normal cell cycle pattern (22) and a derived cell line that expresses mutant p53 (70Z/3-M8). The other is the p53 null L12 early pre-B cells (23) and derived clones expressing the p53 temperature-sensitive mutant (ts; Ref. 24 ). Enrichment of well-defined cell populations representing the individual cell cycle phases was achieved by centrifugal elutriation (20) .
We found that the pattern of BER activity is modulated during the cell cycle. Cells exhibit two distinct peaks of BER, at similar levels of activity. One peak is associated with the G0-G1-enriched populations and the other with the G2-M-enriched populations. Exposure of cells to 400R significantly enhanced the G0-G1-associated peak of BER activity. Under these conditions, the G2-M-associated BER activity was reduced, and instead, cells underwent apoptosis. Our present data show that after genotoxic stress, p53 also functions as a modulator that determines the pattern of BER activity in a cell cycle-specific manner.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
beam model 150
(MDS Nordion, Kanata, Ontario, Canada) fitted with a
60Co source at a dose rate of 90 rads/min.
Cell Fractionation by Centrifugal Elutriation.
Cell separation was performed at 22°C using RPMI 1640
supplemented with 1% FCS with a constant centrifuge speed of 2200 rpm.
Cells (2.0–2.5 x 108) were
loaded at a pump speed of 10.92 ml/min into an elutriation rotor J-6 MI
centrifuge equipped with a JE-5.0 elutriation system including a
Sanderson chamber (Beckman Instruments, Inc.) and a MasterFlex
(Cole-Parmer Instruments) peristaltic pump presterilized with 70%
ethanol, and 13 separated cell fractions were collected. Each fraction
was analyzed routinely by FACS. After the separation, cells were washed
once with PBS, counted by Coulter multisizer, and either replated in
RPMI 1640 supplemented with 10% FCS and grown for 24 h in 37°C
or collected for nuclear extraction for further analysis.
Analysis of Cell Cycle and Apoptosis by FACS.
Cells were fixed with 70% methanol (Biolab) at room temperature and
stained with 50 µg/ml PI (Sigma). The cells were analyzed by a
FACScan flow cytometer (Becton Dickinson) using the CellQuest (Becton
Dickinson) software.
Measurement of DNA Synthesis.
The total DNA synthesis in intact cells was measured as described
previously (27)
. Briefly,
[3
H]thymidine incorporation in intact cells at
37°C for 30 min in 1 ml of RPMI 1640 containing
106 cells supplemented with 10% FCS and 4 mCi of
[3
H]thymidine (64.9 Ci/mmol) was measured. The
reaction was terminated by the addition of 1 ml of 10% trichloroacetic
acid. After 1 h at 0°C, precipitates were washed on glass fiber
filters and counted for insoluble radioactivity.
BER Assay.
BER assay was performed as described previously (11)
.
Briefly, the assay was carried out in 25 µl containing 40
mM Tris (pH 7.6), 12 mM
MgCl2, 1 mM DTT, 0.1 mM
each of dTTP, dATP, and dCTP, 0.01 mM dGTP, 3%
polyethylene glycol, 0.3 µg of depurinated pSP65 plasmid, 0.3 µg of
nontreated plasmid, 0.25 µl of [
-P32]dGTP,
30 mM KCl, and 0.5–1.5 µg of nuclear extracts. Samples
were incubated at 37°C for 15 min. Five µl of stop buffer (120
mM EDTA, 1.2% SDS) were added to each sample and incubated
for 10 min at 60°C. Twenty µg of proteinase K were added and
incubated at 37°C for 1 h and then 170 µl of TE [10
mM Tris-HCl (pH 8), 1 mM EDTA (pH 8)] were
added. Samples were phenol/chloroform extracted and ethanol
precipitated. DNA was linearized with BamHI and fractionated
through a 0.7% agarose gel in TBE. Gels were UV photographed, dried,
and analyzed by phosphorimaging. DNA repair synthesis is presented by
PLS (28)
, calculated by dividing net counts
obtained from the phosphorimager by the DNA content assessed by UV
absorption. SDs are calculated in all experiments.
p53 Protein Analysis.
