| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Departments of Gastrointestinal Medical Oncology [Q. S., X. L., J. L. A., C-N. Q., Q. X., B. W., K. X.] and Cancer Biology [K. X.], The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030; Departments of General Surgery [Z. P.] and Pathology [H. T.], The Shanghai Medical University-affiliated Shanghai First Peoples Hospital, Shanghai 200080, Peoples Republic of China; Cancer Center, Sun Yat-sen University of Medical Sciences, Guangzhou, Guangdong 510060, Peoples Republic of China [C-N. Q.]; and Department of Gastrointestinal Surgery, Nanjing Medical University-affiliated Province Hospital, Nanjing, Jiangsu 210009, Peoples Republic of China [X-C. L.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Like other solid tumors, the growth and metastasis of pancreatic adenocarcinoma is dependent on angiogenesis, the formation of new blood vessels from a preexisting network of capillaries (4) . Of the numerous angiogenic factors discovered thus far, VEGF3 (5) , also known as VPF (6) , has been identified as a key mediator of tumor angiogenesis (5 , 6) . Elevated expression of VEGF in human tumor biopsies has been reported in various cancers, including pancreatic adenocarcinoma (7 , 8) . Additionally, blockade of VEGF signal transduction can inhibit tumor growth and metastasis (9, 10, 11, 12) using neutralizing anti-VEGF monoclonal antibodies (13) , antisense VEGF mRNA-expressing constructs (14 , 15) , VEGF-toxin conjugates (16) , antagonistic VEGF mutants (17) , inhibitory soluble VEGF receptors (18, 19, 20) , inhibitors of VEGF receptor function (12 , 21 , 22) , interference of the VEGF receptor system by specific antibodies (9 , 23) , and overexpression of a dominant-negative VPF/VEGF receptor mutant (10) .
The mechanism of VEGF expression and its regulation in human pancreatic cancer are mostly unknown. Increasing evidence suggests that for many types of normal and malignant cells, VEGF expression is regulated by a plethora of external factors, e.g., cytokines, growth factors, gonadotropins, and many other extracellular molecules. Major stimulators of VEGF expression include hypoxia and hypoglycemia (24) , which occur frequently within the expanding tumor mass and particularly in regions surrounding necrotic areas within diverse types of tumors (24) . The major role of hypoxia in the angiogenesis switch has been clearly demonstrated in a mouse model (25) . Hypoxia-mediated VEGF induction involves the transactivation of a VEGF promoter by HIF-1 (26 , 27) , as well as the stabilization of the VEGF mRNA by proteins that bind to sequences located in the 3' untranslated region of VEGF mRNA (28, 29, 30) . However, in many types of tumors, an elevated level of VEGF production can often be detected in tumor cells located in the extreme periphery of the tumor where there is no apparent hypoxia. This observation is consistent with numerous recent findings indicating that such exogenous factors as hormones, cytokines, and growth factors modulate VEGF expression and then modulate angiogenesis. These factors include epidermal growth factor, insulin-like growth factor I (31) , fibroblast growth factor (32) , IL-1ß (33) , IL-6 (34) , IL-8 (35) , keratinocyte growth factor (36) , platelet-derived growth factor (37) , transforming growth factor ß (38) , and tumor necrosis factor (39) . Other cytokines, such as IL-10, IL-4, and IL-13, can inhibit the release of VEGF. Initial analysis of the VEGF promoter region has revealed several potential transcription factor binding sites, such as HIF-1, AP-1, AP-2, Egr-1, Sp1 (40) , and many others (41, 42, 43, 44) , suggesting that they may be involved in VEGF transcription regulation.
Although VEGF can be induced dramatically by external factors, such as hypoxia, many tumors can constitutively express VEGF without any apparent external stimuli. For example, loss or inactivation of tumor suppressor genes and activation of oncogenes are associated with VEGF overexpression (45, 46, 47, 48, 49, 50, 51, 52, 53) . Given the prominent role of VEGF in tumor angiogenesis, it is critical to understand the molecular basis of constitutive VEGF gene expression. Therefore, in the present study, we defined the cis-acting elements and transcription factors involved in constitutive VEGF expression and regulation in human pancreatic adenocarcinoma. We found that human pancreatic adenocarcinoma cells constitutively expressed VEGF and that having differential levels of constitutive Sp1 expression was strongly correlated with the differential levels of constitutive VEGF expression, suggesting that Sp1 plays an important role in tumor angiogenesis and contributes to the aggressive biology of human pancreatic adenocarcinoma.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Analysis of VEGF Gene Expression.
The human pancreatic carcinoma cells were incubated at 7080% confluence. Cellular mRNA was extracted using the FastTrack mRNA isolation kit (Invitrogen Co., San Diego, CA). The mRNA (2 µg) was then separated electrophoretically on a 1% denaturing formaldehyde agarose gel, transferred to a GeneScreen nylon membrane (DuPont Co., Boston, MA) in 20x SSC, and UV cross-linked using a UV-Stratalinker 1800 (Stratagene, La Jolla, CA). The VEGF cDNA probe used was a 0.204-kb BamHI/EcoRI cDNA fragment corresponding to human VEGF. The cDNA probes were labeled with [
-32P]deoxycytidine triphosphate using a random labeling kit (Boehringer Mannheim Biochemicals, Indianapolis, IN). Equal loading of mRNA samples was monitored by hybridizing the same membrane filter with a human ß-actin cDNA probe (35)
. To measure VEGF secretion, the VEGF level in culture supernatants was determined using the Quantikine VEGF ELISA kit (R&D Systems, Minneapolis, MN), which is a quantitative immunometric sandwich enzyme immunoassay. A curve of the absorbance versus the concentration of VEGF in the standard wells was plotted. By comparing the absorbance of the samples with the standard curve, we determined VEGF concentration in the unknown samples (35)
.
Nuclear Run-On Assays for VEGF.
The pancreatic cancer cells were plated into 15-cm plates at 80% confluence, and nuclei were isolated 24 h after cell seeding. In vitro transcription was performed as described previously (35)
. Nuclear RNA labeled with [
-32P]UTP (Amersham Corp., Arlington Heights, IL) was then hybridized with VEGF and ß-actin cDNA immobilized on a filter. The filter was washed and then exposed to X-ray film. Quantitative results were obtained using densitometric analysis of autoradiograms using the ImageQuant sample measurement software, standardized to ß-actin, and expressed as fold change (35)
.
Determination of mRNA Stability.
