Cancer Research Cell Death Mechanisms and Cancer Therapy  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Offer, H.
Right arrow Articles by Rotter, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Offer, H.
Right arrow Articles by Rotter, V.
[Cancer Research 61, 88-96, January 1, 2001]
© 2001 American Association for Cancer Research


Carcinogenesis

p53 Modulates Base Excision Repair Activity in a Cell Cycle-specific Manner after Genotoxic Stress1

Hagai Offer, Irit Zurer, Gaspar Banfalvi, Marian Reha’k, Ayellet Falcovitz, Michael Milyavsky, Naomi Goldfinger and Varda Rotter2

Departments of Molecular Cell Biology [H. O., I. Z., A. F., M. M., N. G., V. R.] and Biological Chemistry [G. B., M. R.], Weizmann Institute of Science, Rehovot 76100, Israel


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To elucidate the nature of the cross-talk between the p53 protein and the DNA repair machinery, we have investigated the relationship between the two throughout the cell cycle. Base excision repair (BER) was analyzed in cell cycle phase-enriched populations of lymphoid cells expressing wild-type p53. Our study yielded the following novel findings: (a) BER exhibited two distinct peaks of activity, one associated with the G0-G1 checkpoint and the second with the G2-M checkpoint; (b) although the overall BER activity was reduced after exposure of cells to 400R, there was an augmentation of the G0-G1-associated BER activity and a reduction in the G2-M-associated BER activity; and (c) modulations in these patterns of BER after genotoxic stress were found to be p53 regulated. p53 protein levels induced after {gamma}-irradiation were distributed evenly in the various cell cycle populations (analyzed by the PAb-248 anti-p53 monoclonal antibody). However, both the dephosphorylation of serine 376 of p53 (contained in the PAb-421 epitope) and the specific DNA binding activity, as well as apoptosis, were enhanced toward the G2-M populations. Furthermore, inactivation of wild-type p53, mediated by mutant p53 expression, abolished the alterations in the BER pattern and showed no induction of a G2-M-associated apoptosis after {gamma}-irradiation. These results suggest that after genotoxic stress, stabilized p53 enhances the G0-G1-associated BER activity, whereas it predominantly reduces BER activity at the G2-M-enriched populations and instead induces apoptosis. After genotoxic stress, p53 functions as a modulator that determines the pattern of BER activity and apoptosis in a cell cycle-specific manner.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genomic stability, central to the maintenance of the normal cellular life, is heavily dependent on the ability of the cell to sense and recognize damaged DNA and then to either repair or degrade it. Apoptosis after exposure to DNA-damaging agents can be regarded as a mechanism for preventing the propagation of genetically aberrant cells that have sustained a high level of DNA damage (1) . Data accumulated over the years suggest that the tumor suppressor gene p53 plays a pivotal role at several molecular junctures in these pathways (2, 3, 4, 5) . Collectively, it suggests that activated p53, after genotoxic stress, may either trigger the onset of DNA repair, leading to the completion of the cell cycle, or alternatively, induce apoptosis and/or cellular differentiation, leading to exit from the cell cycle (reviewed in Refs. 6 and 7 ). The notion that p53 directly induces apoptosis has been shown unequivocally in many independent ways. However, less is known about the molecular mechanism(s) that underlies the role of p53 in the DNA repair machinery. The wild-type p53 protein was described to be associated with a number of known DNA repair pathways, including nucleotide excision repair (8, 9, 10) . In addition, we showed that p53 in its wild-type protein conformation, encoded by either human or murine temperature-sensitive mutant p53, directly induced BER3 activity in vitro and in vivo (11) .4 Depletion of p53 from the nuclear extracts abolished this enhanced activity (11) . The p53 COOH terminus is thought to be essential for "sensing" and detecting damaged DNA (12, 13, 14) .

p53 plays a central role in the G0-G1 checkpoint, where it has been suggested to induce cell growth arrest and apoptosis, and in the G2-M checkpoint, where it is involved in the control of apoptosis and DNA repair induction (reviewed in Refs. 10 , 15, and 16 ). The involvement of p53 in the DNA damage-dependent delay in the G2 phase of the cell cycle and its contribution to DNA repair in this phase were described by several studies (17, 18, 19, 20) . Knockout of either p53 or p21/waf1 gene expression in human colorectal cancer cell lines caused premature exit from DNA damage-dependent G2 arrest and failure of cytokinesis, resulting in endoreduplication of the tetraploid cells and formation of polyploid giant cells. High levels of p53 can modulate the G2 growth arrest prior to mitotic chromosomal condensation (21) .

To further decipher the molecular cross-talk between the p53 protein and the DNA repair machinery, we studied their activities at specific phases in the cell cycle. In our work, we focused on the role of p53 in BER, a DNA repair pathway that is in charge of the removal of modified bases induced by endogenous and exogenous stress (11) . We have chosen to examine these parameters in two different cell lines. One is the pre-B-lymphoid cell line 70Z/3, which expresses wild-type p53 and seems to exhibit a normal cell cycle pattern (22) and a derived cell line that expresses mutant p53 (70Z/3-M8). The other is the p53 null L12 early pre-B cells (23) and derived clones expressing the p53 temperature-sensitive mutant (ts; Ref. 24 ). Enrichment of well-defined cell populations representing the individual cell cycle phases was achieved by centrifugal elutriation (20) .

We found that the pattern of BER activity is modulated during the cell cycle. Cells exhibit two distinct peaks of BER, at similar levels of activity. One peak is associated with the G0-G1-enriched populations and the other with the G2-M-enriched populations. Exposure of cells to 400R significantly enhanced the G0-G1-associated peak of BER activity. Under these conditions, the G2-M-associated BER activity was reduced, and instead, cells underwent apoptosis. Our present data show that after genotoxic stress, p53 also functions as a modulator that determines the pattern of BER activity in a cell cycle-specific manner.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines.
The murine pre-B-cell line 70Z/3 (25) and the murine early pre-B p53 null cell line L12 (23) were grown in suspension at 37°C in RPMI 1640 containing 10% FCS and 2 x 10-5 M ß-mercaptoethanol. 70Z/3-M8 is a stable clone derived by transfection of pSVLM8p53, a p53 mutant cDNA with an alternatively spliced COOH terminus and the drug-resistant gpt gene (26) . L12p53ts-derived clones express the LTRp53ts mutant plasmid. The 70Z/3-M8 cell line and the L12p53ts cell line were grown in selectable RPMI 1640 containing 2 µg/ml mycophenolic acid, 150 µg/ml xanthine, and 15 µg/ml hypoxanthine. Cells at a density of 2.5 x 108/ml were irradiated by a {gamma} beam model 150 (MDS Nordion, Kanata, Ontario, Canada) fitted with a 60Co source at a dose rate of 90 rads/min.

Cell Fractionation by Centrifugal Elutriation.
Cell separation was performed at 22°C using RPMI 1640 supplemented with 1% FCS with a constant centrifuge speed of 2200 rpm. Cells (2.0–2.5 x 108) were loaded at a pump speed of 10.92 ml/min into an elutriation rotor J-6 MI centrifuge equipped with a JE-5.0 elutriation system including a Sanderson chamber (Beckman Instruments, Inc.) and a MasterFlex (Cole-Parmer Instruments) peristaltic pump presterilized with 70% ethanol, and 13 separated cell fractions were collected. Each fraction was analyzed routinely by FACS. After the separation, cells were washed once with PBS, counted by Coulter multisizer, and either replated in RPMI 1640 supplemented with 10% FCS and grown for 24 h in 37°C or collected for nuclear extraction for further analysis.