For Western blot analysis, 106 cells were lysed
in sample buffer [140 mM Tris (pH 6.8), 22.4% glycerol,
6% SDS, 10% ß-mercaptoethanol, and 0.02% bromophenol blue] boiled
and loaded on 10% polyacrylamide gels containing SDS. Proteins were
transferred to nitrocellulose membranes. The p53 protein was detected
using monoclonal PAb-248 antibody (29)
. The
protein-antibody complexes were detected using a horseradish
peroxidase-conjugated secondary antibody using the super-signal
enhanced chemiluminescence system (Pierce).
For the immunoprecipitation assays, [35S]methionine-labeled proteins were immunoprecipitated with the anti-p53-specific antibodies, PAb-248 (30) and PAb-421 (29) . The complexes were precipitated with Sepharose-protein A and washed three times in PLB buffer [10 mM NaH2PO4 (pH 7.5), 100 mM NaCl, 1% Triton X-100, 0.5% sodium deoxychlorate, and 0.1% SDS]. Proteins were then separated and analyzed by SDS-PAGE.
EMSA.
The DNA mobility shift assay was performed as described previously
(31)
. Briefly, 10–20 fmol of radio-end-labeled DNA
oligonucleotide, TCGAGAGGCATGTCTAGGCATGTCTC (32)
, were
mixed with 5 µg of nuclear extract. One µl of anti-p53 monoclonal
antibody PAb-421 (29)
ascitic fluid, 2 µg (2 µl) of
poly(deoxyinosinic-deoxycytidylic acid) and 10 µl of buffer (25
mM Tris-HCl, 100 mM KCl, 6.25 mM
MgCl2, 0.5 mM EDTA, 1 mM
DTT, and 10% glycerol) were added. The reactions were incubated for 15
min on ice and another 15 min at room temperature, loaded on a 4%
polyacrylamide gel, and electrophoresed.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-irradiation. For this purpose, we used the 70Z/3 cell line, a
chemically transformed pre-B-cell line, that expresses wild-type p53
and seems to exhibit a normal cell cycle (22)
. 70Z/3 cells
were exposed to 400R, and 2 h later, the BER activity was measured
from their nuclear extracts. The assay used is based on the comparison
of DNA synthesis in plasmids containing AP sites, generated by an
acidic treatment (AP+), and in untreated plasmids (AP-), as described
previously (11)
. This assay measures short gap repair
activity mediated by ß-polymerase on AP sites. Fig. 1
presents the amount of AP- and AP+ DNA of each sample (A),
the incorporation of labeled nucleotides in the samples (B),
and a quantitative analysis of the DNA repair synthesis in the various
cell populations (C). As can be seen, exposure to 400R
reduced significantly the BER activity in cells as opposed to the
untreated cells. This unexpected reduction prompted us to investigate
this phenomenon and the involvement of the tumor suppressor protein
p53.
|
Cell cycle-enriched populations of 70Z/3 pre-B cells were prepared, and
the authenticity of the cell cycle phase of each cell fraction was
confirmed by FACS analysis (see "Materials and Methods"). Fig. 2A
shows the cell cycle pattern of the various elutriated cell
fractions, where fractions 3–5 represent populations highly enriched
for cells in the G0-G1
phase, fractions 6–9 represent cells in the S-phase, and fractions
10–12 represent cells in the G2-M phase.
Fractions 1–2 were discarded because they mostly contained cell
debris.
|
represents a typical profile of DNA synthesis throughout the cell
cycle. Cells in the S-phase (fractions 6–9) exhibited a peak in DNA
synthesis, whereas cells in the
G0-G1 phase (fractions
3–5) and in the G2-M phase (fractions 10–12)
showed lower levels of [3
H]thymidine
incorporation. According to the cell cycle patterns obtained from these
two methods, it appears that centrifugal elutriation under the
conditions used is a valid method for the enrichment of cell
cycle-specific populations.