To evaluate VEGF mRNA stability in different pancreatic cancer cells, we measured the half-life of VEGF mRNA in the cells 24 h after incubation at 80% confluence. Actinomycin D (5 µg/ml) was added to the culture to block further gene transcription. mRNA was isolated 0, 1, 2, 4, 8, and 12 h after the addition of actinomycin D. The amount of VEGF and ß-actin mRNA at each time point was quantified after Northern blot analysis using densitometry; the amount of VEGF mRNA was corrected for loading differences using the amount of ß-actin mRNA. Also, the half-life of VEGF mRNA was calculated by drawing the best-fit linear curve on a plot of VEGF versus time; the time at the point of half-maximal VEGF was taken to be the half-life.
Construction of Reporter Plasmids and Mutagenesis.
A 2.324-kb fragment containing 5' VEGF sequences from -2274 to +50 relative to the transcription initiation site was subcloned into the KpnI and NheI sites of pGL3-basic (Promega, Madison, WI), which contains firefly luciferase coding sequences as well as SV40 intron and polyadenylation signals but lacks eukaryotic promoter or enhancer elements. The final full-length reporter plasmid was designated pGL3-V2274. Its deletion and site-directed mutation reporters were generated as follows. All constructs were verified by sequencing the inserts and flanking regions of the plasmids.
To generate progressive 5'-unidirectional deletion mutants, a series of forward primers was used in combination with the same reverse primer in a PCR with pGL3-V2274 as a template. The reverse primer with the NheI site (underlined) was 5'-CAGAGCGCTGGTGCTAGCCC-3', whereas the forward primers, each of which had the KpnI site (underlined), were 5'-GCTGGGTACCACCATGGAGG-3' (pGL3-V2274), 5'-GCTGGGTACCACGAATGATGG-3' (pGL3-V1181), 5'-GCTGGGTACCTCCCCCTTTGG-3' (pGL3-V1012), 5'-GCTGGGTACCAGATGAGGGCTCC-3' (pGL3-V789), 5'-GCTGGGTACCGTGTGTCCCTCTCC-3' (pGL3-V411), 5'-GCTGGGTACCGCGCGTGTCTCTGG-3' (pGL3-V267), and 5'-GCTGGGTACCCCCTTTTTTTTTTAAAAG-3' (pGL3-V38). The resulting PCR products were gel-purified, digested with KpnI and NheI, and subcloned into the KpnI/NheI sites of the pGL3-basic vector. These products were designated as pGL3-V1181, pGL3-V1012, pGL3-V789, pGL3-V411, pGL3-V267, pGL3-V109, pGL3-V88, pGL3-V61, and pGL3-V38.
To generate site-directed mutants of Sp1, AP-2, and Egr-1 elements at -109 to +50, respectively, the QuickChange mutagenesis kit (Stratagene) was used according to the manufacturers instructions. The primers (mutations are shown in bold and underlined throughout) for mutation of the AP-2 elements were 5'-CGGGGCGGGCCTAGGGCGGGGTCCC-3' (sense) and 5'-GGGACCCCGCCCTAGGCCCGCCCCG-3' (antisense), and the primers for mutation of the Egr-1 elements were 5'-GGGGCGGGCCTAGGGCGGGGTCCCGGCTAGGCGGAGCCATG-3' (sense) and 5'-CATGGCTCCGCCTAGCCGGGACCCCGCCCTAGGCCCGCCCC-3' (antisense). In addition, the primers for mutation of the Sp1.1 elements were 5'-GGTCCCGGCGGTTCGGAGCCATGC-3' (sense) and 5'-GCATGGCTCCGAACCGCCGGGACC3' (antisense), the primers for mutation of the Sp1.2 elements were 5'-GGGCGGGCCGGGTTCGGGGTCCCGGC-3' (sense) and 5'-GCCGGGACCCCGAACCCGGCCCGCCC3' (antisense), and the primers for mutation of the Sp1.3 elements were 5'-CCGCCCCCCGGTTCGGGCCGGGGG-3' (sense) and 5'-CCCCCGGCCCGAACCGGGGGGCGG-3' (antisense). The primers for mutation of the Sp1.4 elements were 5'-CGCCTGTCCCCGAACCCCGGGGCGGG-3' (sense) and 5'-CCCGCCCCGGGGTTCGGGGACAGGCG3' (antisense). The primers for mutation of all four Sp1 elements were 5'-GCTCGCCTGTCCCCGAACCCCGGTTCGGGCCGGGTTCGGGGTCCCGGCGGTTCGGAGCCATGC3' (sense) and 5'-GCATGGCTCCGAACCGCCGGGACCCCGAACCCGGCCCGAACCGGGGTTCGGGGACAGGCGAGC3' (antisense). The resulting reporter plasmids were designated as pGL3-V/AP-2m, pGL3-V/Egr-1m, pGL3-V/Sp1.1m, pGL3-V/Sp1.2m, pGL3-V/Sp1.3m, pGL3-V/Sp1.4m, and pGL3-V/Sp1.ALLm, respectively.
Analysis of VEGF Promoter Activities.
VEGF promoter plasmids containing firefly luciferase reporters were cotransfected into tumor cells in triplicate with an internal control pBA-RL using a calcium-phosphate method (Mammalian Transfection Kit; Stratagene). The pBA-RL contained a full-length renilla luciferase gene under the control of a human ß-actin promoter. In some experiments, the reporters were cotransfected with pCMV4-Sp1, pCMV4-Sp3, or pCMV4 (obtained from Dr. Jonathan M. Horowitz, the North Carolina State University, North Carolina; reviewed in Ref. 56
). Six h after cotransfection, the plates were washed three times with PBS and refed with fresh MEM. The activity of both firefly and renilla luciferase was determined 48 h later using the Dual Luciferase Assay kit (Promega). Specific VEGF promoter activity was calculated as described previously (35)
.
EMSA.
EMSA was performed using nuclear extracts prepared from different pancreatic cancer cells plated into the 15-cm plates at 80% confluence. The following double-stranded oligonucleotides were used: a wild-type Sp1 consensus sequence (5'-ATTCGATCGGGGCGGGGCGAGC-3') and its mutant Sp1 consensus sequence (5'-ATTCGATCGGTTCGGGGCGAGC-3') and Sp1 binding sequences corresponding to Sp1 binding sites in the VEGF promoter region (as described in "Results"). The oligonucleotides were annealed and 5' end-labeled with [32P]ATP (Amersham Corp.) plus T4 polynucleotide kinase using standard procedures (35)
. A binding reaction was carried out by preincubating 5 µg of nuclear extract protein in 20 mM HEPES (pH 7.9), 50 mM NaCl, 5% glycerol, 0.1 mM DTT, and 1 µg of poly(dI-dC) at room temperature for 15 min, which was followed by the addition of the double-stranded 32P-labeled oligonucleotide and a second incubation at room temperature for 15 min. For competition assays, a 50-fold molar excess of unlabeled oligonucleotides (or as indicated) was added to the binding reaction. For supershift reactions, extracts were preincubated with anti-Sp1 or anti-Sp3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 45 min on ice. Samples were then loaded on a 5% polyacrylamide gel, and electrophoresis was performed at room temperature for 3 h at 120 V. The gel was then dried for 2 h at 80°C and exposed to Kodak film (Eastman Kodak Co., Rochester, NY) at -70°C.