Analysis of Cell Cycle and Apoptosis by FACS.
Cells were fixed with 70% methanol (Biolab) at room temperature and stained with 50 µg/ml PI (Sigma). The cells were analyzed by a FACScan flow cytometer (Becton Dickinson) using the CellQuest (Becton Dickinson) software.

Measurement of DNA Synthesis.
The total DNA synthesis in intact cells was measured as described previously (27) . Briefly, [3 H]thymidine incorporation in intact cells at 37°C for 30 min in 1 ml of RPMI 1640 containing 106 cells supplemented with 10% FCS and 4 mCi of [3 H]thymidine (64.9 Ci/mmol) was measured. The reaction was terminated by the addition of 1 ml of 10% trichloroacetic acid. After 1 h at 0°C, precipitates were washed on glass fiber filters and counted for insoluble radioactivity.

BER Assay.
BER assay was performed as described previously (11) . Briefly, the assay was carried out in 25 µl containing 40 mM Tris (pH 7.6), 12 mM MgCl2, 1 mM DTT, 0.1 mM each of dTTP, dATP, and dCTP, 0.01 mM dGTP, 3% polyethylene glycol, 0.3 µg of depurinated pSP65 plasmid, 0.3 µg of nontreated plasmid, 0.25 µl of [{alpha}-P32]dGTP, 30 mM KCl, and 0.5–1.5 µg of nuclear extracts. Samples were incubated at 37°C for 15 min. Five µl of stop buffer (120 mM EDTA, 1.2% SDS) were added to each sample and incubated for 10 min at 60°C. Twenty µg of proteinase K were added and incubated at 37°C for 1 h and then 170 µl of TE [10 mM Tris-HCl (pH 8), 1 mM EDTA (pH 8)] were added. Samples were phenol/chloroform extracted and ethanol precipitated. DNA was linearized with BamHI and fractionated through a 0.7% agarose gel in TBE. Gels were UV photographed, dried, and analyzed by phosphorimaging. DNA repair synthesis is presented by PLS (28) , calculated by dividing net counts obtained from the phosphorimager by the DNA content assessed by UV absorption. SDs are calculated in all experiments.

p53 Protein Analysis.
For Western blot analysis, 106 cells were lysed in sample buffer [140 mM Tris (pH 6.8), 22.4% glycerol, 6% SDS, 10% ß-mercaptoethanol, and 0.02% bromophenol blue] boiled and loaded on 10% polyacrylamide gels containing SDS. Proteins were transferred to nitrocellulose membranes. The p53 protein was detected using monoclonal PAb-248 antibody (29) . The protein-antibody complexes were detected using a horseradish peroxidase-conjugated secondary antibody using the super-signal enhanced chemiluminescence system (Pierce).

For the immunoprecipitation assays, [35S]methionine-labeled proteins were immunoprecipitated with the anti-p53-specific antibodies, PAb-248 (30) and PAb-421 (29) . The complexes were precipitated with Sepharose-protein A and washed three times in PLB buffer [10 mM NaH2PO4 (pH 7.5), 100 mM NaCl, 1% Triton X-100, 0.5% sodium deoxychlorate, and 0.1% SDS]. Proteins were then separated and analyzed by SDS-PAGE.

EMSA.
The DNA mobility shift assay was performed as described previously (31) . Briefly, 10–20 fmol of radio-end-labeled DNA oligonucleotide, TCGAGAGGCATGTCTAGGCATGTCTC (32) , were mixed with 5 µg of nuclear extract. One µl of anti-p53 monoclonal antibody PAb-421 (29) ascitic fluid, 2 µg (2 µl) of poly(deoxyinosinic-deoxycytidylic acid) and 10 µl of buffer (25 mM Tris-HCl, 100 mM KCl, 6.25 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, and 10% glycerol) were added. The reactions were incubated for 15 min on ice and another 15 min at room temperature, loaded on a 4% polyacrylamide gel, and electrophoresed.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Changes in BER Activity as a Result of DNA Damage.
To study the effect of DNA damage in cells on the onset of the repair machinery, we chose to examine the BER activity in cells exposed to {gamma}-irradiation. For this purpose, we used the 70Z/3 cell line, a chemically transformed pre-B-cell line, that expresses wild-type p53 and seems to exhibit a normal cell cycle (22) . 70Z/3 cells were exposed to 400R, and 2 h later, the BER activity was measured from their nuclear extracts. The assay used is based on the comparison of DNA synthesis in plasmids containing AP sites, generated by an acidic treatment (AP+), and in untreated plasmids (AP-), as described previously (11) . This assay measures short gap repair activity mediated by ß-polymerase on AP sites. Fig. 1Citation presents the amount of AP- and AP+ DNA of each sample (A), the incorporation of labeled nucleotides in the samples (B), and a quantitative analysis of the DNA repair synthesis in the various cell populations (C). As can be seen, exposure to 400R reduced significantly the BER activity in cells as opposed to the untreated cells. This unexpected reduction prompted us to investigate this phenomenon and the involvement of the tumor suppressor protein p53.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Changes in BER activity as a result of induced DNA damage. Nuclear extracts obtained from unfractionated nontreated (0R) or treated (400R) 70Z/3 cells were analyzed for BER activity, as described in "Materials and Methods." Duplicate samples of linearized AP+ and AP- plasmids from the various reactions were separated by gel electrophoresis and exposed to UV (A) or analyzed for radioactivity by phosphorimaging (B). DNA repair synthesis (PLS) is calculated as described in "Materials and Methods" (C). Bars, SD.

 
Characterization of Cell Populations Obtained by Centrifugal Elutriation.
To characterize the behavior of BER throughout the cell cycle in response to DNA damage, BER activity was measured in enriched cell cycle phase-specific populations. The enriched populations were separated by centrifugal elutriation of logarithmically growing cells. This method separates cells according to their DNA content and density, which vary according to the different cell cycle phases (20) .

Cell cycle-enriched populations of 70Z/3 pre-B cells were prepared, and the authenticity of the cell cycle phase of each cell fraction was confirmed by FACS analysis (see "Materials and Methods"). Fig. 2ACitation shows the cell cycle pattern of the various elutriated cell fractions, where fractions 3–5 represent populations highly enriched for cells in the G0-G1 phase, fractions 6–9 represent cells in the S-phase, and fractions 10–12 represent cells in the G2-M phase. Fractions 1–2 were discarded because they mostly contained cell debris.



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Characterization of cell populations obtained by centrifugal elutriation. 70Z/3 cells were elutriated as described in "Materials and Methods." Cell cycle patterns of the various fractions were obtained, using PI staining followed by FACS analysis. A three-dimensional representation of the cell number and cell cycle phase of each of the fractions obtained is presented in A. Ap, apoptotic cells; G0/G1, phase; S, replicating cells; G2/M, phase. DNA synthesis of the individually elutriated fractions measured by [3H]thymidine incorporation is presented in B. Columns are the average of three separate cell elutriations; bars, SD. DNA repair synthesis (PLS) measured in nuclear extracts obtained from the elutriated fractions is presented in C. Columns are the average of three separate elutriations; bars, SD. Each measurement was done in duplicates. A typical presentation of the various steps of the in vitro BER assay is illustrated in Fig. 1Citation .

