Cancer Research Meeting Calendar  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horiguchi, M.
Right arrow Articles by Nohmi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horiguchi, M.
Right arrow Articles by Nohmi, T.
[Cancer Research 61, 3913-3918, May 15, 2001]
© 2001 American Association for Cancer Research


Carcinogenesis

Molecular Nature of Ultraviolet B Light-induced Deletions in the Murine Epidermis1

Mieko Horiguchi2, Ken-ichi Masumura, Hironobu Ikehata, Tetsuya Ono, Yusuke Kanke2 and Takehiko Nohmi3

Division of Genetics and Mutagenesis, National Institute of Health Sciences, Tokyo 158-8501 [M. H., K. M., T. N.]; Division of Bioregulation Studies, Tokyo University of Agriculture, Tokyo 156-8502 [M. H., Y. K.]; and Department of Cell Biology, Tohoku University Graduate School of Medicine, Sendai 980-8575 [H. I., T. O.], Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Depletion of the stratospheric ozone layer leads to an increase in ambient UV loads, which are expected to raise skin cancer incidences. Tumor development in the skin could be a multistep process in which various genetic alterations, such as point mutations and deletions, occur successively. Here, we demonstrate that UVB irradiation efficiently induces deletions in the epidermis using a novel transgenic mouse, gpt delta. In this mouse model, deletions in {lambda} DNA integrated in the chromosome are preferentially selected as Spi- (sensitive to P2 interference) phages, which can then be subjected to molecular analysis. The mice were exposed to UVB at single doses of 0.3, 0.5, 1.0, 1.5, and 2.0 kJ/m2. After 4 weeks, {lambda} phage was rescued from the genomic DNA of the epidermis by in vitro packaging reactions. The mutant frequencies of Spi- with large deletions in the epidermis increased >15-fold at a UVB dose of 0.5 kJ/m2 over the control. Molecular sizes of most of the large deletions were >1000 bp. More than one-half of the large deletions occurred between short direct-repeat sequences from 1 to 6 bp, and the remainder had flush ends. In the unirradiated mouse, almost all of the Spi- mutants were 1-bp frameshifts in runs of identical bases. These results suggest that UVB irradiation induces deletions in the murine epidermis, and most of the deletions are generated through end-joining of double strand breaks in DNA.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
UV light radiation in sunlight is the most prominent and ubiquitous carcinogen in the environment. Excess exposure to solar UV increases the risk of skin cancer, which is by far the most common type of cancer in the United States and Australia. Although all of the detrimental UVC (wavelength 200–280 nm) and most of the UVB (280–320 nm) radiation are efficiently absorbed by the ozone layer, the residual UVB irradiation that reaches the ground is still hazardous to human skin (1 , 2) . Studies on the carcinogenic effects of UVA (320–400 nm) and UVB indicate that UVB is responsible for most of the carcinogenic effects of sun exposure (1) . UVB irradiation will be a more serious environmental threat if the stratospheric ozone layer is more severely depleted. It is predicted that a 1% reduction in the ozone layer would lead to an increase in the incidence of skin cancer by 2–4% (2) .

UVB irradiation induces the formation of CPD4 and pyrimidine-(6,4)-pyrimidone photoproducts in DNA (3) and increases the frequency of base substitutions, i.e., C->T single transitions and CC->TT double transitions, at dipyrimidine sites. The C->T and CC->TT transitions at dipyrimidine sites are predominantly found in the p53 tumor suppressor gene in human skin cancers (4, 5, 6, 7, 8, 9) . The mutations in the H-ras and Ki-ras oncogenes in human skin cancers are also located opposite potential pyrimidine dimer sites (10) , suggesting the importance of UV photoproducts at dipyrimidine sites in skin carcinogenesis. Besides base substitutions, UV irradiation induces deletions and chromosome aberrations in a number of unicellular model organisms, such as Escherichia coli, Saccharomyces cerevisiae, and cultured mammalian cells in vitro (11, 12, 13, 14, 15) . Deletions and chromosome aberrations are often involved in the inactivation of tumor suppressor genes, which normally inhibit cell growth and tumor formation. In fact, it is suggested that deletions of certain regions of chromosomes may play important roles in the development of basal cell carcinoma, squamous cell carcinoma, and cutaneous malignant melanoma in humans (16, 17, 18, 19) . However, it remains an open question whether UVB irradiation actually induces deletions in the skin of rodents or humans, and if so, what the molecular characteristics of the UVB-induced deletions are.