Western Blot Analysis.
Whole-cell lysates were prepared from human pancreatic cancer cell lines. A standard Western blot was performed using a polyclonal rabbit antihuman and antimouse Sp1 (Santa Cruz Biotechnology) and a second antibody [antirabbit IG, horseradish peroxidase-linked F(ab')2 fragment from a donkey; Amersham Corp.]. Equal protein sample loading was monitored by hybridizing the same membrane filter with an anti-ß-actin antibody (35)
. The probe proteins were detected using the Amersham enhanced chemiluminescence system according to the manufacturers instructions.
Immunohistochemistry.
Human tumor and normal tissue sections (5-µm thick) of formalin-fixed, paraffin-embedded specimens were processed for immunostaining using a 1:500 dilution of rabbit anti-VEGF and anti-Sp1 antibodies and appropriate peroxidase-conjugated antirabbit IgG second antibody as described previously (35)
. The slides were then examined under a bright-field microscope. A positive reaction was indicated by a reddish-brown precipitate in the cytoplasm and nucleus. Negative controls were done using nonspecific IgG.
Statistics.
Each experiment was performed independently at least twice with similar results; one representative experiment was presented. The significance of the data was determined using Students t test (two-tailed). Ps < 0.05 were deemed significant.
| RESULTS |
|---|
|
|
|---|
|
Regulation of the Steady-State Level of VEGF mRNA.
The steady-state level of VEGF mRNA expression has been shown to be dynamically regulated by many factors at both the transcriptional and posttranscriptional level (18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53)
and determined using nuclear run-on (transcription) and transcript degradation rate (mRNA stability) assays of the VEGF gene. In the present study, we first measured the VEGF mRNA half-life in both CaPan-2 cells expressing a low level of VEGF and PANC-1 cells expressing a high level of VEGF. Actinomycin D (5 µg/ml) was added to the culture to block further gene transcription. The total RNA was isolated 0, 1, 2, 4, 8, and 12 h after the addition of actinomycin D. The amount of VEGF mRNA and ß-actin mRNA at each time point was quantified after Northern blot analysis (Fig. 2A)
. The VEGF mRNA half-life was calculated by drawing the best-fit linear curve on a plot of VEGF versus time (Fig. 2B)
. We found that the VEGF mRNA half-life in PANC-1 and SW-1990 cells was slightly shorter than that in CaPan-2 and HS766T cells (Fig. 2B)
. Therefore, stability did not appear to be the major factor for the different expression levels of VEGF mRNA.
|
Constitutive VEGF Promoter Activity.
To characterize the DNA sequences involved in constitutive transcriptional activation of the VEGF gene, we used luciferase reporter plasmids in which VEGF 5'-flanking sequences were fused to the firefly luciferase coding sequences in the pGL3-basic vector. The full-length sequence (defined as pGL3-2274) spanned -2274 to +50 relative to the transcription initiation site. Additionally, a luciferase reporter without any VEGF promoter sequences (defined as pGL3-basic) was used as a control (Fig. 2E)
. The plasmids were cotransfected into the cells with pBA-RL, which was used as an internal control to monitor transfection efficiency (35)
. The transfected cells, which were 4050% confluent, were incubated for 48 h; the activity of both luciferases was then measured using the Dual Luciferase Assay. As shown in Fig. 2E
, a high level of VEGF promoter activity was detected in PANC-1, COLO357, Bxpc-3, and SW-1990 cells, whereas a low level of VEGF promoter activity was detected in CaPan-2, HS766T, MDA Panc-48, and HPAFII cells.
Characterization of the Minimal Responsive Region.
To determine the essential responsive region or regions of a high level of VEGF promoter activity, progressive deletion mutants from the pGL3-V2274 were generated as described in "Materials and Methods" and designated pGL3-V1181, pGL3-V1012, pGL3-V789, pGL3-V411, pGL3-V267, pGL3-V109, pGL3-V88, pGL3-V61, and pGL3-V38. This series of mutant reporters was cotransfected into the PANC-1 cells with pBA-RL, and the relative luciferase activity was determined as described above (Fig. 2E)
. There was no significant loss of VEGF promoter activity with deletions from -2274 to -267, whereas further deletion of -267 to -38 totally eliminated the constitutive VEGF promoter activity (Fig. 3A)
. These results suggested that the sequence from -267 bp to -38 bp was required for constitutive VEGF gene expression.
|
Characterization of cis-responsive Elements.
It has been reported that there are five Sp1 binding sites within the region from -267 to -38: one is located between -267 and -109 (Sp1.5); whereas the remaining four are clustered between -109 and -38 (Sp1.4, Sp1.3, Sp1.2, and Sp1.1). In addition, there are several other putative response elements in this region (one AP-2 and two Egr-1 binding sites) that overlap with the Sp1 cluster as shown in Fig. 3B
.
To determine whether these cis-elements were essential for the constitutive VEGF expression, point-mutated pGL3-V109 luciferase reporters were generated (Fig. 3C)
and transfected into both PANC-1 and CaPan-2 cells. As compared with the control pGL3-V109 (wild-type) reporter, point mutations of AP-2 or Egr-1 had no significant effects on luciferase activity, suggesting that these putative sites did not contribute significantly to the constitutive VEGF promoter activity. Mutations in individual Sp1 sites variably reduced the luciferase activity, and mutations in all four Sp1 sites eliminated the luciferase activity and the difference in promoter activity in PANC-1 and CaPan-2 cells (Fig. 3C)
. We further compared the pGL3-V109 (Sp1-mediated) and pGL3-V/Sp1.ALLm (non-Sp-mediated) promoter activity in cell lines with low or high VEGF expression. As shown in Fig. 3D
, a high level of pGL3-V109 activity was observed in PANC-1, COLO357, Bxpc-3, and SW-1990 cells expressing a high level of VEGF, whereas a low level of pGL3-V109 activity was observed in CaPan-2, HS766T, MDA Panc-48, and HPAFII cells expressing a high level of VEGF. There was no significant pGL3-V/Sp1.ALLm promoter activity in either high or low VEGF-expressing cells (Fig. 3D)
. These results indicated that Sp1 factor binding elements were mainly responsible for the constitutive VEGF promoter in human pancreatic cancer cells. Additionally, a maximal level of constitutive VEGF promoter activity appeared to require the presence and cooperation of all four Sp1 binding sites, suggesting that the proximal Sp1 cluster in the VEGF promoter is responsible for the high constitutive transcription activity of VEGF in human pancreatic cancer cells.