Finally, nuclear extracts were obtained from each fraction and analyzed
for BER activity. As can be seen in Fig. 2
C, two peaks of
BER with similar levels of activity are evident. One peak lies in the
G0-G1 phase (fractions
3–5) and the other in the G2-M phase (fractions
10–12). The pattern obtained shows that replicating cells at the
S-phase exhibit low levels of BER activity, whereas cells residing in
the G0-G1 and the
G2-M phases exhibit higher levels of BER
activity.
Characterization of -irradiated Cell Populations Obtained by
Centrifugal Elutriation.
Genotoxic stress is expected to affect DNA repair, as well as p53
expression and activity. To address this issue, cells were subjected to
-irradiation, and the connection between BER activity and p53 was
examined. To this end, 70Z/3 cells were exposed to 400R -irradiation
and 2 h later were separated by centrifugal elutriation. Cell
cycle parameters, BER activity, and p53 protein levels were measured.
No differences in the overall patterns of the cell cycle obtained by
FACS analysis were observed between the total unfractionated
populations and between the fractionated populations, with and without
treatment (compare Fig. 2A
of nontreated cells to Fig. 3A
of -irradiated cells). Furthermore, no significant
differences in the pattern of DNA synthesis of the various enriched
populations examined were seen (compare Fig. 2B
of
nontreated cells to Fig. 3B
of -irradiated cells).
|
that 400R -irradiation caused a
reduction in BER activity in comparison with nontreated cells. To
further understand this phenomenon, we determined the BER activity
profile along the cell cycle phases after -irradiation, which
revealed a significant change in the BER profile compared with that of
nontreated cells. The reduction in BER activity in -irradiated cells
may be more specifically mapped to the G2-M phase
(compare Fig. 3C
of -irradiated cells to Fig. 2C
of nontreated cells). Enriched cell populations obtained
from -irradiated cells exhibited a single enhanced peak of BER
activity, confined to the
G0-G1-enriched fractions
(Fig. 3C)
. Thus, it can be concluded that after
-irradiation, the
G0-G1-associated BER
activity is enhanced, and the G2-M-associated BER
activity is attenuated.
We looked for a possible relationship between p53 expression and BER
activity. p53 protein levels were determined in unfractionated cells
after -irradiation and after no treatment. Western blot analysis of
the p53 protein level, using the PAb-248 anti-p53 monoclonal
antibodies, showed an increase in p53 levels as early as 1 h after
-irradiation (Fig. 4A)
. To further examine the expression of p53 in the enriched
cell cycle fractions, cells were radiolabeled with
[35S]methionine, and p53 protein was
immunoprecipitated with the PAb-248 and the PAb-421 anti-p53 monoclonal
antibodies. Fig. 4B
displays a significant increase in the
level of p53 after -irradiation, with the PAb-248 antibody (compare
panels of total unfractionated cells, nontreated, and treated
fractionated cells, respectively). No significant differences in the
levels of the immunoprecipitated p53 in the individual cell fractions
were observed. However, when analyzed with the PAb-421 antibody,
detected levels of p53 protein seemed to increase from fractions 8 to
12, the G2-M-enriched fractions. These patterns
suggest that the increased protein levels of p53 after -irradiation
are equally distributed in all cell fractions, whereas expression of
the PAb-421 epitope seems to be cell cycle specific. In agreement with
previous reports, this may suggest that dephosphorylation of residue
376 in the PAb-421 epitope is -irradiation dependent (33
, 34)
.
|
-irradiation,
at different cell cycle phases. For this, nuclear extracts were
prepared from enriched fractions 2 h after -irradiation and
were analyzed by the EMSA, using a radiolabeled oligonucleotide
containing the p53 consensus sequence and the PAb-421 monoclonal
antibody (31)
. Fig. 5
shows that -irradiation enhanced the sequence-specific p53 DNA
binding activity (Fig. 5, A
and B, compare lanes
of total). Comparison of the various treated and nontreated cell
fractions indicated an increase in the p53 DNA binding activity in
enriched fractions from the mid S-phase (fractions 7–8) that was
further enhanced in the G2-M-enriched fractions.