We have previously established a transgenic mouse named gpt delta for the efficient detection of mutations in vivo (20) . A novel feature of this transgenic mutation assay is its ability to detect certain types of deletions by Spi- (sensitive to P2 interference) selection as well as point mutations by 6-thioguanine selection (21 , 22) . The Spi- selection takes advantage of the fact that growth of wild-type {lambda} phage is restricted in P2 lysogens (23) . Only mutant {lambda} phages that are deficient in the functions of both the gam and redBA genes can grow well in P2 lysogens and display the Spi- phenotype. Simultaneous inactivation of both the gam and redBA genes is induced by deletions in the region. Thus, Spi- selection has been used to detect deletion mutations of {lambda} phage generated in Escherichia coli cells (23 , 24) . In the transgenic mice gpt delta, ~80 copies of {lambda} EG10 DNA, which carries the gam and redBA genes, are integrated in each chromosome 17 of C57BL/6J background (21) . The {lambda}EG10 can be rescued from the mouse genome by in vitro packaging reactions, and P2 lysogens are infected with the rescued phages to identify Spi- plaques. Using this system, we detected 5–15-fold increases in the MF of Spi- over the background in the spleen of mice irradiated with {gamma}-radiation and demonstrated that all of the Spi- mutants are indeed deletions in the {lambda}EG10 DNA (20 , 22) .

In previous work, we examined the gpt mutations in the epidermis of UVB-irradiated transgenic mice and demonstrated that most of the gpt mutations are G:C to A:T transitions at dipyrimidine sites (25) . In this study, we examined whether UVB irradiation induces deletions in the murine epidermis by Spi- selection. Strikingly, the MFs of large deletions are increased >15-fold by UVB irradiation at a dose of 0.5 kJ/m2, and most of the deletions exhibit the sequence characteristics that are frequently observed in deletions causing human diseases. The possible implications of UVB-induced deletions in skin carcinogenesis are discussed.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Treatment of Mice.
The methods of UVB irradiation and the extraction of genomic DNA were described previously (25) . In summary, the 14-week-old mice were exposed to UVB at a single dose of 0.3, 0.5, 1.0, 1.5, or 2.0 kJ/m2 (17 J/m2/s, two mice in each group) in UVB tubes with an emission spectrum of 270–590 nm with a peak at 313 nm (FL20 SE; Toshiba, Tokyo, Japan) at 20 cm from the UV source. They were sacrificed 4 weeks later. The unirradiated control mice were age matched. The transgene, {lambda}EG10, was rescued from the genomic DNA of epidermis by in vitro packaging reactions (20) .

Spi- Mutation Assays.
Spi- assays were conducted as described (20 , 22) . E. coli LE392 was infected with the recovered Spi- mutant phages to obtain the phage lysates (26) . The lysates were used as templates for PCR analysis. DNA sequences of primers 1, 2, and 5 used for PCR analysis are described (22) . Other primers used were: primer 12 (5'- CGCGGCCGGTCGAGGGACCTAATAACTTCGTA-3'); primer r101 (5'- GCAATGGAACTGGCTGTTGTTACCGGGCAACG -3'); primer r102 (5'-ATATTACTGCTACAGGGACCCAAGG-3'); primer r201 (5'-GCACTTCCGAGTCACAGGAGAATGGAATGGAGAG-3'); primer r202 (5'-CGCGTCGTCTTCACAGCGATGCCAGAGTCTG-3'); primer r203 (5'-GACGCAGACCTTTTCCATGAATTGG-3'); primer r301 (5'- CCGTAGCGTACTGAAGAAGCACCGCGAAACG-3'); primer r302 (5'-CGCATCCTCACGATAATATCCGGGTAGGCGC-3'); primer r401 (5'-CACACCCTGCTTGCTGAGGTTTGCA-3'); primer r402 (5'-CGCATCCCAAACGGATGTTACGTCATA-3'); primer r403 (5'-ATGAGTACTGCACTCGCAACGCTGGCTGGG-3').

PCR was performed using the LA PCR kit Ver. 2 (Takara, Shiga, Japan). The reaction was initiated by heating for 1 min at 94°C, followed by 29 cycles of 20 s at 98°C and 1 min elongation at 68°C per kbp of the desired PCR fragment. The entire DNA sequence of lambda EG10 is available at http://dgm2alpha.nihs.go.jp. The DNA sequence was determined as described in the analysis of gpt mutants. Sequencing primers (5' end-labeled with Cy5 dye) were: primer sA (5'-CCACTTTTATTGGCGATGAAAAGATGTTTC-3'); primer s201 (5'-CGCTTCGATAACTCTGTTGAATGGCTCT-3'); primer s202 (5'-TGAGTACGGTCATCATCTGACACTACAG-3'); primer s301 (5'-GGTGTGAATCCCATCAGCGTTACCGTTT-3'); primer s302 (5'-AGTGATTGCGCCTACCCGGATATTATCGTG-3'); primer s401 (5'-AGCCACACCGGTGCAAACCTCAGCA-3'); primer s402 (5'-GGCTTTATGACGTAACATCCGTTTGGG-3'); primer s403 (5'-CCATGCCGACACGTTCAGCCAGCTTCCCAG-3').


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
UVB-induced Spi- Mutations in the Skin.
To investigate the mutagenic effects of UVB irradiation in the epidermis, 12 gpt delta-transgenic mice were exposed to increasing doses of UVB (0.3, 0.5, 1.0, 1.5, and 2.0 kJ/m2). The MFs of Spi- increased along with the dose up to 1.0 kJ/m2 and were ~3 times higher than the control level at 0.5 and 1.0 kJ/m2 UVB (Table 1)Citation . The MFs decreased at UVB doses of 1.5 and 2.0 kJ/m2.