Elevated Sp1 Expression in Human Pancreatic Cancer Cells.
To further determine the trans-acting factors involved in the constitutive expression of VEGF, EMSA was performed. The five pairs of probes used contained the putative Sp1 binding sites (Sp1.1, Sp1.2, Sp1.3, Sp1.4, and Sp1.5) and their corresponding mutants; their spanning positions in the VEGF promoter are outlined in Fig. 4A
. Incubation of nuclear extracts from PANC-1 cells with these wild-type Sp1.1, Sp1.2, and Sp1.4 probes resulted in the formation of three major shifted DNA-protein complexes (indicated as Sp1 and Sp3 in Fig. 4A
) but not with their corresponding mutants (Fig. 4B)
. The shifted complexes were competed with cold Sp1 consensus oligonucleotides but not with cold mutant Sp1 consensus oligonucleotides. In supershift assays, we clearly showed that there were two Sp3-containing complexes and one Sp1-containing complex (Fig. 4C)
. In contrast, incubation of nuclear extracts from PANC-1 cells with wild-type Sp1.3 and Sp1.5 probes failed to form the three shifted DNA-protein complexes described above (Fig. 4B)
. These data indicated for the first time that Sp1.1, Sp1.2, and Sp1.4 binding sites were functionally active, whereas Sp1.3 and Sp1.5 binding sites were not.
|
Expression of Sp1 Protein in Pancreatic Cancer Cells.
Because the putative Sp1 binding sites were shown to bind differentially to Sp1 and Sp3 in cells expressing different levels of VEGF, we sought to determine whether this differential Sp1 binding activity was due to different levels of Sp1 and/or Sp3 protein expression. Expression of both proteins in human pancreatic cancer cells was determined by Western blot analysis. As shown in Fig. 5, A and B
, a high level of Sp1 protein was detected in PANC-1, COLO357, SW-1990, and Bxpc-3 cells constitutively expressing a high level of VEGF, whereas a low level of Sp1 proteins was detected in CaPan-2, HS766T, MDA Panc-3, and HPAFII cells constitutively expressing a low level of VEGF. The expression level of Sp3 was proportional to that of Sp1, and no significant ratio difference was observed in the cells expressing different levels of VEGF (data not shown), suggesting that different VEGF expression levels may not be due to an Sp1 and Sp3 expression imbalance.
|
|
Expression of VEGF and Sp1 in Pancreatic Adenocarcinoma Cells.
To determine the biological relevance of Sp1-mediated constitutive expression of VEGF, VEGF and Sp1 expression was determined in human pancreatic adenocarcinoma cells. Ten human pancreatic adenocarcinoma specimens and 10 normal human pancreatic tissue specimens were used for immunostaining with specific anti-VEGF and anti-Sp1 antibodies. As compared with the normal pancreatic tissue specimens, all of the human pancreatic cancer specimens overexpressed the Sp1 protein, which was correlated with elevated expression of VEGF (Fig. 7)
. To further confirm this finding, VEGF expression was determined by Northern blot analysis, and Sp1 expression was determined by both Western blot analysis and EMSA. Consistent with the results of immunostaining (Fig. 7)
, tumor tissues expressed a higher level of VEGF than normal tissue (Fig. 8A)
. The tumor tissue also expressed a higher level of Sp1 protein (Fig. 8B)
and binding activity (Fig. 8C)
than normal tissues. These data demonstrated clearly that constitutive expression of the transcription factor Sp1 contributes to VEGF overexpression and hence to angiogenesis and progression of human pancreatic adenocarcinoma.
|
|
| DISCUSSION |
|---|
|
|
|---|
Although VEGF expression can be induced dramatically by external factors, such as hypoxia, and modulated by many growth factors and cytokines, many types of cancer can constitutively express VEGF. As shown in the present study, the majority of human pancreatic cancer cells constitutively express VEGF without any apparent external stimuli. As a first approach, we aimed to identify the mechanisms and kinetics implicated by the differential levels of constitutive VEGF mRNA expression observed in various human pancreatic cancer cells. Initial experiments indicated that VEGF mRNA stability varied among the cancer cell lines but could not explain the variable steady-state level of VEGF mRNA. However, the steady-state level of VEGF mRNA was consistent with the VEGF gene transcription rate as determined using a nuclear run-on assay. These results suggested that constitutive VEGF expression depends mainly on the constitutively activated VEGF gene transcription process. This conclusion was further supported by our results indicating that the VEGF promoter was constitutively active in these cells and correlated with VEGF expression.
Whereas little is currently known about the transcriptional regulation leading to constitutive VEGF expression, disruption or deregulation of normal signal transduction pathways may be an important contributing factor. This hypothesis is supported by several recent studies showing that the loss or inactivation of the wild-type vHL and/or p53 tumor suppressor gene is associated with increased angiogenesis in developing tumors (45, 46, 47, 48, 49, 50, 51, 52, 53) . Also, the v-src oncogene increases VEGF expression by inducing HIF-1 expression (57, 58, 59) , which is not only independent of hypoxia but also actually short circuits the normal HIF-1-dependent hypoxia-sensing mechanism that regulates VEGF expression. Given the prominent role of VEGF in tumor angiogenesis, it is critical to understand the molecular basis of constitutive VEGF gene expression. In the present study, we further defined the cis-acting elements and transcription factors involved in constitutive VEGF expression in human pancreatic cancer cells.
Functional analysis of the human VEGF promoter was initially performed using the full-length VEGF promoter reporter in eight human pancreatic cancer cell lines. A high level of VEGF promoter activity was evident in the cells constitutively expressing a high level of VEGF, whereas a low level of VEGF promoter activity was detected in the cells constitutively expressing a low level of VEGF. Therefore, there was a direct correlation between VEGF promoter activity and VEGF expression. In addition, progressive 5'-deletion constructs of the human VEGF promoter were analyzed in PANC-1 and CaPan-2 cells, which had high and low VEGF expression, respectively. Deletion up to -267 had no effect on constitutive VEGF promoter activity compared with pGL3-V2274, which exhibited maximal VEGF promoter activity, whereas further deletion from -267 to -37 reduced significantly or totally eliminated constitutive promoter activity; the difference in VEGF promoter activity between PANC-1 and CaPan-2 cells was consequently reduced or eliminated as well. These results indicate that the region from -37 to -267 is functionally essential for differential constitutive VEGF promoter activity in human pancreatic cancer cells.