This coincides with the appearance of the PAb-421 epitope of p53 in the
G2-M phase after -irradiation.
|
-irradiation is cell cycle independent, whereas the activation of
p53 and its specific DNA binding activity are cell cycle phase
specific. Furthermore, it can be said that the activation of p53 is at
the posttranslational level and independent of p53 stabilization.
Induction of Cell Growth Arrest and Apoptosis in -irradiated
Cell Populations Obtained by Centrifugal Elutriation.
To get better insight into the relationship between p53 and cellular
responses to genotoxic stress, it was important to examine other known
p53 processes. In the following experiments, we measured cell growth
arrest and induction of apoptosis in cell cycle-enriched populations
after -irradiation. Equal numbers of -irradiated as well as
nontreated cells were fractionated, as described above, and the
individual enriched cell populations were cultured at 37°C.
Twenty-four h later, cells were stained with PI and analyzed for cell
cycle patterns by FACS. The typical cell cycle patterns that were
obtained are shown in Fig. 6
. All cell fractions from nontreated cells exhibited normal patterns of
progression as a synchronized population (Fig. 6A)
.
Fractions 3–5, which were enriched for
G0-G1 phase progressed to
the S-phase, fractions 6–8 enriched for the S-phase progressed toward
the G2-M phase, and fractions 10–12, which were
enriched for G2-M phase, progressed to the
G0-G1 phase. Cell fractions
obtained after -irradiation showed an enhanced growth arrest that
was accompanied by apoptosis (Fig. 6B)
. Fig. 6C
presents a quantitative comparison between the percentage of apoptotic
cells obtained in the individually enriched populations of
-irradiated and nonirradiated cells. Enriched fractions for
G0-G1 (3, 4, 5)
and for S-phase (6, 7, 8)
, which were exposed to
-irradiation, showed a 5% increase of apoptosis compared with that
of the corresponding nontreated cells. Cells enriched for
G2-M phase showed a 15–20% increase of
apoptosis compared with that of the corresponding nontreated cells.
These results suggest that as a response to -irradiation, cells are
predominantly induced to undergo apoptosis at
G2-M (10, 11, 12)
. It should be added
that similar patterns of exit to apoptosis in the
G2-M fractions were evident when cells were
elutriated prior to -irradiation.
|
Measurements of BER Activity and Apoptosis after Wild-Type p53
Inactivation by Mutant p53 Expression.
To further study the association between p53 and the BER and apoptotic
patterns during the cell cycle and their alterations after genotoxic
stress, we analyzed cells that inactivate wild-type p53. For this
purpose, we used 70Z/3 cells stably transfected with mutant p53, which
inactivates wild-type p53 (clone 70Z/3-M8; Ref. 26
). We
compared BER activity in unfractionated 70Z/3 parental cells and in
mutant p53-expressing cells (clone 70Z/3-M8), with no treatment and
after -irradiation. As seen in Fig. 7
, inactivation of p53 by mutant p53 in nontreated cells caused more than
a 2.5-fold reduction in BER activity. This is in agreement with our
previous results that showed in an in vitro assay that BER
activity is, at least in part, p53 dependent (11)
.