View this table:
[in this window]
[in a new window]

 
Table 1 Spi- mutant frequencies recovered from UVB-irradiated and unirradiated gpt delta-transgenic mice

 
Characteristics of the Spi- Mutation Spectra.
To clarify the specificity of UVB-induced mutations, 141 Spi- mutants rescued from the epidermis were subjected to molecular analysis, 130 mutants from irradiated groups and 11 from unirradiated groups. We at first roughly mapped the mutations by PCR analysis and found that the mutants could be classified into two groups: one that produced no amplified products using primers 1 and 2; and another that produced amplified products using the same primers. The former mutants (class 1 and 2 mutants; see below) were further analyzed using other PCR primers, such as primers 5 and 12, to find appropriate sequencing primers for determining the junctions of deletion mutants. The latter mutants (classes 3, 4, and 5) were directly subjected to DNA sequence analysis. We determined the junction sequences of 106 of 130 Spi- mutants from UVB-irradiated mice, and classified them into five classes based on the deletion size and the sequence characteristics of the junction region.

Class 1 includes 23 large deletion mutants that exhibit short homologous sequences (1–6 bp) in their junction regions (Fig. 1)Citation . The deletions vary in size from 956 bp to ~9 kbp. The length of the direct-repeat sequences at the junctions was not related to the size of the deletions. In addition to simple deletions, a complex-type mutation was observed (1.5 kJ/m2 UVB). This mutant has a deletion of 2061 bp but has a 12-bp insertion in the junction. Intriguingly, the 10-bp sequence of the insertion was the same as that in the 5' side of the junction. Class 2 includes eight large deletion mutants that do not exhibit short homology at the junctions (Fig. 1)Citation . These deletions range from 269 bp to ~8 kbp. Four mutants had a 1- or 2-bp insertion at the junction. The junction sequences were CCAA instead of CAA by the insertion of C (0.3 kJ/m2 UVB), TTTTG instead of TTTG by the insertion of T (0.5 kJ/m2 UVB), and GGTATAA instead of GGTTAA by the insertion of A (1.5 kJ/m2 UVB); TGTGTG instead of TGTG by the insertion of TG (1.0 kJ/m2 UVB). These additional bases were the same as or complementary to the 5'-base. Most (28 of 31) of them deleted regions of both the gam and redBA genes. The remainder (3 of 31) deleted a region in the gam gene and upstream.



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Large deletions (class 1 and 2 mutants) recovered from UVB-unirradiated and -irradiated mice and a partial genetic map of the {lambda}EG10 transgene, including gam and redBA target region for Spi- selection. {square} below the map, regions deleted in Spi- mutants. * indicates the deletions occurred entirely within the region of the gam gene and upstream. The other deletions occurred in the region of the gam and redBA genes. a, class 1 includes 24 (at least 19 independent mutants) large deletion mutants that exhibit short homologous sequences (1–6 bp) in their junction regions. The deletions vary from 956 to ~9 kb. Class 2 includes eight large deletion mutants that do not exhibit homology at the junctions. These deletions range from 269 to ~8 kb. Four mutants had a 1- or 2-bp insertion at the junction. b, short homologous sequences in the junctions are highlighted in bold capital letters, and inserted bases are highlighted in underlined bold capitals. Junctions are indicated as the space between left and right sequences. c, the identical mutant was multiplied and recovered from the same mouse: -3979 bp was recovered twice from mouse 3 and five times from mouse 5.

 
Class 3 includes 10 single-base pair deletion mutants that occur in nonrepetitive sequences of the gam gene (Table 2)Citation . Four of 10 mutants have both single-bp deletions and base substitutions in the neighboring base pairs in the gam gene. Five of the remainder have single-bp deletions that occurred beside run sequences. Class 4 includes 50 single-bp deletions that occur in the repetitive sequences in the gam gene. The mutational hot spots in this group were nucleotides 227–231, 238–241, 286–289, and 295–300. Two mutants (0.3 kJ/m2 and 0.5 kJ/m2 UVB) had both single-bp deletions and single-base substitutions within one or four neighboring bps in the gam gene.


View this table:
[in this window]
[in a new window]

 
Table 2 Sequence analysis of Spi- mutants (class 3–5) derived from UVB-irradiated and unirradiated gpt delta mice

 
Besides deletion mutants, 15 mutants had base substitutions but without deletions in the gam gene (Class 5) (Table 2)Citation . About three-fourths (11 of 15) of the base substitutions occurred in run sequences, and 60% (9 of 15) of them created a stop codon. Interestingly, the majority of them could make plaques on recA- mutants of E. coli, whereas all of the other Spi- mutants (class 1 to 4) could not.

In the unirradiated group, 11 mutants were classified into 3 groups as with the irradiated groups. Ninety-one % (10 of 11) of the Spi- mutants yielded PCR products with primers 1 and 2, and these mutants had single-bp deletions in the gam gene (Table 2)Citation . Two of them had 1-bp deletions in nonrun sequences (class 3), and the remaining eight mutants had 1-bp frameshifts in run sequences (class 4). The predominant sequence change of the class 4 mutants was AAAAA->AAAA at nucleotides 227–231. A large deletion of 3979 bp was found in the untreated mice (class 1) (Fig. 1)Citation . This deletion mutation was multiply identified in five irradiated mice as well.