Several putative response elements in the region from -267 to -2274 have been identified. These include three AP-1 binding sites, one HIF-1 binding site, two AP-2 binding sites, and one NF1 binding site. VEGF gene regulation by nitric oxide and hypoxia appears to be potentiated by the AP-1 element of the gene in C6 glioma cells (60 , 61) . Also, a unique site (TGAGTGA) located at position -621 of the 5'-flanking region of the VEGF gene is functional and responsible for the inhibitory effect of retinoids in cultured keratinocytes (62) . Furthermore, lipopolysaccharide-induced VEGF production in human pulp cells is mediated in part through AP-1 activation (63) . On the other hand, mutant H- and K-ras oncogenes, as well as v-src and v-raf, induce VEGF expression in transformed fibroblasts and epithelial cells in part through ras-dependent signal transduction pathways and AP-1 activation, which can presumably bind to relevant sites in the VEGF promoter regions (64) . However, hypoxia-mediated VEGF induction in osteoblast-like cells (65) and smooth muscle cells (66 , 67) is likely not mediated by AP-1. In addition, VEGF induction by carbon monoxide and anoxia in rat cardiomyocytes does not involve AP-1 binding sites (68) . Furthermore, hypoxia-induced VEGF expression is independent of AP-1-mediated transcription (69) .
The role of AP-1 in VEGF expression and regulation is not certain at the present time. This might be due to the use of different cell lines or tissues. Our full-length VEGF promoter construct contains three motifs homologous to the AP-1 binding site [5'-TGANT(C/A)NN-3'] at positions -621, -1527, and -2265. Transactivation analysis using different promoter constructs revealed that these distal AP-1 elements do not contribute significantly to constitutive VEGF promoter activity in PANC-1 and CaPan-2 cells because deletion of them (pGL3-V1181, pGL3-V1012, and pGL3-V411; Fig. 3
) had no effect compared with pGL3-V2274. Also, K-ras and p53 mutations are very common in pancreatic cancer (3)
. However, it remains unclear whether these mutations directly influence AP-1 activity and VEGF overexpression in human pancreatic cancer cells.
HIF-1 is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. HIF-1 also activates VEGF transcription by binding VEGF 5'-flanking sequences in hypoxic Hep3B cells (27 , 67) . The oncogenic Ha-ras enhances the induction of VEGF by hypoxia via HIF-1 (70) . c-src expression is neither required nor critical for expression of HIF-1 or transcriptional activation of the VEGF gene (71) , whereas cells expressing the v-src oncogene have increased expression of HIF-1 and VEGF under both hypoxic and nonhypoxic conditions (59) . Additionally, the loss of PTEN during malignant progression contributes to tumor expansion through the deregulation of Akt activity and HIF-1-regulated gene expression (72) . Therefore, the HIF-1 element is crucial in hypoxia-dependent and -independent induction of VEGF. At least one HRE has been clearly identified and shown to be responsive functionally to hypoxia and oncogenic transformation (67) . In the present study, both deletion and site-directed (data not shown) mutation of this HRE apparently did not affect the constitutive VEGF promoter activity, suggesting that this HRE was not functionally active and likely did not contribute significantly to the constitutive VEGF promoter activity observed in human pancreatic cancer cells.
The transcription factor AP-2 is a 52-kDa protein that binds as a dimer to the palindromic sequence 5'-GCCNNNGGC-3', although some AP-2 binding sites deviate from this consensus sequence. It has been suggested that AP-2 plays a role in the regulation of VEGF expression in hamster cells by hypoxia and p42/p44 mitogen-activated protein kinase (73)
and in bovine ovarian granulosa cells by growth factors (74)
. Also, AP-2 protein appears to be functionally important in transforming growth factor
-induced VPF/VEGF gene expression in keratinocytes (75)
. In the present study, we showed that neither distal AP-2 (pGL3-V789 versus pGL3-V1012) nor distal NF1 (pGL3-V267 versus pGL3-V411) elements contributed to the constitutive VEGF promoter activity.
Our findings described above indicated that these distal putative elements are not constitutively active in human pancreatic cancer cells. In contrast, they may play an essential role in dynamic regulation of VEGF by hypoxia, which mainly involves transcription factor HIF-1
. In a mouse model, it has been clearly demonstrated that hypoxia becomes a primary mediator of the angiogenic switch in advanced cancers (25)
. We therefore focused our current study of constitutive VEGF expression on the proximal region of the VEGF promoter. Small-scale deletion of the pGL3-V267 VEGF promoter revealed that the proximal 71-bp region (-38 to -109) is essential for constitutive VEGF promoter activity in pancreatic cancer cells (Fig. 3)
. Within this region, there are four Sp1 elements (Sp1.1, Sp1.2, Sp1.3, and Sp1.4), two Egr-1 elements (Egr-1.1 and Egr-1.2), and one AP-2 element. To define the contribution of these elements to VEGF promoter activity, site-directed mutagenesis was performed. We found that mutation of the AP-2 element did not affect the constitutive VEGF promoter activity. Therefore, both distal and proximal AP-2 binding sites were not of functional significance in constitutive VEGF promoter activity. Mutation of the two Egr-1 elements did not affect the constitutive VEGF promoter activity either. These results were consistent with previous reports showing that enhanced VEGF gene expression in platelet-derived growth factor-BB-induced NIH3T3 cells is mediated by Sp1 and/or Sp3 transcription factors bound to the promoter region of the VEGF gene (37)
. In our site-directed mutagenesis study, mutation of the four individual Sp1 elements resulted in a variable (12.3645.56%) reduction in VEGF promoter activity compared with that of the wild-type pGL3-V109 construct (Fig. 4)
, and mutation of all four Sp1 elements totally eradicated the constitutive VEGF promoter activity and its difference in PANC-1 and CaPan-2 cells. These results clearly demonstrated that the proximal Sp1 elements are essential for the differential constitutive promoter activity of the VEGF gene in human pancreatic cancer cells. Additionally, we determined the Sp1 binding activity in various pancreatic cancer cells. Only three of five putative Sp1 binding sites were functionally active. Also, a high level of Sp1 binding activity was observed in the cells constitutively expressing high levels of VEGF, whereas low levels of Sp1 binding activity were detected in the cells constitutively expressing a low level of VEGF. Therefore, the Sp1 binding activity was correlated directly with VEGF promoter activity, mRNA expression, and VEGF protein secretion.