 
For further characterization of the enriched cell cycle populations, the DNA synthesis of each fraction was quantified according to [3 H]thymidine incorporation. Fig. 2BCitation represents a typical profile of DNA synthesis throughout the cell cycle. Cells in the S-phase (fractions 6–9) exhibited a peak in DNA synthesis, whereas cells in the G0-G1 phase (fractions 3–5) and in the G2-M phase (fractions 10–12) showed lower levels of [3 H]thymidine incorporation. According to the cell cycle patterns obtained from these two methods, it appears that centrifugal elutriation under the conditions used is a valid method for the enrichment of cell cycle-specific populations.

Finally, nuclear extracts were obtained from each fraction and analyzed for BER activity. As can be seen in Fig. 2Citation C, two peaks of BER with similar levels of activity are evident. One peak lies in the G0-G1 phase (fractions 3–5) and the other in the G2-M phase (fractions 10–12). The pattern obtained shows that replicating cells at the S-phase exhibit low levels of BER activity, whereas cells residing in the G0-G1 and the G2-M phases exhibit higher levels of BER activity.

Characterization of {gamma}-irradiated Cell Populations Obtained by Centrifugal Elutriation.
Genotoxic stress is expected to affect DNA repair, as well as p53 expression and activity. To address this issue, cells were subjected to {gamma}-irradiation, and the connection between BER activity and p53 was examined. To this end, 70Z/3 cells were exposed to 400R {gamma}-irradiation and 2 h later were separated by centrifugal elutriation. Cell cycle parameters, BER activity, and p53 protein levels were measured.

No differences in the overall patterns of the cell cycle obtained by FACS analysis were observed between the total unfractionated populations and between the fractionated populations, with and without treatment (compare Fig. 2ACitation of nontreated cells to Fig. 3ACitation of {gamma}-irradiated cells). Furthermore, no significant differences in the pattern of DNA synthesis of the various enriched populations examined were seen (compare Fig. 2BCitation of nontreated cells to Fig. 3BCitation of {gamma}-irradiated cells).



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Characterization of {gamma}-irradiated (400R) cell populations obtained by centrifugal elutriation. 70Z/3 cells were irradiated with 400R, incubated for 2 h, and elutriated, as described in "Materials and Methods." The different fractions obtained were analyzed for cell cycle patterns by FACS using PI staining. Three-dimensional representation of the cell number and cell cycle phase of each of the fractions obtained (A) is shown. Ap, apoptotic cells; G0/G1, phase; S, replicating cells; G2/M, phase. DNA synthesis in the elutriated fractions after {gamma}-irradiation was measured by [3H]thymidine incorporation. Columns are the average of three separate cell elutriations; bars, SD (B). DNA repair synthesis (PLS) was assayed in nuclear extracts derived from the elutriated fractions after {gamma}-irradiation. Columns are the average of three separate elutriations; bars, SD. Each measurement was done in duplicate (C).

 
It was shown previously in Fig. 1Citation that 400R {gamma}-irradiation caused a reduction in BER activity in comparison with nontreated cells. To further understand this phenomenon, we determined the BER activity profile along the cell cycle phases after {gamma}-irradiation, which revealed a significant change in the BER profile compared with that of nontreated cells. The reduction in BER activity in {gamma}-irradiated cells may be more specifically mapped to the G2-M phase (compare Fig. 3CCitation of {gamma}-irradiated cells to Fig. 2CCitation of nontreated cells). Enriched cell populations obtained from {gamma}-irradiated cells exhibited a single enhanced peak of BER activity, confined to the G0-G1-enriched fractions (Fig. 3C)Citation . Thus, it can be concluded that after {gamma}-irradiation, the G0-G1-associated BER activity is enhanced, and the G2-M-associated BER activity is attenuated.

We looked for a possible relationship between p53 expression and BER activity. p53 protein levels were determined in unfractionated cells after {gamma}-irradiation and after no treatment. Western blot analysis of the p53 protein level, using the PAb-248 anti-p53 monoclonal antibodies, showed an increase in p53 levels as early as 1 h after {gamma}-irradiation (Fig. 4A)Citation . To further examine the expression of p53 in the enriched cell cycle fractions, cells were radiolabeled with [35S]methionine, and p53 protein was immunoprecipitated with the PAb-248 and the PAb-421 anti-p53 monoclonal antibodies. Fig. 4BCitation displays a significant increase in the level of p53 after {gamma}-irradiation, with the PAb-248 antibody (compare panels of total unfractionated cells, nontreated, and treated fractionated cells, respectively). No significant differences in the levels of the immunoprecipitated p53 in the individual cell fractions were observed. However, when analyzed with the PAb-421 antibody, detected levels of p53 protein seemed to increase from fractions 8 to 12, the G2-M-enriched fractions. These patterns suggest that the increased protein levels of p53 after {gamma}-irradiation are equally distributed in all cell fractions, whereas expression of the PAb-421 epitope seems to be cell cycle specific. In agreement with previous reports, this may suggest that dephosphorylation of residue 376 in the PAb-421 epitope is {gamma}-irradiation dependent (33 , 34) .



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Analysis of p53 protein in cell cycle enriched populations after {gamma}-irradiation. Analysis of p53 levels by Western blotting in nonfractionated 70Z/3 cells at defined time points (0, 0.5, 1, 2, and 3 h) after {gamma}-irradiation using the PAb-248 anti-p53 antibody (A) is shown. p53 protein levels were evaluated by specific immunoprecipitation of [35S]methionine-labeled cell extracts obtained from unfractionated cells (Total), as well as cell cycle-enriched fractions (3–12) {gamma}-irradiated (treated) and nontreated, using the PAb-248 or PAb-421 anti-p53 monoclonal antibodies (B). Arrow on the left, position of the p53 protein. M, molecular size marker.

 
Stabilization of the p53 protein after genotoxic stress is usually associated with protein activity. Therefore, we measured the specific DNA binding activity of p53 in cells subjected to 400R {gamma}-irradiation, at different cell cycle phases. For this, nuclear extracts were prepared from enriched fractions 2 h after {gamma}-irradiation and were analyzed by the EMSA, using a radiolabeled oligonucleotide containing the p53 consensus sequence and the PAb-421 monoclonal antibody (31) . Fig. 5Citation shows that {gamma}-irradiation enhanced the sequence-specific p53 DNA binding activity (Fig. 5, ACitation and B, compare lanes of total). Comparison of the various treated and nontreated cell fractions indicated an increase in the p53 DNA binding activity in enriched fractions from the mid S-phase (fractions 7–8) that was further enhanced in the G2-M-enriched fractions. This coincides with the appearance of the PAb-421 epitope of p53 in the G2-M phase after {gamma}-irradiation.



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Analysis of the specific DNA binding activity of p53 in the elutriated fractions. Nuclear extracts obtained from {gamma}-irradiated and nontreated cells after elutriation were analyzed for specific DNA binding activity of p53 using EMSA, as described in "Materials and Methods." Lower left arrow, p53-DNA complex; upper left arrow, p53-DNA-PAb-421 complex. Control of DNA binding activity mediated by baculovirus-expressed, wild-type p53 is presented in the two extreme left lanes; -, no antibody; +, in the presence of PAb-421 antibodies.