Specific MF of Large Deletions.
To characterize the deletion mutations in more detail, we compared the specific MFs of large deletions, i.e., class 1 and 2 mutants, at each UVB dose (Table 3)Citation . Although the total MFs of the Spi- in UVB-irradiated mice were only 3 times higher than those of the unirradiated at the maximum level (Table 1)Citation , the specific MFs of large deletions were much higher. Remarkably, the specific MF of large deletions at 0.5 kJ/m2 was 17 times higher than that of large deletions in the unirradiated cases. On the other hand, the specific MFs of 1-bp deletions, i.e., class 3 and 4 mutants, were almost unchanged regardless of the UVB doses. These results strongly suggest that the major type of deletion mutations induced by UVB irradiation is large deletions rather than small deletions.


View this table:
[in this window]
[in a new window]

 
Table 3 Spi- mutant frequencies of large deletions (class 1 and 2) and 1-bp deletions (class 3 and 4) recovered from UVB-irradiated and unirradiated gpt delta mice

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we investigated UVB-induced deletions in the skin of gpt delta mice using Spi- selection. Mice were exposed to UVB irradiation at single doses of 0.3, 0.5, 1.0, 1.5, and 2.0 kJ/m2. At 4 weeks after irradiation, the total MF of Spi- in the epidermis was determined (Table 1)Citation . Although the total MF did not increase by >3-fold, the specific MF of class 1 and 2 mutants at the dose of 0.5 kJ/m2 was ~17 times higher than the control (Table 3)Citation . Even if we regarded the repetitive five mutants at 0.5 kJ/m2 (Fig. 1)Citation as a result of clonal expansion of one independent mutant, the corrected specific MF of large deletions was still 13 times higher than the control value. The molecular sizes of the deletions in classes 1 and 2 (total 31 mutants) were more than 1 kbp except for two mutants (-269 + 1 bp and -956 bp) (Fig. 1)Citation . To our knowledge, this is the first report in which UVB-induced deletions in vivo are systematically analyzed at the molecular level.

Deletions having short (class 1) or no (class 2) homologous sequences at their junctions have been observed in a number of mutant genes implicated in human diseases including cancer. Examples include the retinoblastoma (27) , {alpha}-galactosidase A (28) , ß-globin (29) , factor VIII (30) , and aspartylglucosaminidase genes (31) . Indeed, ~40% of large deletions in human disorders are characterized by the presence of very short sequence homologies (2–6 bp) at the breakpoints (32) . On the basis of the sequence characteristics observed in the junctions and the molecular models of deletions proposed for E. coli, S. cerevisiae, and cultured mammalian cells (11 , 13 , 32) , we hypothesize that class 1 and class 2 mutants are induced by UVB irradiation as follows (Fig. 2)Citation . UVB irradiation induces CPD and pyrimidine-(6,4)-pyrimidone photoproducts at dipyrimidine sites, which block DNA replication and may cause daughter strand gaps in DNA. DSBs may occur as a result of breaks in the gap region, possibly through the attack of an endonuclease specific for single-strand DNA (12 , 33) . The assumption that DSBs are induced by replication of UV-damaged template DNA is consistent with the fact that UV irradiation induces strand breaks during DNA replication; hence, it is called an S-phase-dependent agent (34) . Alternatively, DSBs may be induced during the repair of UV-induced lesions (35 , 36) . The resulting double-stranded ends could be digested by exonucleases, thereby generating 3'- or 5'-protruding ends. Dipyrimidine sites where UV photoproducts are generated may be removed in this step. This could account for the absence of dipyrimidine sites at the junctions or the neighboring sequences of the Spi- mutants (Fig. 1)Citation . In class 1 mutants having short homologous sequences in the junctions, the joining of the ends would take place by annealing of the complementary short homologous sequences, which would be followed by gap filling and ligation. In class 2 mutants with flush ends, the double-stranded ends would be joined without the short direct-repeat sequences. Interestingly, one-half of the class 2 mutants (4 of 8) had 1- or 2-bp insertions at the junctions. No class 1 mutants had such insertions. These insertions are also observed in the junction of large deletions of human primary fibroblast (32) . They may play a role in the efficient joining of two flush DNA ends during nonhomologous recombination. Because DSBs are related to various genetic alterations, they might cause not only Spi- mutations but also larger deletions such as LOH often observed in human skin cancers (16, 17, 18) .



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Proposed mechanisms for the induction of deletions by UVB irradiation in the murine epidermis. UVB irradiation induces UV photoproducts at dipyrimidine sites (T-C dimer), which block DNA replication and may cause daughter-strand gaps in DNA. DNA DSBs may occur as a result of breaks in the gap, possibly through the cleavage by an endonuclease. Alternatively, double-strand breaks may be induced during the repair of UV-induced lesions. The resulting double-stranded ends are digested by exonucleases, thereby generating 3'- or 5'-protruding ends. The ends are joined with or without the short direct-repeat sequences, thereby generating class 1 and class 2 mutants, respectively. The DSBs might be related to induction of LOH as well as Spi- mutations.