Sp1 is a well-characterized, sequence-specific, DNA-binding protein that is important in the transcription of many cellular and viral genes that contain GC boxes in their promoter (41) . Additional transcription factors (Sp2, Sp3, and Sp4) have been cloned that are similar in their structural and transcriptional properties to Sp1, thus forming a Sp1 multigene family (76) . In the present study, we analyzed the factor or factors binding to the functional Sp1.1 element using EMSA and supershift analysis. Three expressed constitutively DNA-protein complexes were detected using labeled Sp1.1 oligonucleotides. Analysis using antibodies against Sp1 and Sp3 revealed that complex 1 contained Sp1, complex 2 contained both Sp1 and Sp3, and complex 3 contained only Sp3. However, whereas Sp1 stimulates transcriptional activity, the function of Sp3 is less clear. Sp3 has been shown to act as a dual-function regulator whose activity depends on the context of DNA binding sites in a promoter. Sp3 also functions as a repressor when it is bound to a promoter through multiple DNA binding sites and as an activator when it is targeted to a promoter through a single DNA binding site (77, 78, 79, 80) . In addition, Sp3 has the ability to repress Sp1-mediated transcriptional activation of the human alcohol dehydrogenase 5 gene, possibly by competing with Sp1 for binding (80) . With regard to the VEGF gene, we have determined that Sp1 potently activates the VEGF promoter in both PANC-1 and CaPan-2 cells, as well as Sp-deficient SL2 cells (data not shown), whereas Sp3 functions as a weak transcriptional activator.
Finally, we compared Sp1 activity in different pancreatic cancer cells. We found that the level of Sp1 activity directly correlated with the VEGF promoter activity, the steady-state level of mRNA, and VEGF secretion. Furthermore, Sp1 activity was directly correlated with Sp1 expression as determined using Western blot analysis, which showed a high level of Sp1 protein in the cells constitutively expressing a high level of VEGF, whereas a low level of Sp1 protein was seen in the cells constitutively expressing a low level of VEGF. Data from pancreatic cancer tissues were consistent with these biochemical findings. As compared with normal pancreatic tissue specimens, most of the human pancreatic cancer specimens overexpressed Sp1 protein as determined using immunostaining, Western blot, and EMSA and which correlated directly with VEGF overexpression.
The underlying mechanism resulting in different levels of Sp1 activity is currently unknown. This difference could be due to several mechanisms, such as the Sp1:Sp3 ratio (81)
, methylation status of Sp1 binding sites (82)
, and possible inhibitory proteins that bind to Sp1/Sp3 (56)
. It may also involve many other cellular factors, including the functional status of oncogenes and suppressor genes. Sp1/Sp3 has been shown to interact with several oncogenes and suppressor genes, e.g., retinoblastoma protein (56
, 83)
and the vHL tumor suppressor gene (50)
. Also, tumor cells harboring the inactivated vHL gene are associated with increased VEGF expression and angiogenesis (47, 48, 49)
. vHL gene-mediated repression of VEGF has convincingly been shown to be mediated by transcriptional and posttranscriptional mechanisms (50, 51, 52)
. At the transcriptional level, vHL forms a complex with the Sp1 transcription factor and inhibits Sp1-mediated VEGF expression (50)
. Whether the status of vHL, p53, and Ras is involved in this constitutive VEGF expression in human pancreatic cancer cells is unknown. Our present study was the first to demonstrate that differential Sp1 expression and activity directly regulate the constitutive levels of VEGF expression in human pancreatic cancer cells, thus providing a novel mechanism for constitutive VEGF regulation. Interestingly, the VEGF level can be further induced by hypoxia via the HIF-1
pathway in pancreatic cancer cells expressing high levels of VEGF (data not shown). We are currently investigating the possible interaction between Sp1 and HIF-1
, which has been shown to be a major mediator of VEGF regulation by hypoxia and oncogenic transformation (26, 27, 28, 29, 30)
.
In summary, we have demonstrated the importance of elements within the proximal region of the human VEGF promoter for differential constitutive VEGF expression in human pancreatic cancer. This analysis also indicated that the major contributing factor was the differential expression of Sp1 in human pancreatic cancer cells and that Sp1 was aberrantly overexpressed in pancreatic adenocarcinoma specimens compared with normal pancreatic tissue specimens. Therefore, abnormal activation of Sp1 may play an important role in tumor angiogenesis, growth, and metastasis. A further understanding of the molecular basis of Sp1, as well as of VEGF regulation, will have functional implications in suppressing pancreatic cancer progression and will ultimately lead to the design of new therapeutic modalities. On the basis of these results, we propose that increased Sp1 DNA-binding activity may augment the angiogenic and metastatic capacity of tumor cells through overexpression of Sp1-responsive genes, including the key angiogenic factor VEGF.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported in part by the University Startup Fund, the Multidisciplinary Pancreatic Program Research Grant, the Lustgarten Pancreatic Cancer Research Foundation, Research Project Grant RPG-00-054-01-CMS from the American Cancer Society, and Cancer Center Support Core Grant CA 16672-23 from the NIH (to K. X.). ![]()
2 To whom requests for reprints should be addressed, at the Department of Gastrointestinal Medical Oncology, Box 426, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: (713) 792-2013; Fax: (713) 745-1163; E-mail: kepxie{at}mail.mdanderson.org ![]()
3 The abbreviations used are: VEGF, vascular endothelial growth factor; VPF, vascular permeability factor; HIF-1, hypoxia-inducible factor 1; EMSA, electrophoretic mobility shift assay; IL, interleukin; AP, activator protein; vHL, von Hippel-Lindau. ![]()
Received 9/27/00. Accepted 3/12/01.
| REFERENCES |
|---|
|
|
|---|
in human glioma cells: possible roles of SP-1. J. Biol. Chem., 271: 28220-28228, 1996.
regulates the VEGF expression and is potentially involved in lung and vascular development. Proc. Natl. Acad. Sci. USA, 94: 4273-4278, 1997.