 
In all, these results show that the protein level of p53 induced by {gamma}-irradiation is cell cycle independent, whereas the activation of p53 and its specific DNA binding activity are cell cycle phase specific. Furthermore, it can be said that the activation of p53 is at the posttranslational level and independent of p53 stabilization.

Induction of Cell Growth Arrest and Apoptosis in {gamma}-irradiated Cell Populations Obtained by Centrifugal Elutriation.
To get better insight into the relationship between p53 and cellular responses to genotoxic stress, it was important to examine other known p53 processes. In the following experiments, we measured cell growth arrest and induction of apoptosis in cell cycle-enriched populations after {gamma}-irradiation. Equal numbers of {gamma}-irradiated as well as nontreated cells were fractionated, as described above, and the individual enriched cell populations were cultured at 37°C. Twenty-four h later, cells were stained with PI and analyzed for cell cycle patterns by FACS. The typical cell cycle patterns that were obtained are shown in Fig. 6Citation . All cell fractions from nontreated cells exhibited normal patterns of progression as a synchronized population (Fig. 6A)Citation . Fractions 3–5, which were enriched for G0-G1 phase progressed to the S-phase, fractions 6–8 enriched for the S-phase progressed toward the G2-M phase, and fractions 10–12, which were enriched for G2-M phase, progressed to the G0-G1 phase. Cell fractions obtained after {gamma}-irradiation showed an enhanced growth arrest that was accompanied by apoptosis (Fig. 6B)Citation . Fig. 6CCitation presents a quantitative comparison between the percentage of apoptotic cells obtained in the individually enriched populations of {gamma}-irradiated and nonirradiated cells. Enriched fractions for G0-G1 (3, 4, 5) and for S-phase (6, 7, 8) , which were exposed to {gamma}-irradiation, showed a 5% increase of apoptosis compared with that of the corresponding nontreated cells. Cells enriched for G2-M phase showed a 15–20% increase of apoptosis compared with that of the corresponding nontreated cells. These results suggest that as a response to {gamma}-irradiation, cells are predominantly induced to undergo apoptosis at G2-M (10, 11, 12) . It should be added that similar patterns of exit to apoptosis in the G2-M fractions were evident when cells were elutriated prior to {gamma}-irradiation.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Cell growth arrest and apoptosis in {gamma}-irradiated cell populations obtained by centrifugal elutriation. Equal numbers of {gamma}-irradiated as well as nontreated cells were fractionated, as mentioned above, and the individual cell fractions were cultured at 37°C. Twenty-four h later, cells were stained with PI and analyzed for cell cycle patterns by FACS. A and B, the cell number and the cell cycle phase of the individual enriched cell fractions obtained from the nontreated cells and from the {gamma}-irradiated (treated) cells, respectively. The percentage of apoptotic cells of nontreated ({square}) and of {gamma}-irradiated ({blacksquare}) cell fractions is shown in panel C. Columns are the average of two separate elutriations; bars, SD.

 
In all, it seems that the induction of apoptosis predominantly correlates with fractions exhibiting enhanced p53 DNA binding activity, which suggests that the measured apoptosis is mainly p53 dependent. Furthermore, the observation that G2-M-enriched fractions display a reduction in the BER activity and yet an increase in apoptosis suggests that these two pathways are mutually exclusive.

Measurements of BER Activity and Apoptosis after Wild-Type p53 Inactivation by Mutant p53 Expression.
To further study the association between p53 and the BER and apoptotic patterns during the cell cycle and their alterations after genotoxic stress, we analyzed cells that inactivate wild-type p53. For this purpose, we used 70Z/3 cells stably transfected with mutant p53, which inactivates wild-type p53 (clone 70Z/3-M8; Ref. 26 ). We compared BER activity in unfractionated 70Z/3 parental cells and in mutant p53-expressing cells (clone 70Z/3-M8), with no treatment and after {gamma}-irradiation. As seen in Fig. 7Citation , inactivation of p53 by mutant p53 in nontreated cells caused more than a 2.5-fold reduction in BER activity. This is in agreement with our previous results that showed in an in vitro assay that BER activity is, at least in part, p53 dependent (11) . Exposure of these clones to 400R seems to reduce BER activity in the parental 70Z/3 cells (Fig. 7)Citation . However, expression of mutant p53 seems to exert an enhanced BER activity after {gamma}-irradiation. The latter BER activity measured is most likely p53 independent.



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Analysis of BER activity in cell lines harboring the wild-type p53 and the mutant p53 after {gamma}-irradiation. 70Z/3 parental cells and the 70Z-M8-derived clone expressing mutant p53 were exposed to {gamma}-irradiation (treated) or were left untreated. Nuclear extracts were analyzed for BER activity as described in "Materials and Methods." Duplicate samples of linearized AP+ and AP- plasmids from the various reactions were separated by gel electrophoresis and exposed to UV (A) or analyzed for radioactivity by phosphorimaging (B). DNA repair synthesis (PLS) was quantified as described in "Materials and Methods" (C).

 
Next, BER activity was measured in nontreated and treated fractionated mutant p53-expressing 70Z/3-M8 cells (Fig. 8, ACitation and B, respectively). Interestingly, similar patterns were obtained for the {gamma}-irradiated and nontreated 70Z/3-M8 cells, which consist of two peaks in the G0-G1 and G2-M phases. This pattern resembles that observed for the 70Z/3 parental nontreated cells (see Fig. 2CCitation ), aside for the G0-G1- and G2-M-associated peaks, which are lower for the 70Z/3-M8 cells. In addition, in the 70Z/3-M8 cells, {gamma}-irradiation did not induce a reduction of the G2-M-associated peak of BER activity (Fig. 8B)Citation , as seen with the {gamma}-irradiated parental 70Z/3 cells (see Fig. 3CCitation ). Also, an increase in the G0-G1-associated peak of BER activity observed in the {gamma}-irradiated parental 70Z/3 cells was not found in the 70Z/3-M8 mutant-expressing cells. This suggests that the increase in the G0-G1-associated BER activity after {gamma}-irradiation and the attenuation of the G2-M-associated BER activity is p53 dependent.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Modulations in the pattern of BER activity and apoptosis after mutant p53 expression. 70Z/3 parental cells and the 70Z-M8-derived clone expressing mutant p53 were exposed to {gamma}-irradiation (+) or were left untreated (-) and fractionated by elutriation. Nuclear extracts were analyzed for BER activity as described in "Materials and Methods." DNA repair synthesis (PLS) in the nontreated mutant p53-expressing elutriated fractions (70Z/3-M8) is presented in A. Columns are the average of two separate elutriations; bars, SD. Each measurement was done in duplicates. DNA repair synthesis (PLS) in the mutant p53-expressing elutriated fractions (70Z/3-M8) after {gamma}-irradiation is presented in B. C, apoptosis percentage in each of the respective nontreated ({square}) and {gamma}-irradiated ({blacksquare}) cell fractions analyzed. Columns are the average of two separate elutriations; bars, SD.