Exposure of these clones to 400R seems to reduce BER activity in the
parental 70Z/3 cells (Fig. 7)
. However, expression of mutant p53 seems
to exert an enhanced BER activity after -irradiation. The latter BER
activity measured is most likely p53 independent.
|
and B, respectively). Interestingly, similar
patterns were obtained for the -irradiated and nontreated 70Z/3-M8
cells, which consist of two peaks in the
G0-G1 and
G2-M phases. This pattern resembles that observed
for the 70Z/3 parental nontreated cells (see Fig. 2C
), aside
for the G0-G1- and
G2-M-associated peaks, which are lower for the
70Z/3-M8 cells. In addition, in the 70Z/3-M8 cells, -irradiation did
not induce a reduction of the G2-M-associated
peak of BER activity (Fig. 8B)
, as seen with the
-irradiated parental 70Z/3 cells (see Fig. 3C
). Also, an
increase in the
G0-G1-associated peak of
BER activity observed in the -irradiated parental 70Z/3 cells was
not found in the 70Z/3-M8 mutant-expressing cells. This suggests that
the increase in the
G0-G1-associated BER
activity after -irradiation and the attenuation of the
G2-M-associated BER activity is p53 dependent.
|
depicts the p53 protein levels in the L12p53ts clone, as
evaluated by Western blot analysis, using the PAb-248 anti-p53
monoclonal antibody. The L12p53ts producer clone and the L12 p53 null
cell line were exposed to 400R and grown for 24 h in 32°C to
permit the expression of wild-type p53 conformation in the L12p53ts
cell line. Fig. 9B
presents the BER activity levels in
enriched G0-G1 and
G2-M populations, in the p53-expressing and
nonexpressing cell lines, after genotoxic stress. In the
G0-G1-enriched population,
an increment of 1.3-fold in the BER activity after the expression of
wild-type p53 was observed, whereas in the
G2-M-enriched population, a reduction of 2-fold
in BER activity after p53 expression was evident. These results suggest
a direct effect of p53 on the cell cycle-dependent BER activity after
-irradiation.
|
-irradiation.
To this end, the L12p53ts clone was exposed to 400R, and cells were
grown for 24 h in either 32°C to permit expression of the
wild-type p53 conformation or 37°C to permit expression of the mutant
p53 conformation. Cells were fractionated by centrifugal elutriation,
nuclear extracts were prepared, and BER activity was measured. Fig. 9, C
and D, present the patterns of BER activity
obtained. The two BER-specific peaks were evident in cell extracts
expressing the mutant p53 grown at 37°C (Fig. 9C)
.
However, cells grown at 32°C expressing the wild-type p53 protein
seemed to express a facilitated
G0-G1-associated BER
activity and exhibited a significant reduction in the
G2-M-associated BER activity (Fig. 9D)
. These results are in agreement with the conclusion that
p53 expression modulates the pattern of BER activity along the cell
cycle. The findings with 70Z/3, 70Z/3-M8, L12p53ts, and L12
substantiate the involvement of p53 in BER and exclude the possibility
that this phenomenon is cell type specific.
Finally, we examined the effect of p53 inactivation on
-irradiation-induced apoptosis throughout the cell cycle. Enriched
70Z/3-M8 cell fractions subjected to -irradiation and nontreated
controls were cultured for 24 h and stained with PI. Fig. 8C
presents the percentage of apoptosis obtained for the
treated and nontreated 70Z/3-M8enriched fractions. In all cell
cycle phases, up to a 2–3-fold increase in apoptosis was evident after
-irradiation. However, a further increase of 4–5-fold in apoptosis,
as observed for the parental 70Z/3 cells in the
G2-M phase (see Fig. 6C
), was not
observed for the 70Z/3-M8 cells.
These results are in agreement with the concept that mutant p53 acts
through a dominant-negative mechanism, by which it interferes with the
wild-type p53 activity. Moreover, it may be said that the induction of
G2-M-associated apoptosis after -irradiation
is p53 dependent.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
It is well accepted that p53 plays a pivotal role in the maintenance of genomic stability. p53 is involved in the G0-G1 checkpoint and has also been shown to control G2-M-associated DNA repair activities (reviewed in Ref. 7 ). p53 is believed to function as part of a stress-response pathway, which determines the fate of cells. The options include cell survival, which consists of cell cycle delay accompanied by repair of DNA damage (10 , 19 , 39) , cell suicide through apoptosis (6 , 40) , or permanent cell cycle arrest terminated by necrosis or cellular differentiation (41) .