 
In a previous report, we characterized the Spi- mutants recovered from the spleen of {gamma}-irradiated mice (22) . Class 1 and 2 deletion mutants with short homology at the ends or flush ends, respectively, were also identified in the {gamma}-irradiated mice. However, much shorter deletions (<1 kbp) were more frequently observed in the {gamma}-irradiated mice. For example, ~70% (11 of 16 class 1 and 2 mutants) of Spi- recovered from {gamma}-irradiated mice at a dose of 50 Gy are shorter than 600 bp. In contrast, only 6% (2 of 31 class 1 and 2 mutants) of Spi- recovered from UVB-irradiated mice were shorter than 1 kbp. The difference in the sizes of deletions may be due to the mechanisms involved in the {gamma}-ray-induced and UVB-induced deletions. One plausible explanation is that the shorter sizes of the {gamma}-ray-induced deletions might represent the length of two clustered DSBs induced by {gamma}-irradiation (37 , 38) , whereas the sizes of UVB-induced deletions might reflect the extent of digestion by exonucleases during the processing of single-stranded DNA. The spectrum of UVB-induced deletions is also different from that of deletions induced by a dietary carcinogen, PhIP. We have determined the spectrum of Spi- mutants recovered from the colon of gpt delta mice treated with PhIP and revealed that most of the Spi- mutants are 1-bp deletions in runs of guanine or in a guanine base beside run sequences (39) . Only 3 of 96 Spi- mutants have deletions of >1 kbp. Thus, the spectrum, i.e., class 1 and class 2 mutants of >1 kbp, could be a molecular characteristic of UVB-induced deletions.

Class 3 and 4 mutants are 1-bp deletions that occur in nonrepetitive or repetitive sequences, respectively, in the gam gene. Spi- selection identifies defective {lambda} phage the gam and redBA gene functions of which are simultaneously inactivated. Thus, the most typical Spi- mutants are deletions in the region of the gam and redBA genes, such as class 1 and 2 mutants (22) . However, because translation of the gam and redBA genes is probably linked, and the gam gene is transcribed first, -1-base frameshifts in the gam gene may interfere with the start of translation of the downstream red genes, thereby functionally inactivating not only gam but also redBA. Hence, Spi- selection can detect -1 frameshifts in the gam gene as well as large deletions in the red and gam genes. Although class 3 mutants have deletions in nonrepetitive sequences, one-half of the mutations (5 of 10) occur beside runs of identical bases. In PhIP-induced Spi- mutations, 1-bp deletions beside run sequences are also frequently observed (39) . The repetitive sequences may stabilize the mutagenic intermediates that may lead to 1-bp deletions beside the run sequences. Class 4 mutants (50 mutants) are the most frequently observed mutations in the UVB-irradiated mice. However, most of these mutations could be due to spontaneous mutations because the spectrum of mutations is very similar to that of unirradiated mice, and the specific MF of this class was not enhanced by more than twice that of the control level by UVB irradiation (Table 3)Citation . Four mutational hotspots are identified, all 4–6-bp-long run sequences. These hotspots for 1-bp deletions were also observed in spleen, liver, and colon of untreated transgenic mice (22 , 39) . Thus, slippage errors of DNA replication in the repetitive sequences appear to be common in various organs of mice, although they may have different rates of DNA replication.

Besides single-base deletion mutants, 15 mutants were detected in the Spi- mutants recovered from UVB-irradiated mice that have base substitutions in the gam gene. These mutants are remarkable in three respects: no deletions were detected in the gam gene; the base changes are not typical UVB-induced transitions; and most of them could make plaques on a recA E. coli strain. The phenotype of {lambda} phage that cannot produce a plaque on a recA strain is called Fec- (26) . {lambda} red and gam double deletion mutants are Fec-. We suspect that they contain mutations in the other region of {lambda} DNA where DNA sequences have not been examined. However, the molecular mechanisms of the mutants that exhibit Spi- but not Fec- are currently unknown.

An interesting observation was the bell-shaped dose-response curve of total MF of Spi- along with the doses of UVB irradiation (Table 1)Citation . Because the specific MF of class 1 and 2 mutants exhibited a similar dose-response curve (Table 3)Citation , we suggest that the bell-shaped dose-response curve of total MF of Spi- is largely due to the apparent suppression of large deletions in higher doses of UVB. In previous work, we examined the gpt mutations in the epidermis and dermis of UVB-irradiated mice and observed that the MF did not increase by >10-fold at higher UVB doses, such as 1.5 and 2.0 kJ/m2 (25) . Because both the gpt mutations and Spi- mutations require DNA replication for mutagenesis, DNA replication might be severely inhibited at higher UVB doses. It could also be possible that the high efficiency of DNA repair against daughter strand gaps in DNA might be induced in the skin at higher UVB doses or that mutated cells are selectively killed. Alternatively, Spi- mutants are not recovered because the extent of deletions induced at the high doses is >10 kbp, which destroys the functions of {lambda} phage. Further work is needed to clarify the reason why the MFs of deletions in the mouse skin apparently decrease at higher UVB doses.