 
To further study the role of p53 in BER activity during the cell cycle, we used a p53 null, L12-derived cell line that expresses the ts p53 mutant plasmid, LTR-p53-ts. Fig. 9ACitation depicts the p53 protein levels in the L12p53ts clone, as evaluated by Western blot analysis, using the PAb-248 anti-p53 monoclonal antibody. The L12p53ts producer clone and the L12 p53 null cell line were exposed to 400R and grown for 24 h in 32°C to permit the expression of wild-type p53 conformation in the L12p53ts cell line. Fig. 9BCitation presents the BER activity levels in enriched G0-G1 and G2-M populations, in the p53-expressing and nonexpressing cell lines, after genotoxic stress. In the G0-G1-enriched population, an increment of 1.3-fold in the BER activity after the expression of wild-type p53 was observed, whereas in the G2-M-enriched population, a reduction of 2-fold in BER activity after p53 expression was evident. These results suggest a direct effect of p53 on the cell cycle-dependent BER activity after {gamma}-irradiation.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. Modulations in the pattern of BER activity after expression of p53TS mutant. p53 protein levels were measured in the L12 parental p53 null cell line, as a negative control, and in the L12tsp53-derived clone expressing the p53TS mutant protein, using Western blot analysis, and compared with the p53 protein marker (M; panel A). L12 cells ({square}) and L12tsp53 cells ({blacksquare}) were exposed to 400R, fractionated by centrifugal elutriation, and grown for 24 h at 32°C. The nuclear extracts from the G0-G1-enriched populations (fractions 3–5) and the G2-M-enriched populations (fractions 8–12) were analyzed for BER activity at 32°C (B), as described in "Materials and Methods." In addition, BER activity was measured in L12tsp53 cells exposed to 400R, fractionated by centrifugal elutriation, and grown for 24 h at 37°C (mutant p53 form; C) or at 32°C (wild-type p53 form; D). Columns are the average of two separate elutriations; bars, SD. Each measurement was done in duplicates.

 
Additional support was provided by comparing the BER activity of the L12p53ts clone expressing the wild-type conformation of p53 to that expressing the mutant p53 conformation, in response to {gamma}-irradiation. To this end, the L12p53ts clone was exposed to 400R, and cells were grown for 24 h in either 32°C to permit expression of the wild-type p53 conformation or 37°C to permit expression of the mutant p53 conformation. Cells were fractionated by centrifugal elutriation, nuclear extracts were prepared, and BER activity was measured. Fig. 9, CCitation and D, present the patterns of BER activity obtained. The two BER-specific peaks were evident in cell extracts expressing the mutant p53 grown at 37°C (Fig. 9C)Citation . However, cells grown at 32°C expressing the wild-type p53 protein seemed to express a facilitated G0-G1-associated BER activity and exhibited a significant reduction in the G2-M-associated BER activity (Fig. 9D)Citation . These results are in agreement with the conclusion that p53 expression modulates the pattern of BER activity along the cell cycle. The findings with 70Z/3, 70Z/3-M8, L12p53ts, and L12 substantiate the involvement of p53 in BER and exclude the possibility that this phenomenon is cell type specific.

Finally, we examined the effect of p53 inactivation on {gamma}-irradiation-induced apoptosis throughout the cell cycle. Enriched 70Z/3-M8 cell fractions subjected to {gamma}-irradiation and nontreated controls were cultured for 24 h and stained with PI. Fig. 8CCitation presents the percentage of apoptosis obtained for the treated and nontreated 70Z/3-M8enriched fractions. In all cell cycle phases, up to a 2–3-fold increase in apoptosis was evident after {gamma}-irradiation. However, a further increase of 4–5-fold in apoptosis, as observed for the parental 70Z/3 cells in the G2-M phase (see Fig. 6CCitation ), was not observed for the 70Z/3-M8 cells.

These results are in agreement with the concept that mutant p53 acts through a dominant-negative mechanism, by which it interferes with the wild-type p53 activity. Moreover, it may be said that the induction of G2-M-associated apoptosis after {gamma}-irradiation is p53 dependent.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Major genomic surveillance mechanisms regulated in response to DNA damage exist at the G1-S and G2-M checkpoints. Defects in these mechanisms may result in a "mutator phenotype" that is associated with tumorigenesis (35) . Cells developed multiple DNA repair pathways to protect themselves from different types of DNA damage. It appears that DNA repair varies throughout the cell cycle. Early studies have already shown that unscheduled DNA synthesis may occur at different phases of the cell cycle after UV irradiation. Low levels of repair were evident in G1 cells, in mixed G2-S and M-enriched cells, and in asynchronous cells (36) . Likewise, exposure of human fibroblasts to UV induced an endonuclease-associated DNA repair activity, which was found to be very low in mitosis with no major variations in incision activity in the remaining phases of the cell cycle (37 , 38) .

It is well accepted that p53 plays a pivotal role in the maintenance of genomic stability. p53 is involved in the G0-G1 checkpoint and has also been shown to control G2-M-associated DNA repair activities (reviewed in Ref. 7 ). p53 is believed to function as part of a stress-response pathway, which determines the fate of cells. The options include cell survival, which consists of cell cycle delay accompanied by repair of DNA damage (10 , 19 , 39) , cell suicide through apoptosis (6 , 40) , or permanent cell cycle arrest terminated by necrosis or cellular differentiation (41) .

Exogenous and endogenous signals, after DNA clastogenic/mutagenic events (42) , which include {gamma}-irradiation (2 , 3) , UV irradiation (43, 44, 45) , various chemical exposures (46 , 47) , oxidative stress (48 , 49) , and metabolite deprivation, are among the DNA-damaging agents that would elicit a p53-dependent stress response. The best characterized DNA damage signaling pathway that activates p53, not including UV irradiation, consists of selective phosphorylation of the p53 protein by the ATM kinase (33 , 50, 51, 52) . This is confirmed by the finding that the p53-dependent response to all known DNA-damaging agents, except for UV, is severely impaired in ataxia telangiectasia patients and in atm knockout mice (53, 54, 55) .

The apparent connection between the DNA repair machinery and p53 expression, and their association with the cell cycle checkpoints, prompted us to further investigate the possible cross-talk between these pathways. In our study, we focused on BER activity, a DNA repair system that acts continuously on both spontaneously and externally induced DNA damage caused by hydrolysis, oxygen-free radicals, simple alkylating agents (56 , 57) , and {gamma}-irradiation. We chose {gamma}-irradiation as the inducer of BER activity (58 , 59) . It should be noted that we obtained similar results using cisplatin as a DNA-damaging agent (data not shown). Interestingly, the base damage induced by {gamma}-irradiation was found to be recognized by poly(ADP-ribose) polymerase, which in turn converts the DNA interruption into intracellular signals that activate BER or cell death after the G2-M phase (60 , 61) .

We showed previously that wild-type p53 is directly involved in BER activity, by using an in vitro experimental assay. Nuclear extracts with wild-type p53 showed an enhanced BER activity in comparison to nuclear extracts expressing the mutant conformation of p53 (11) . In the present study, we show that p53 in vivo modulates the BER activity pattern after {gamma}-irradiation in a cell cycle-specific manner. Exposure of cells to 400R reduced the overall BER activity, and yet a significant change in its pattern occurred. We found that cells that are not subjected to genotoxic stress exhibit two distinct cell cycle-associated peaks of BER activity, at the G0-G1 and the G2-M phases. Exposure of cells to {gamma}-irradiation was found to alter this pattern of two peaks of BER activity in such a way that BER was enhanced at the G0-G1 checkpoint and attenuated at the G2-M checkpoint. Variations in the pattern of distribution of these activities suggest that BER is used both at the G0-G1 and the G2-M checkpoints to repair spontaneous DNA damage. External genotoxic stress, however, seems to predominantly induce the G0-G1 BER-associated activity and to attenuate the G2-M-associated BER activity. Interestingly, under the same conditions, cells at the G2-M phase were alternatively induced to undergo apoptosis. It appears that DNA-damaged cells entering the G0-G1 checkpoint are preferentially repaired by the BER machinery rather then sent to apoptosis, whereas cells in the G2-M checkpoint are preferentially induced to undergo apoptosis. The decision whether to induce DNA repair at a given cell cycle checkpoint may be determined by the amount of damaged DNA accumulated, the availability of the immediate activity of the BER pathway or other repair pathways, or yet by other unknown reasons.