Exogenous and endogenous signals, after DNA clastogenic/mutagenic
events (42)
, which include -irradiation (2
, 3)
, UV irradiation (43, 44, 45)
, various chemical
exposures (46
, 47)
, oxidative stress (48
, 49)
, and metabolite deprivation, are among the DNA-damaging
agents that would elicit a p53-dependent stress response. The best
characterized DNA damage signaling pathway that activates p53, not
including UV irradiation, consists of selective phosphorylation of the
p53 protein by the ATM kinase (33
, 50, 51, 52)
. This is
confirmed by the finding that the p53-dependent response to all known
DNA-damaging agents, except for UV, is severely impaired in ataxia
telangiectasia patients and in atm knockout mice
(53, 54, 55)
.
The apparent connection between the DNA repair machinery and p53
expression, and their association with the cell cycle checkpoints,
prompted us to further investigate the possible cross-talk between
these pathways. In our study, we focused on BER activity, a DNA repair
system that acts continuously on both spontaneously and externally
induced DNA damage caused by hydrolysis, oxygen-free radicals, simple
alkylating agents (56
, 57)
, and -irradiation. We chose
-irradiation as the inducer of BER activity (58
, 59)
.
It should be noted that we obtained similar results using cisplatin as
a DNA-damaging agent (data not shown). Interestingly, the base damage
induced by -irradiation was found to be recognized by
poly(ADP-ribose) polymerase, which in turn converts the DNA
interruption into intracellular signals that activate BER or cell death
after the G2-M phase (60
, 61)
.
We showed previously that wild-type p53 is directly involved in BER
activity, by using an in vitro experimental assay. Nuclear
extracts with wild-type p53 showed an enhanced BER activity in
comparison to nuclear extracts expressing the mutant conformation of
p53 (11)
. In the present study, we show that p53 in
vivo modulates the BER activity pattern after -irradiation in a
cell cycle-specific manner. Exposure of cells to 400R reduced the
overall BER activity, and yet a significant change in its pattern
occurred. We found that cells that are not subjected to genotoxic
stress exhibit two distinct cell cycle-associated peaks of BER
activity, at the G0-G1 and
the G2-M phases. Exposure of cells to
-irradiation was found to alter this pattern of two peaks of BER
activity in such a way that BER was enhanced at the
G0-G1 checkpoint and
attenuated at the G2-M checkpoint. Variations in
the pattern of distribution of these activities suggest that BER is
used both at the G0-G1 and
the G2-M checkpoints to repair spontaneous DNA
damage. External genotoxic stress, however, seems to predominantly
induce the G0-G1
BER-associated activity and to attenuate the
G2-M-associated BER activity. Interestingly,
under the same conditions, cells at the G2-M
phase were alternatively induced to undergo apoptosis. It appears that
DNA-damaged cells entering the
G0-G1 checkpoint are
preferentially repaired by the BER machinery rather then sent to
apoptosis, whereas cells in the G2-M checkpoint
are preferentially induced to undergo apoptosis. The decision whether
to induce DNA repair at a given cell cycle checkpoint may be determined
by the amount of damaged DNA accumulated, the availability of the
immediate activity of the BER pathway or other repair pathways, or yet
by other unknown reasons.
Our presented data suggest that alterations in BER activity after
-irradiation are p53 dependent. In two different mutant
p53-expressing clones, the accelerated
G0-G1-associated BER
activity and the reduced G2-M-associated activity
observed in wild-type p53-expressing cells after -irradiation were
not found. The levels of the two typical peaks of BER activity in the
mutant p53 clones were also lower than in the wild-type p53-expressing
cells, after genotoxic stress. Furthermore, the mutant p53 cells,
70Z/3-M8, were blocked to undergo G2-M-associated
apoptosis. Inactivation of the p53-dependent BER activity in these
cells is probably mediated by a dominant-negative mechanism induced by
mutant p53.