The studies on DNA alteration in skin cancers suggest that base substitutions in p53 is involved in the early step of carcinogenesis. In addition, large deletions such as LOH are also often observed in skin carcinogenesis. For example, LOH and homologous deletions of human chromosome 9p22 have been observed in melanoma cell lines and fresh tumors (18 , 40) . The majority of sporadic basal cell carcinomas have allelic loss on chromosome 9q22, implying the inactivation of a tumor suppressor in this region (16) . LOH of 9q22 is also implicated in squamous cell carcinomas (17) . Although it is supposed that these deletion mutations could have been caused partly by solar UVB irradiation, the role of UVB irradiation does not appear to be as clear as for the p53 mutations. We assume there are at least two major reasons that obscure the relationship between UVB exposure and induction of deletions. First, as shown in this study, UVB-induced deletions do not exhibit sequence alterations at dipyrimidine sites (Fig. 1)Citation . Instead, they display another molecular characteristic, namely, that there are deletions of >1 kbp with short homology at the ends or flush ends. Thus, the absence of sequence changes at dipyrimidine sites does not necessarily mean that they are not induced by UVB irradiation. Second, deletions are induced at a lower frequency compared with that of base substitutions. For example, the frequency of the gpt mutations is 120.6 x 10-6 at a UVB dose of 0.5 kJ/m2 in the previous work (25) , whereas the specific MF of class 1 and 2 Spi- mutants was 1.6 x 10-6 at the same UVB dose using the same DNA preparation (Table 3)Citation . This suggests that the MF of UVB-induced deletions is > 75 times lower than that of base substitutions, which are mainly G:C to A:T transitions at dipyrimidine sites. Hence, an efficient method that preferentially selects deletions, such as Spi- selection, is required for the detection and molecular analysis. However, Spi- assay system has an apparent limitation in detecting very large deletions. Our estimate of maximum deletion size to be detected is 10 kbp (20 , 22) . Thus, larger deletions might occur at higher frequencies.

In this study, we have demonstrated that UVB irradiation can induce deletions in the murine epidermis, and we suggest that most of the deletions are generated through end-joining of DSBs in DNA. Because DSBs induce multiple genetic alterations such as translocations or chromosomal loss, the results raise the possibility that UVB irradiation may induce larger deletions such as LOH or homologous deletions of chromosomes in human skin. Further molecular analysis of Spi- mutants induced by UVB irradiation in various genetic backgrounds, such as DNA repair-deficient or skin cancer-prone mice, could give more detailed information regarding how deletions are induced by UVB irradiation in the epidermis. Such work is presently being conducted in our laboratory.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grants-in-Aid for Cancer Research from the Ministry of Health, Labor and Welfare, Japan, Crossover Research from the Ministry of Education, Sports, Culture, Science and Technology, Japan, and Basic Research from the Japan Health Science Foundation. Back

2 The present addresses are: Department of Domestic Science, Otsuma Women’s University, Chiyoda-ku, Tokyo 102-8357, Japan. Back

3 To whom requests for reprints should be addressed, at Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 Japan. Phone: 81-3-3700-9873; Fax: 81-3-3707-6950; E-mail: nohmi{at}nihs.go.jp Back

4 The abbreviations used are: UVB, ultraviolet B light; CPD, cyclobutane pyrimidine dimers; Spi, sensitive to P2 interference; MF, mutant frequency; PhIP, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine; LOH, loss of heterozygosity; DSB, double-strand break. Back