Our presented data suggest that alterations in BER activity after {gamma}-irradiation are p53 dependent. In two different mutant p53-expressing clones, the accelerated G0-G1-associated BER activity and the reduced G2-M-associated activity observed in wild-type p53-expressing cells after {gamma}-irradiation were not found. The levels of the two typical peaks of BER activity in the mutant p53 clones were also lower than in the wild-type p53-expressing cells, after genotoxic stress. Furthermore, the mutant p53 cells, 70Z/3-M8, were blocked to undergo G2-M-associated apoptosis. Inactivation of the p53-dependent BER activity in these cells is probably mediated by a dominant-negative mechanism induced by mutant p53.

The observation that mutant p53 expresser cells seem to exhibit a higher BER activity, in response to genotoxic stress, as opposed to the parental wild-type p53 clone, is in agreement with our previous observations (11) . We speculate that in the normal life course of the cell, BER activity, which at least in part is p53 dependent, serves as a DNA repair machinery that treats endogenous DNA aberrations accumulated during cell replication and differentiation. However, after external genotoxic stress, we suggest that cells acquire an additional regulatory security mechanism to assure genomic stability, and that this mechanism is p53 dependent. Thus, in addition to a direct role of p53 in the "housekeeping" BER activity (11) , we show that p53 has an additional role in response to genotoxic stress as a modulator of the BER activity throughout the cell cycle.

Analysis of wild-type p53 expression along the cell cycle after {gamma}-irradiation indicated enhanced levels of the stabilized p53 protein that were equally distributed throughout the cell cycle. However, both the dephosphorylated form of p53 at residue 376 and the specific p53 DNA binding activity, which presumably represents initial steps associated with its transcriptional activity, seemed to appear as cells progress toward the G2-M phase. The {gamma}-irradiated induced p53 DNA binding activity also coincides with the p53-dependent apoptosis. The observation that the stabilization of p53 protein and its functional activation show different patterns along the cell cycle suggests that these are two distinguished and defined steps in the process of activation of the p53 protein.

To conclude, it appears that after genotoxic stress, stabilized p53 induces, at the G0-G1 checkpoint, BER activity that is independent of its transcriptional activity. This is further supported by our recent observation that a p53 transcription-deficient mutant functions as wild-type p53 when analyzed for BER activity.4 At the G2-M phase, p53 plays a central regulatory role in attenuating BER activity and alternatively signaling a G2-M-associated apoptosis. The latter probably depends on its transcriptional activity. The decision of whether cells exposed to genotoxic stress should repair their damaged DNA through BER activity or undergo apoptosis is a cell cycle phase-specific event that seems to be controlled by the wild-type p53 protein. This may be applied to anticancer therapy, by causing cancerous cells to accumulate in the G2-M phase before treatment with genotoxic stress.


    ACKNOWLEDGMENTS
 
We thank Drs. Curtis C. Harris and Lorne Hofseth for fruitful comments and criticism and Mary McMenamin (National Cancer Institute-NIH) and Vivien Laufer (Weizmann Institute of Science) for editing the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by grants from the Israel-USA Binational Science Foundation and the German Israeli Foundation for Scientific Research and Development and the Israel Cancer Research Fund. V. R. is the incumbent of the Norman and Helen Asher Professorial Chair in Cancer Research at the Weizmann Institute. Back

2 To whom requests for reprints should be addressed, at Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot 76100, Israel. Phone: 972-8-9344501; Fax: 972-8-9465265; E-mail: varda.rotter{at}weizmann.ac.il Back

3 The abbreviations used are: BER, base excision repair; ts, temperature sensitive; FACS, fluorescence-activated cell sorter; PI, propidium iodide; AP, apurinic; EMS, electrophoretic mobility shift assay. Back

4 H. Offer, M. Milyavsky, N. Erez, and V. Rotter. p53 involvement in BER does not require its transcriptional activity, submitted for publication. Back