The observation that mutant p53 expresser cells seem to exhibit a higher BER activity, in response to genotoxic stress, as opposed to the parental wild-type p53 clone, is in agreement with our previous observations (11) . We speculate that in the normal life course of the cell, BER activity, which at least in part is p53 dependent, serves as a DNA repair machinery that treats endogenous DNA aberrations accumulated during cell replication and differentiation. However, after external genotoxic stress, we suggest that cells acquire an additional regulatory security mechanism to assure genomic stability, and that this mechanism is p53 dependent. Thus, in addition to a direct role of p53 in the "housekeeping" BER activity (11) , we show that p53 has an additional role in response to genotoxic stress as a modulator of the BER activity throughout the cell cycle.
Analysis of wild-type p53 expression along the cell cycle after
-irradiation indicated enhanced levels of the stabilized p53 protein
that were equally distributed throughout the cell cycle. However, both
the dephosphorylated form of p53 at residue 376 and the specific p53
DNA binding activity, which presumably represents initial steps
associated with its transcriptional activity, seemed to appear as cells
progress toward the G2-M phase. The
-irradiated induced p53 DNA binding activity also coincides with the
p53-dependent apoptosis. The observation that the stabilization of p53
protein and its functional activation show different patterns along the
cell cycle suggests that these are two distinguished and defined steps
in the process of activation of the p53 protein.
To conclude, it appears that after genotoxic stress, stabilized p53 induces, at the G0-G1 checkpoint, BER activity that is independent of its transcriptional activity. This is further supported by our recent observation that a p53 transcription-deficient mutant functions as wild-type p53 when analyzed for BER activity.4 At the G2-M phase, p53 plays a central regulatory role in attenuating BER activity and alternatively signaling a G2-M-associated apoptosis. The latter probably depends on its transcriptional activity. The decision of whether cells exposed to genotoxic stress should repair their damaged DNA through BER activity or undergo apoptosis is a cell cycle phase-specific event that seems to be controlled by the wild-type p53 protein. This may be applied to anticancer therapy, by causing cancerous cells to accumulate in the G2-M phase before treatment with genotoxic stress.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 This work was supported in part by grants from
the Israel-USA Binational Science Foundation and the German Israeli
Foundation for Scientific Research and Development and the Israel
Cancer Research Fund. V. R. is the incumbent of the Norman and Helen
Asher Professorial Chair in Cancer Research at the Weizmann
Institute. 
2 To whom requests for reprints should be
addressed, at Department of Molecular Cell Biology, Weizmann Institute
of Science, Rehovot 76100, Israel. Phone: 972-8-9344501; Fax:
972-8-9465265; E-mail: varda.rotter{at}weizmann.ac.il
3 The abbreviations used are: BER, base excision
repair; ts, temperature sensitive; FACS, fluorescence-activated cell
sorter; PI, propidium iodide; AP, apurinic; EMS, electrophoretic
mobility shift assay.
4 H. Offer, M. Milyavsky, N. Erez, and V. Rotter.
p53 involvement in BER does not require its transcriptional activity,
submitted for publication.