Received 12/ 8/00. Accepted 3/16/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Yuspa S. H., Dlugosz A. A. Cutaneous carcinogenesis: natural and experimental 2nd Ed. Goldsmith L. A. eds. . Physiology, Biochemistry, and Molecular Biology of the Skin, : 1365-1402, Oxford University Press New York 1991.
  2. Kelfkens G., de Gruijl F. R., van der Leun C. Ozone depletion and increase in annual carcinogenic ultraviolet dose. Photochem. Photobiol., 52: 254-257, 1990.
  3. Friedberg E. C. Walker G. C. Siede W. eds. . DNA Repair and Mutagenesis, : ASM Press Washington, DC 1995.
  4. Brash D. E., Haseltine W. A. UV-induced mutation hotspots occur at DNA damage hotspots. Nature (Lond.), 298: 189-192, 1982.[Medline]
  5. Brash D. E., Ziegler A., Jonason A. S., Simon J. A., Kunala S., Leffell D. J. Sunlight and sunburn in human skin cancer: p53, apoptosis, and tumor promotion. J. Invest. Dermatol. Symp. Proc., 1: 136-142, 1996.
  6. Ziegler A., Leffell D. J., Kunala S., Sharma H. W., Gailani M., Simon J. A., Halperin A. J., Baden H. P., Shapiro P. E., Bale A. E. Mutation hotspots due to sunlight in the p53 gene of nonmelanoma skin cancers. Proc. Natl. Acad. Sci. USA, 90: 4216-4220, 1993.[Abstract/Free Full Text]
  7. Kress S., Sutter C., Strickland P. T., Mukhtar H., Schweizer J., Schwarz M. Carcinogen-specific mutational pattern in the p53 gene in ultraviolet B radiation-induced squamous cell carcinomas of mouse skin. Cancer Res., 52: 6400-6403, 1992.[Abstract/Free Full Text]
  8. Kanjilal S., Pierceall W. E., Cummings K. K., Kripke M. L., Ananthaswamy H. N. High frequency of p53 mutations in ultraviolet radiation-induced murine skin tumors: evidence for strand bias and tumor heterogeneity. Cancer Res., 53: 2961-2964, 1993.[Abstract/Free Full Text]
  9. Dumaz N., van Kranen H. J., de Vries A., Berg R. J., Wester P. W., van Kreijl C. F., Sarasin A., Daya-Grosjean L., de Gruijl F. R. The role of UV-B light in skin carcinogenesis through the analysis of p53 mutations in squamous cell carcinomas of hairless mice. Carcinogenesis (Lond.), 18: 897-904, 1997.[Abstract/Free Full Text]
  10. Pierceall W. E., Goldberg L. H., Tainsky M. A., Mukhopadhyay T., Ananthaswamy H. N. ras gene mutation and amplification in human nonmelanoma skin cancers. Mol. Carcinog., 4: 196-202, 1991.[Medline]
  11. Yamaguchi H., Yamashita T., Shimizu H., Ikeda H. A hotspot of spontaneous and UV-induced illegitimate recombination during formation of {lambda} bio transducing phage. Mol. Gen. Genet., 248: 637-643, 1995.[Medline]
  12. Ukita T., Ikeda H. Role of the recJ gene product in UV-induced illegitimate recombination at the hotspot. J. Bacteriol., 178: 2362-2367, 1996.[Abstract/Free Full Text]
  13. Galli A., Schiestl R. H. On the mechanism of UV and {gamma}-ray-induced intrachromosomal recombination in yeast cells synchronized in different stages of the cell cycle. Mol. Gen. Genet., 248: 301-310, 1995.[Medline]
  14. Ishii Y., Ikushima T. Involvement of G2-dependent DNA double-strand break repair in the formation of ultraviolet light B-induced chromosomal aberrations. Mutat. Res., 427: 99-103, 1999.[Medline]
  15. Seguin L. R., Tarone R. E., Liao K. H., Robbins J. H. Ultraviolet light-induced chromosomal aberrations in cultured cells from Cockayne syndrome and complementation group C xeroderma pigmentosum patients: lack of correlation with cancer susceptibility. Am. J. Hum. Genet., 42: 468-475, 1988.[Medline]
  16. Gailani M. R., Stahle-Backdahl M., Leffell D. J., Glynn M., Zaphiropoulos P. G., Pressman C., Unden A. B., Dean M., Brash D. E., Bale A. E., Toftgard R. The role of the human homologue of Drosophila patched in sporadic basal cell carcinomas. Nat. Genet., 14: 78-81, 1996.[Medline]
  17. Ahmadian A., Ren Z. P., Williams C., Ponten F., Odeberg J., Ponten J., Uhlen M., Lundeberg J. Genetic instability in the 9q22.3 region is a late event in the development of squamous cell carcinoma. Oncogene, 17: 1837-1843, 1998.[Medline]
  18. Pollock P. M., Yu F., Qiu L., Parsons P. G., Hayward N. K. Evidence for u.v. induction of CDKN2 mutations in melanoma cell lines. Oncogene, 11: 663-668, 1995.[Medline]
  19. Ananthaswamy H. N., Pierceall W. E. Molecular alterations in human skin tumors. Prog. Clin. Biol. Res., 376: 61-84, 1992.[Medline]
  20. Nohmi T., Katoh M., Suzuki H., Matsui M., Yamada M., Watanabe M., Suzuki M., Horiya N., Ueda O., Shibuya T., Ikeda H., Sofuni T. A new transgenic mouse mutagenesis test system using Spi- and 6-thioguanine selections. Environ. Mol. Mutagen., 28: 465-470, 1996.[Medline]
  21. Masumura K., Matsui M., Katoh M., Horiya N., Ueda O., Tanabe H., Yamada M., Suzuki H., Sofuni T., Nohmi T. Spectra of gpt mutations in ethylnitrosourea-treated and untreated transgenic mice. Environ. Mol. Mutagen., 34: 1-8, 1999.[Medline]
  22. Nohmi T., Suzuki M., Masumura K., Yamada M., Matsui K., Ueda O., Suzuki H., Katoh M., Ikeda H., Sofuni T. Spi- selection. An efficient method to detect {gamma}-ray-induced deletions in transgenic mice. Environ. Mol. Mutagen., 34: 9-15, 1999.[Medline]