Received 5/10/00. Accepted 10/26/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. White E. Life, death, and the pursuit of apoptosis. Genes Dev., 10: 1-15, 1996.[Free Full Text]
  2. Kastan M. B., Onyekwere O., Sidransky D., Vogelstein B., Craig R. W. Participation of p53 protein in the cellular response to DNA damage. Cancer Res., 51: 6304-6311, 1991.[Abstract/Free Full Text]
  3. Kuerbitz S. J., Plunkett B. S., Walsh W. V., Kastan M. B. Wild-type p53 is a cell cycle checkpoint determinant following irradiation. Proc. Natl. Acad. Sci. USA, 89: 7491-7495, 1992.[Abstract/Free Full Text]
  4. Lane D. P. p53, guardian of the genome. Nature (Lond.)., 358: 15-16, 1992.[Medline]
  5. Livingstone L. R., White A., Sprouse J., Livanos E., Jacks T., Tlsty T. D. Altered cell cycle arrest and gene amplification potential accompany loss of wild-type p53. Cell, 70: 923-935, 1992.[Medline]
  6. Gottlieb T. M., Oren M. p53 and apoptosis. Semin. Cancer Biol., 8: 359-368, 1998.[Medline]
  7. Schwartz D., Rotter V. p53-dependent cell cycle control: response to genotoxic stress. Semin. Cancer Biol., 8: 325-336, 1998.[Medline]
  8. Wang X. W., Yeh H., Schaeffer L., Roy R., Moncolli V., Egly J-M., Wang Z., Friedberg E. C., Evans M. K., Taffe B. G., Bohr V. A., Weeda G., Hoeijmakers J. H. J., Forrester K., Harris C. C. p53 modulation of TFIIH-associated nucleotide excision repair activity. Nat. Genet., 10: 188-195, 1995.[Medline]
  9. Ford J. M., Hanawalt P. C. Expression of wild-type p53 is required for efficient global genomic nucleotide excision repair in UV-irradiated human fibroblasts. J. Biol. Chem., 272: 28073-28080, 1997.[Abstract/Free Full Text]
  10. Janus F., Albrechtsen N., Dornreiter I., Wiesmuller L., Grosse F., Deppert W. The dual role model for p53 in maintaining genomic integrity. Cell Mol Life Sci., 55: 12-27, 1999.[Medline]
  11. Offer H., Wolkowicz R., Matas D., Blumenstein S., Livneh Z., Rotter V. Direct involvement of p53 in the base excision repair pathway of the DNA repair machinery. FEBS Lett., 450: 197-204, 1999.[Medline]
  12. Lee S., Elenbaas B., Levine A., Griffith J. p53 and its 14 kDa C-terminal domain recognize primary DNA damage in the form of insertion/deletion mismatches. Cell, 81: 1013-1020, 1995.[Medline]
  13. Jayaraman L., Prives C. Activation of p53 sequence-specific DNA binding by short single strands of DNA requires the p53 C-terminus. Cell, 81: 1021-1029, 1995.[Medline]
  14. Reed M., Woelker B., Wang P., Wang Y., Anderson M. E., Tegtmeyer P. The C-terminal domain of p53 recognizes DNA damaged by ionizing radiation. Proc. Natl. Acad. Sci. USA, 92: 9455-9459, 1995.[Abstract/Free Full Text]
  15. O’Connor P. M. Mammalian G1 and G2 phase checkpoints. Cancer Surv., 29: 151-182, 1997.[Medline]
  16. Teyssier F., Bay J. O., Dionet C., Verrelle P. Cell cycle regulation after exposure to ionizing radiation. Bull. Cancer, 86: 345-357, 1999.[Medline]
  17. Stewart N., Hicks G. G., Paraskevas F., Mowat M. Evidence for a second cell cycle block at G2/M by p53. Oncogene, 10: 109-115, 1994.
  18. Hong J. H., Gatti R. A., Huo Y. K., Chiang C. S., McBride W. H. G2/M-phase arrest and release in ataxia-telangiectasia and normal cells after exposure to ionising radiation. Radiat. Res., 140: 17-23, 1994.[Medline]
  19. Kaufmann W. K., Levedakou E. N., Grady H. L., Paules R. S., Stein G. H. Attenuation of G2 checkpoint function precedes human cell immortalization. Cancer Res., 55: 7-11, 1995.[Abstract/Free Full Text]
  20. Schwartz D., Almog N., Peled A., Goldfinger N., Rotter V. Role of wild type p53 in the G2 phase: regulation of the {gamma}-irradiation-induced delay and DNA repair. Oncogene, 15: 2597-2607, 1997.[Medline]
  21. Bunz F., Dutriaux A., Lengauer C., Waldman T., Zhou S., Brown J. P., Sedivy J. M., Kinzler K. W., Vogelstein B. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science (Washington DC), 282: 1497-1501, 1998.[Abstract/Free Full Text]
  22. Aloni-Grinstein R., Schwartz D., Rotter V. Accumulation of wild type p53 protein upon {gamma}-irradiation induces a G2-dependent immunoglobulin {kappa} light chain gene expression. EMBO J., 14: 1392-1401, 1995.[Medline]
  23. Wolf D., Harris N., Rotter V. Reconstitution of p53 expression in a non-producer Ab-MuLV-transformed cell line by transfection of a functional p53 gene. Cell, 38: 119-126, 1984.[Medline]
  24. Michalovitz D., Halevy O., Oren M. Conditional inhibition of transformation and of cell proliferation by a temperature-sensitive mutant of p53. Cell, 62: 671-680, 1990.[Medline]
  25. Paige C. J., Kincade P. W., Ralph P. Murine B cell leukemia line inducible surface immunoglobulin expression. J. Immunol., 121: 641-647, 1978.[Abstract/Free Full Text]
  26. Aloni-Grinstein R., Zan-Bar I., Alboum I., Goldfinger N., Rotter V. Wild type p53 functions as a control protein in the differentiation pathway of the B-cell lineage. Oncogene, 8: 3297-3305, 1993.[Medline]
  27. Banfalvi G., Mikhailova M., Poirier L. A., Chou M. W. Multiple subphases of DNA replication in Chinese hamster ovary (CHO-K1) cells. DNA Cell Biol., 16: 1493-1498, 1997.[Medline]
  28. Hunger H. D., Schmidt G., Flachmeier C. Quantitative Western blotting using [{gamma}-33P]ATP and the ultrasensitive bio-imaging analyzer. Anal. Biochem., 217: 98-102, 1994.[Medline]
  29. Harlow E., Crawford L. V., Pim D. C., Williamson N. M. Monoclonal antibodies specific for simian virus 40 tumor antigen. J. Virol., 39: 861-869, 1981.[Abstract/Free Full Text]
  30. Gannon J. V., Greaves R., Iggo R., Lane D. P. Activating mutations in p53 produce a common conformational effect. A monoclonal antibody specific for the mutant form. EMBO J., 9: 1595-1602, 1990.[Medline]
  31. Wolkowicz R., Elkind N. B., Ronen D., Rotter V. The DNA binding activity of wild type p53 is modulated by blocking its various antigenic epitopes. Oncogene, 10: 1167-1174, 1995.[Medline]
  32. El-Deiry W., Kern S. E., Pietenpol J. A., Kinzler K. W., Vogelstein B. Definition of a consensus binding site for p53. Nat. Genet., 1: 45-49, 1992.[Medline]
  33. Waterman M. J. F., Stavridi E. S., Waterman J. L. F., Halazonetis T. D. ATM-dependent activation of p53 involves dephosphorylation and association with 14-4-3 proteins. Nat. Genet., 19: 175-178, 1998.[Medline]
  34. Delphin C., Baudier J. The protein kinase C activator, phorbol ester, cooperates with the wild-type p53 species of Ras-transformed embryo fibroblasts growth arrest. J. Biol. Chem., 269: 29579-29587, 1994.[Abstract/Free Full Text]
  35. Loeb L. A. Microsatellite instability: marker of a mutator phenotype in cancer. Cancer Res., 54: 5059-5063, 1994.[Free Full Text]
  36. Giulotto E., Mottura A., De Carli L., Nuzzo F. DNA repair in UV-irradiated heteroploid cells at different phases of the cell cycle. Exp. Cell Res., 113: 415-420, 1978.[Medline]
  37. Kaufmann W. K., Wilson S. J. DNA repair endonuclease activity during synchronous growth of diploid human fibroblasts. Mutat. Res., 236: 107-117, 1990.[Medline]
  38. Petersen L. N., Orren D. K., Bohr V. A. Gene-specific and strand-specific DNA repair in the G1 and G2 phases of the cell cycle. Mol. Cell. Biol., 15: 3731-3737, 1995.[Abstract]
  39. Bates S., Vousden K. H. p53 in signaling checkpoint arrest or apoptosis. Curr. Opin. Genet. Dev., 6: 12-19, 1996.[Medline]
  40. Levine J. A. p53, the cellular gatekeeper for growth and division. Cell, 88: 323-331, 1997.[Medline]
  41. Almog N., Rotter V. Involvement of p53 in cell differentiation and development. Biochim. Biophys. Acta, 1333: F1-F27, 1997.[Medline]