Received 5/10/00. Accepted 10/26/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-irradiation-induced delay and DNA repair. Oncogene, 15: 2597-2607, 1997.[Medline]
-irradiation induces a G2-dependent immunoglobulin 
light chain gene expression. EMBO J., 14: 1392-1401, 1995.[Medline]
-33P]ATP and the ultrasensitive bio-imaging analyzer. Anal. Biochem., 217: 98-102, 1994.[Medline]
. Nature (Lond.), 392: 405-408, 1998.[Medline]
-irradiated human cells. Carcinogenesis (Lond.)., 8: 607-609, 1987.This article has been cited by other articles:
|
|
 |
|
  A. Romanenko, A. Kakehashi, K. Morimura, H. Wanibuchi, M. Wei, A. Vozianov, and S. Fukushima Urinary bladder carcinogenesis induced by chronic exposure to persistent low-dose ionizing radiation after Chernobyl accident Carcinogenesis, November 1, 2009; 30(11): 1821 - 1831. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. K. Pulukuri, J. A. Knost, N. Estes, and J. S. Rao Small Interfering RNA-Directed Knockdown of Uracil DNA Glycosylase Induces Apoptosis and Sensitizes Human Prostate Cancer Cells to Genotoxic Stress Mol. Cancer Res., August 1, 2009; 7(8): 1285 - 1293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Kassam and A. J. Rainbow UV-inducible base excision repair of oxidative damaged DNA in human cells Mutagenesis, January 1, 2009; 24(1): 75 - 83. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Menendez, A. Inga, and M. A. Resnick The Biological Impact of the Human Master Regulator p53 Can Be Altered by Mutations That Change the Spectrum and Expression of Its Target Genes Mol. Cell. Biol., March 15, 2006; 26(6): 2297 - 2308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Wu, J. A. Roth, H. Zhao, S. Luo, Y.-L. Zheng, S. Chiang, and M. R. Spitz Cell Cycle Checkpoints, DNA Damage/Repair, and Lung Cancer Risk Cancer Res., January 1, 2005; 65(1): 349 - 357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sugo, N. Niimi, Y. Aratani, K. Takiguchi-Hayashi, and H. Koyama p53 Deficiency Rescues Neuronal Apoptosis but Not Differentiation in DNA Polymerase {beta}-Deficient Mice Mol. Cell. Biol., November 1, 2004; 24(21): 9470 - 9477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Zurer, L. J. Hofseth, Y. Cohen, M. Xu-Welliver, S. P. Hussain, C. C. Harris, and V. Rotter The role of p53 in base excision repair following genotoxic stress Carcinogenesis, January 1, 2004; 25(1): 11 - 19. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Scott, J. D. Earle, and P. H. Gumerlock Functional p53 Increases Prostate Cancer Cell Survival After Exposure to Fractionated Doses of Ionizing Radiation Cancer Res., November 1, 2003; 63(21): 7190 - 7196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. K. Sah, A. Munshi, T. Nishikawa, T. Mukhopadhyay, J. A. Roth, and R. E. Meyn Adenovirus-mediated wild-type p53 radiosensitizes human tumor cells by suppressing DNA repair capacity Mol. Cancer Ther., November 1, 2003; 2(11): 1223 - 1231. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. R. Lloyd and P. C. Hanawalt p53 Controls Global Nucleotide Excision Repair of Low Levels of Structurally Diverse Benzo(g)chrysene-DNA Adducts in Human Fibroblasts Cancer Res., September 15, 2002; 62(18): 5288 - 5294. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Liu, Y. Nakatsuru, and S. L. Gerson Base Excision Repair as a Therapeutic Target in Colon Cancer Clin. Cancer Res., September 1, 2002; 8(9): 2985 - 2991. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Offer, N. Erez, I. Zurer, X. Tang, M. Milyavsky, N. Goldfinger, and V. Rotter The onset of p53-dependent DNA repair or apoptosis is determined by the level of accumulated damaged DNA Carcinogenesis, June 1, 2002; 23(6): 1025 - 1032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Smith and Y. R. Seo p53 regulation of DNA excision repair pathways Mutagenesis, March 1, 2002; 17(2): 149 - 156. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. d. M. C. Gontijo, F. N. Elias, D. M. F. Salvadori, M. L. C. S. de Oliveira, L. A. Correa, J. Goldberg, J. C. d. S. Trindade, and J. L. V. de Camargo Single-Cell Gel (Comet) Assay Detects Primary DNA Damage in Nonneoplastic Urothelial Cells of Smokers and Ex-smokers Cancer Epidemiol. Biomarkers Prev., September 1, 2001; 10(9): 987 - 993. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Frosina Counteracting spontaneous transformation via overexpression of rate-limiting DNA base excision repair enzymes Carcinogenesis, September 1, 2001; 22(9): 1335 - 1341. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
) and of 
) cell
fractions is shown in panel C. Columns are the average
of two separate elutriations; bars, SD.