  23. Ikeda H., Shimizu H., Ukita T., Kumagai M. A novel assay for illegitimate recombination in Escherichia coli: stimulation of {lambda} bio transducing phage formation by ultraviolet light and its independence from RecA function. Adv. Biophys., 31: 197-208, 1995.[Medline]
  24. Shimizu H., Yamaguchi H., Ikeda H. Molecular analysis of {lambda} bio transducing phage produced by oxolinic acid-induced illegitimate recombination in vivo. Genetics, 140: 889-896, 1995.[Abstract]
  25. Horiguchi M., Masumura K., Ikehata H., Ono T., Kanke Y., Sofuni T., Nohmi T. UVB-induced gpt mutations in the skin of gpt delta transgenic mice. Environ. Mol. Mutagen., 34: 72-79, 1999.[Medline]
  26. 2nd Ed. Sambrook J. Fritsch E. F. Maniatis T. eds. . Molecular Cloning, a Laboratory Manual, : Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 1989.
  27. Canning S., Dryja T. P. Short, direct repeats at the breakpoints of deletions of the retinoblastoma gene. Proc. Natl. Acad. Sci. USA, 86: 5044-5048, 1989.[Abstract/Free Full Text]
  28. Kornreich R., Bishop D. F., Desnick R. J. {alpha}-Galactosidase. A gene rearrangements causing Fabry disease. Identification of short direct repeats at breakpoints in an Alu-rich gene. J. Biol. Chem., 265: 9319-9326, 1990.[Abstract/Free Full Text]
  29. Henthorn P. S., Smithies O., Mager D. L. Molecular analysis of deletions in the human ß-globin gene cluster: deletion junctions and locations of breakpoints. Genomics, 6: 226-237, 1990.[Medline]
  30. Woods S. P., Kazazian H. H., Jr., Antonarakis S. E. Nonhomologous recombination in the human genome: deletions in the human factor VIII gene. Genomics, 10: 94-101, 1991.[Medline]
  31. Jalanko A., Manninen T., Peltonen L. Deletion of the C-terminal end of aspartylglucosaminidase resulting in a lysosomal accumulation disease: evidence for a unique genomic rearrangement. Hum. Mol. Genet., 4: 435-441, 1995.[Abstract/Free Full Text]
  32. Morris T., Thacker J. Formation of large deletions by illegitimate recombination in the HPRT gene of primary human fibroblasts. Proc. Natl. Acad. Sci. USA, 90: 1392-1396, 1993.[Abstract/Free Full Text]
  33. Wang T. C., Smith K. C. Postreplicational formation and repair of DNA double-strand breaks in UV-irradiated Escherichia coli uvrB cells. Mutat. Res., 165: 39-44, 1986.[Medline]
  34. Ikushima T., Shima Y., Ishii Y. Effects of an inhibitor of topoisomerase II, ICRF-193, on the formation of ultraviolet-induced chromosomal aberrations. Mutat. Res., 404: 35-38, 1998.[Medline]
  35. Bradley M. O., Taylor V. I. DNA double-strand breaks induced in normal human cells during the repair of ultraviolet light damage. Proc. Natl. Acad. Sci. USA, 78: 3619-3623, 1981.[Abstract/Free Full Text]
  36. Berneburg M., Lowe J. E., Nardo T., Araujo S., Fousteri M. I., Green M. H., Krutmann J., Wood R. D., Stefanini M., Lehmann A. R. UV damage causes uncontrolled DNA breakage in cells from patients with combined features of XP-D and Cockayne syndrome. EMBO J., 19: 1157-1166, 2000.[Medline]
  37. Sutherland B. M., Bennett P. V., Sidorkina O., Laval J. Clustered damages and total lesions induced in DNA by ionizing radiation: oxidized bases and strand breaks. Biochemistry, 39: 8026-8031, 2000.[Medline]
  38. Sutherland B. M., Bennett P. V., Sidorkina O., Laval J. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation. Proc. Natl. Acad. Sci. USA, 97: 103-108, 2000.[Abstract/Free Full Text]
  39. Masumura K., Matsui K., Yamada M., Horiguchi M., Ishida K., Watanabe M., Wakabayashi K., Nohmi T. Characterization of mutations induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyrimidine in the colon of gpt delta transgenic mouse: novel G:C deletions beside runs of identical bases. Carcinogenesis (Lond.), 21: 2049-2056, 2000.[Abstract/Free Full Text]
  40. Kamb A., Gruis N. A., Weaver-Feldhaus J., Liu Q., Harshman K., Tavtigian S. V., Stockert E., Day R. S., III, Johnson B. E., Skolnick M. H. A cell cycle regulator potentially involved in genesis of many tumor types. Science (Wash. DC), 264: 436-440, 1994.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
K.-i. Masumura, Y. Totsuka, K. Wakabayashi, and T. Nohmi
Potent genotoxicity of aminophenylnorharman, formed from non-mutagenic norharman and aniline, in the liver of gpt delta transgenic mouse
Carcinogenesis, December 1, 2003; 24(12): 1985 - 1993.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Kannan, N. E. Sharpless, J. Xu, R. C. O'Hagan, M. Bosenberg, and L. Chin
Components of the Rb pathway are critical targets of UV mutagenesis in a murine melanoma model
PNAS, February 4, 2003; 100(3): 1221 - 1225.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Horiguchi, M.
Right arrow Articles by Nohmi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Horiguchi, M.
Right arrow Articles by Nohmi, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online