  42. Nelson W. G., Kastan M. B. DNA strand breaks-the DNA template alteration that triggers p53 dependent DNA damage response pathways. Mol. Cell. Biol., 14: 1815-1823, 1994.[Abstract/Free Full Text]
  43. Hall P. A., McKee P. H., Menage H. D., Dover R., Lane D. P. High levels of p53 protein in UV-irradiated normal human skin. Oncogene, 8: 203-207, 1993.[Medline]
  44. Lu X., Lane D. P. Differential induction of transcriptionally active p53 following UV or ionizing irradiation: defects in chromosome instability syndromes?. Cell, 75: 765-778, 1993.[Medline]
  45. Yamaizumi M., Sugano T. UV-induced nuclear accumulation of p53 is evoked through DNA damage of actively transcribed genes independent of the cell cycle. Oncogene, 9: 2775-2784, 1994.[Medline]
  46. Zhan Q., Carrier F., Fornace A. J. Induction of cellular p53 activity by DNA-damaging agents and growth arrest. Mol. Cell. Biol., 13: 4242-4250, 1993.[Abstract/Free Full Text]
  47. Tishler R. B., Calderwood S. K., Coleman C. N., Price B. D. Increases in sequence specific DNA binding by p53 following treatment with chemotherapeutic and DNA damaging agents. Cancer Res., 53: 2212-2216, 1993.[Abstract/Free Full Text]
  48. An W. G., Kanekal M., Simon M. C., Maltepe E., Blagosklony M. V., Neckers L. M. Stabilization of wild-type p53 by hypoxia-inducible factor 1{alpha}. Nature (Lond.), 392: 405-408, 1998.[Medline]
  49. Graeber T., Osmanian C., Jacks T., Housman D., Koch C., Lowe S. W., Giaccia A. J. Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumours. Nature (Lond.), 379: 88-91, 1996.[Medline]
  50. Barlow C., Liyanage M., Moens P. B., Deng C-X., Ried T., Wynshaw-Boris A. Partial rescue of the prophase I defects of Atm-deficient mice by p53 and p21 null alleles. Nat. Genet., 17: 462-466, 1997.[Medline]
  51. Banin S., Moyal L., Shieh S., Taya Y., Anderson C. W., Chessa L., Smorodinsky N. I., Prives C., Reiss Y., Shiloh Y., Ziv Y. Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science (Washington DC), 281: 1674-1677, 1998.[Abstract/Free Full Text]
  52. Nakagawa K., Taya Y., Tamai K., Yamaizumi M. Requirement of ATM in phosphorylation of the human p53 protein at serine 15 following DNA double-strand breaks. Mol. Cell. Biol., 19: 2828-2834, 1999.[Abstract/Free Full Text]
  53. Enoch T., Norbury C. Cellular responses to DNA damage: cell-cycle checkpoints, apoptosis and the roles of p53 and ATM. Trends Biochem. Sci., 20: 426-434, 1995.[Medline]
  54. Barlow C., Hirotsune S., Paylor R., Liyanage M., Eckhaus M., Collins F., Shiloh Y., Crawley N. J., Ried T., Tagle D., Wynshaw-Boris A. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell, 86: 159-171, 1996.[Medline]
  55. Xu Y., Baltimore D. Dual roles of ATM in the cellular response to radiation and in cell growth control. Genes Dev., 10: 2401-2410, 1996.[Abstract/Free Full Text]
  56. Lindahl T. Instability and decay of the primary structure of DNA. Nature (Lond.), 362: 709-715, 1993.[Medline]
  57. Seeberg E., Eide L., Bjoras M. The base excision repair pathway. Trends Biochem. Sci., 20: 391-397, 1995.[Medline]
  58. Moran M. F., Ebisuzaki K. Base excision repair of DNA in {gamma}-irradiated human cells. Carcinogenesis (Lond.)., 8: 607-609, 1987.[Abstract/Free Full Text]
  59. Talpaert-Borle M. Formation, detection and repair of AP sites. Mutat. Res., 181: 45-56, 1987.[Medline]
  60. Wang Z. Q., Auer B., Stingl L., Berghammer H., Haidacher D., Schweiger M., Wagner E. F. Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev., 9: 509-520, 1995.[Abstract/Free Full Text]
  61. Dantzer F., Schreiber V., Niedergang C., Trucco C., Flatter E., De La Rubia G., Oliver J., Rolli V., Menissier-de Murcia J., de Murcia G. Involvement of poly(ADP-ribose) polymerase in base excision repair. Biochimie, 81: 69-75, 1999.[Medline]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
S. M. K. Pulukuri, J. A. Knost, N. Estes, and J. S. Rao
Small Interfering RNA-Directed Knockdown of Uracil DNA Glycosylase Induces Apoptosis and Sensitizes Human Prostate Cancer Cells to Genotoxic Stress
Mol. Cancer Res., August 1, 2009; 7(8): 1285 - 1293.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
S. N. Kassam and A. J. Rainbow
UV-inducible base excision repair of oxidative damaged DNA in human cells
Mutagenesis, January 1, 2009; 24(1): 75 - 83.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Menendez, A. Inga, and M. A. Resnick
The Biological Impact of the Human Master Regulator p53 Can Be Altered by Mutations That Change the Spectrum and Expression of Its Target Genes.
Mol. Cell. Biol., March 1, 2006; 26(6): 2297 - 2308.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Wu, J. A. Roth, H. Zhao, S. Luo, Y.-L. Zheng, S. Chiang, and M. R. Spitz
Cell Cycle Checkpoints, DNA Damage/Repair, and Lung Cancer Risk
Cancer Res., January 1, 2005; 65(1): 349 - 357.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Sugo, N. Niimi, Y. Aratani, K. Takiguchi-Hayashi, and H. Koyama
p53 Deficiency Rescues Neuronal Apoptosis but Not Differentiation in DNA Polymerase {beta}-Deficient Mice
Mol. Cell. Biol., November 1, 2004; 24(21): 9470 - 9477.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
I. Zurer, L. J. Hofseth, Y. Cohen, M. Xu-Welliver, S. P. Hussain, C. C. Harris, and V. Rotter
The role of p53 in base excision repair following genotoxic stress
Carcinogenesis, January 1, 2004; 25(1): 11 - 19.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. L. Scott, J. D. Earle, and P. H. Gumerlock
Functional p53 Increases Prostate Cancer Cell Survival After Exposure to Fractionated Doses of Ionizing Radiation
Cancer Res., November 1, 2003; 63(21): 7190 - 7196.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
N. K. Sah, A. Munshi, T. Nishikawa, T. Mukhopadhyay, J. A. Roth, and R. E. Meyn
Adenovirus-mediated wild-type p53 radiosensitizes human tumor cells by suppressing DNA repair capacity
Mol. Cancer Ther., November 1, 2003; 2(11): 1223 - 1231.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. R. Lloyd and P. C. Hanawalt
p53 Controls Global Nucleotide Excision Repair of Low Levels of Structurally Diverse Benzo(g)chrysene-DNA Adducts in Human Fibroblasts
Cancer Res., September 15, 2002; 62(18): 5288 - 5294.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. Liu, Y. Nakatsuru, and S. L. Gerson
Base Excision Repair as a Therapeutic Target in Colon Cancer
Clin. Cancer Res., September 1, 2002; 8(9): 2985 - 2991.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
H. Offer, N. Erez, I. Zurer, X. Tang, M. Milyavsky, N. Goldfinger, and V. Rotter
The onset of p53-dependent DNA repair or apoptosis is determined by the level of accumulated damaged DNA
Carcinogenesis, June 1, 2002; 23(6): 1025 - 1032.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
M. L. Smith and Y. R. Seo
p53 regulation of DNA excision repair pathways
Mutagenesis, March 1, 2002; 17(2): 149 - 156.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. M. d. M. C. Gontijo, F. N. Elias, D. M. F. Salvadori, M. L. C. S. de Oliveira, L. A. Correa, J. Goldberg, J. C. d. S. Trindade, and J. L. V. de Camargo
Single-Cell Gel (Comet) Assay Detects Primary DNA Damage in Nonneoplastic Urothelial Cells of Smokers and Ex-smokers
Cancer Epidemiol. Biomarkers Prev., September 1, 2001; 10(9): 987 - 993.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
G. Frosina
Counteracting spontaneous transformation via overexpression of rate-limiting DNA base excision repair enzymes
Carcinogenesis, September 1, 2001; 22(9): 1335 - 1341.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Offer, H.
Right arrow Articles by Rotter, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Offer, H.
Right arrow Articles by Rotter, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online