and developmentally expressed in blood vessels. Mech. Dev., 63: 51-60, 1997.[Medline]
-induced transcriptional activation of the vascular permeability factor (VPF/VEGF) gene requires AP-2-dependent DNA binding and transactivation. EMBO J., 16: 750-759, 1997.[Medline]
This article has been cited by other articles:
![]() |
D. M. Birk, J. Barbato, L. Mureebe, and R. A. Chaer Basic Science Review: Current Insights on the Biology and Clinical Aspects of VEGF Regulation Vascular and Endovascular Surgery, December 1, 2009; 42(6): 517 - 530. [Abstract] [PDF] |
||||
![]() |
S. Wei, H.-C. Chuang, W.-C. Tsai, H.-C. Yang, S.-R. Ho, A. J. Paterson, S. K. Kulp, and C.-S. Chen Thiazolidinediones Mimic Glucose Starvation in Facilitating Sp1 Degradation through the Up-Regulation of {beta}-Transducin Repeat-Containing Protein Mol. Pharmacol., July 1, 2009; 76(1): 47 - 57. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Papineni, S. Chintharlapalli, M. Abdelrahim, S.-o. Lee, R. Burghardt, A. Abudayyeh, C. Baker, L. Herrera, and S. Safe Tolfenamic acid inhibits esophageal cancer through repression of specificity proteins and c-Met Carcinogenesis, July 1, 2009; 30(7): 1193 - 1201. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wu, I. Ivanov, R. Xu, and S. Safe Role of SP transcription factors in hormone-dependent modulation of genes in MCF-7 breast cancer cells: microarray and RNA interference studies J. Mol. Endocrinol., January 1, 2009; 42(1): 19 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Safe and K. Kim Non-classical genomic estrogen receptor (ER)/specificity protein and ER/activating protein-1 signaling pathways J. Mol. Endocrinol., November 1, 2008; 41(5): 263 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, N. Zhang, B. Dai, M. Liu, R. Sawaya, K. Xie, and S. Huang FoxM1B Transcriptionally Regulates Vascular Endothelial Growth Factor Expression and Promotes the Angiogenesis and Growth of Glioma Cells Cancer Res., November 1, 2008; 68(21): 8733 - 8742. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, J.-Y. Zhou, W.-Z. Wei, S. Philipsen, and G. S. Wu Sp1-Mediated TRAIL Induction in Chemosensitization Cancer Res., August 15, 2008; 68(16): 6718 - 6726. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Guo, V. Gokhale, L. H. Hurley, and D. Sun Intramolecularly folded G-quadruplex and i-motif structures in the proximal promoter of the vascular endothelial growth factor gene Nucleic Acids Res., August 1, 2008; 36(14): 4598 - 4608. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yan, J. Chen, A. A Wiley, B. D Crean-Harris, F. F Bartol, and C. A Bagnell Relaxin (RLX) and estrogen affect estrogen receptor {alpha}, vascular endothelial growth factor, and RLX receptor expression in the neonatal porcine uterus and cervix Reproduction, May 1, 2008; 135(5): 705 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Enya, H. Hayashi, T. Takii, N. Ohoka, S. Kanata, T. Okamoto, and K. Onozaki The interaction with Sp1 and reduction in the activity of histone deacetylase 1 are critical for the constitutive gene expression of IL-1{alpha} in human melanoma cells J. Leukoc. Biol., January 1, 2008; 83(1): 190 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. U. Mertens-Talcott, S. Chintharlapalli, X. Li, and S. Safe The Oncogenic microRNA-27a Targets Genes That Regulate Specificity Protein Transcription Factors and the G2-M Checkpoint in MDA-MB-231 Breast Cancer Cells Cancer Res., November 15, 2007; 67(22): 11001 - 11011. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hucl, J. R. Brody, E. Gallmeier, C. A. Iacobuzio-Donahue, I. K. Farrance, and S. E. Kern High Cancer-Specific Expression of Mesothelin (MSLN) Is Attributable to an Upstream Enhancer Containing a Transcription Enhancer Factor Dependent MCAT Motif Cancer Res., October 1, 2007; 67(19): 9055 - 9065. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Singh, Q. Shi, S. T. Bailey, M. J. Palczewski, A. B. Pardee, J. D. Iglehart, and D. K. Biswas Nuclear factor-{kappa}B activation: a molecular therapeutic target for estrogen receptor-negative and epidermal growth factor receptor family receptor-positive human breast cancer Mol. Cancer Ther., July 1, 2007; 6(7): 1973 - 1982. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Jia, J. Zhang, D. Wei, L. Wang, P. Yuan, X. Le, Q. Li, J. Yao, and K. Xie Molecular Basis of the Synergistic Antiangiogenic Activity of Bevacizumab and Mithramycin A Cancer Res., May 15, 2007; 67(10): 4878 - 4885. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim, C. H. Baker, J. L. Abbruzzese, D. Sheikh-Hamad, S. Liu, S. D. Cho, K. Yoon, and S. Safe Regulation of Vascular Endothelial Growth Factor Receptor-1 Expression by Specificity Proteins 1, 3, and 4 in Pancreatic Cancer Cells Cancer Res., April 1, 2007; 67(7): 3286 - 3294. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chintharlapalli, S. Papineni, S. K. Ramaiah, and S. Safe Betulinic Acid Inhibits Prostate Cancer Growth through Inhibition of Specificity Protein Transcription Factors Cancer Res., March 15, 2007; 67(6): 2816 - 2823. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Peng, D. Wei, L. Wang, H. Tang, J. Zhang, X. Le, Z. Jia, Q. Li, and K. Xie RUNX3 Inhibits the Expression of Vascular Endothelial Growth Factor and Reduces the Angiogenesis, Growth, and Metastasis of Human Gastric Cancer. Clin. Cancer Res., November 1, 2006; 12(21): 6386 - 6394. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kanai, D. Wei, Q. Li, Z. Jia, J. Ajani, X. Le, J. Yao, and K. Xie Loss of kruppel-like factor 4 expression contributes to sp1 overexpression and human gastric cancer development and progression. Clin. Cancer Res., November 1, 2006; 12(21): 6395 - 6402. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Higashi, S. Kyo, M. Inoue, H. Tanii, and K. Saijoh Novel Functional Single Nucleotide Polymorphisms in the Latent Transforming Growth Factor-{beta} Binding Protein-1L Promoter: Effect on Latent Transforming Growth Factor-{beta} Binding Protein-1L Expression Level and Possible Prognostic Significance in Ovarian Cancer J. Mol. Diagn., July 1, 2006; 8(3): 342 - 350. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muller, K. J. Sales, A. A. Katz, and H. N. Jabbour Seminal Plasma Promotes the Expression of Tumorigenic and Angiogenic Genes in Cervical Adenocarcinoma Cells via the E-Series Prostanoid 4 Receptor Endocrinology, July 1, 2006; 147(7): 3356 - 3365. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim, C. H. Baker, J. L. Abbruzzese, and S. Safe Tolfenamic acid and pancreatic cancer growth, angiogenesis, and Sp protein degradation. J Natl Cancer Inst, June 21, 2006; 98(12): 855 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Liu, N. Pore, M. Kim, K. R. Voong, M. Dowling, A. Maity, and G. D. Kao Regulation of Histone Deacetylase 4 Expression by the SP Family of Transcription Factors Mol. Biol. Cell, February 1, 2006; 17(2): 585 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Albertini, A. Jain, S. Vignati, S. Napoli, A. Rinaldi, I. Kwee, M. Nur-e-Alam, J. Bergant, F. Bertoni, G. M. Carbone, et al. Novel GC-rich DNA-binding compound produced by a genetically engineered mutant of the mithramycin producer Streptomyces argillaceus exhibits improved transcriptional repressor activity: implications for cancer therapy. Nucleic Acids Res., January 1, 2006; 34(6): 1721 - 1734. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sun, K. Guo, J. J. Rusche, and L. H. Hurley Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents Nucleic Acids Res., October 20, 2005; 33(18): 6070 - 6080. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Sales, T. List, S. C. Boddy, A. R.W. Williams, R. A. Anderson, Z. Naor, and H. N. Jabbour A Novel Angiogenic Role for Prostaglandin F2{alpha}-FP Receptor Interaction in Human Endometrial Adenocarcinomas Cancer Res., September 1, 2005; 65(17): 7707 - 7716. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim and S. Safe Cyclooxygenase-2 Inhibitors Decrease Vascular Endothelial Growth Factor Expression in Colon Cancer Cells by Enhanced Degradation of Sp1 and Sp4 Proteins Mol. Pharmacol., August 1, 2005; 68(2): 317 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Prakash, O. R. Swamy, X. Peng, Z.-Y. Tang, L. Li, J. E. Larson, J. C. Cohen, J. Gill, G. Farr, S. Wang, et al. Activation of Src kinase Lyn by the Kaposi sarcoma-associated herpesvirus K1 protein: implications for lymphomagenesis Blood, May 15, 2005; 105(10): 3987 - 3994. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lou, S. O'Reilly, H. Liang, V. M. Maher, S. D. Sleight, and J. J. McCormick Down-Regulation of Overexpressed Sp1 Protein in Human Fibrosarcoma Cell Lines Inhibits Tumor Formation Cancer Res., February 1, 2005; 65(3): 1007 - 1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, S. Brandt, and S. M. Hyder Ligand- and Cell-Specific Effects of Signal Transduction Pathway Inhibitors on Progestin-Induced Vascular Endothelial Growth Factor Levels in Human Breast Cancer Cells Mol. Endocrinol., February 1, 2005; 19(2): 312 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. McCarty Targeting Multiple Signaling Pathways as a Strategy for Managing Prostate Cancer: Multifocal Signal Modulation Therapy Integr Cancer Ther, December 1, 2004; 3(4): 349 - 380. [Abstract] [PDF] |
||||
![]() |
S. Tsutsumi, T. Yanagawa, T. Shimura, H. Kuwano, and A. Raz Autocrine Motility Factor Signaling Enhances Pancreatic Cancer Metastasis Clin. Cancer Res., November 15, 2004; 10(22): 7775 - 7784. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pore, S. Liu, H.-K. Shu, B. Li, D. Haas-Kogan, D. Stokoe, J. Milanini-Mongiat, G. Pages, D. M. O'Rourke, E. Bernhard, et al. Sp1 Is Involved in Akt-mediated Induction of VEGF Expression through an HIF-1-independent Mechanism Mol. Biol. Cell, November 1, 2004; 15(11): 4841 - 4853. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sato and K. Furukawa Transcriptional Regulation of the Human {beta}-1,4-Galactosyltransferase V Gene in Cancer Cells: ESSENTIAL ROLE OF TRANSCRIPTION FACTOR Sp1 J. Biol. Chem., September 17, 2004; 279(38): 39574 - 39583. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim, R. Smith III, R. Burghardt, and S. Safe Role of Sp Proteins in Regulation of Vascular Endothelial Growth Factor Expression and Proliferation of Pancreatic Cancer Cells Cancer Res., September 15, 2004; 64(18): 6740 - 6749. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Yao, L. Wang, D. Wei, W. Gong, M. Hassan, T.-T. Wu, P. Mansfield, J. Ajani, and K. Xie Association between Expression of Transcription Factor Sp1 and Increased Vascular Endothelial Growth Factor Expression, Advanced Stage, and Poor Survival in Patients with Resected Gastric Cancer Clin. Cancer Res., June 15, 2004; 10(12): 4109 - 4117. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wei, L. Wang, Y. He, H. Q. Xiong, J. L. Abbruzzese, and K. Xie Celecoxib Inhibits Vascular Endothelial Growth Factor Expression in and Reduces Angiogenesis and Metastasis of Human Pancreatic Cancer via Suppression of Sp1 Transcription Factor Activity Cancer Res., March 15, 2004; 64(6): 2030 - 2038. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Fuchs, C. Y. Inwards, and R. Janknecht Vascular Endothelial Growth Factor Expression is Up-Regulated by EWS-ETS Oncoproteins and Sp1 and May Represent an Independent Predictor of Survival in Ewing's Sarcoma Clin. Cancer Res., February 15, 2004; 10(4): 1344 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Neid, K. Datta, S. Stephan, I. Khanna, S. Pal, L. Shaw, M. White, and D. Mukhopadhyay Role of Insulin Receptor Substrates and Protein Kinase C-{zeta} in Vascular Permeability Factor/Vascular Endothelial Growth Factor Expression in Pancreatic Cancer Cells J. Biol. Chem., February 6, 2004; 279(6): 3941 - 3948. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, D. Wei, S. Huang, Z. Peng, X. Le, T. T. Wu, J. Yao, J. Ajani, and K. Xie Transcription Factor Sp1 Expression Is a Significant Predictor of Survival in Human Gastric Cancer Clin. Cancer Res., December 15, 2003; 9(17): 6371 - 6380. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhao, K. Venkatasubbarao, S. Li, and J. W. Freeman Requirement of a Specific Sp1 Site for Histone Deacetylase-mediated Repression of Transforming Growth Factor {beta} Type II Receptor Expression in Human Pancreatic Cancer Cells Cancer Res., May 15, 2003; 63(10): 2624 - 2630. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaluz, M. Kaluzova, and E. J. Stanbridge Expression of the Hypoxia Marker Carbonic Anhydrase IX Is Critically Dependent on SP1 Activity. Identification of a Novel Type of Hypoxia-responsive Enhancer Cancer Res., March 1, 2003; 63(5): 917 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Schafer, T. Cramer, G. Suske, W. Kemmner, B. Wiedenmann, and M. Hocker Oxidative Stress Regulates Vascular Endothelial Growth Factor-A Gene Transcription through Sp1- and Sp3-dependent Activation of Two Proximal GC-rich Promoter Elements J. Biol. Chem., February 28, 2003; 278(10): 8190 - 8198. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Reisinger, R. Kaufmann, and J. Gille Increased Sp1 phosphorylation as a mechanism of hepatocyte growth factor (HGF/SF)-induced vascular endothelial growth factor (VEGF/VPF) transcription J. Cell Sci., January 15, 2003; 116(2): 225 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Malafa, F. D. Fokum, L. Smith, and A. Louis Inhibition of Angiogenesis and Promotion of Melanoma Dormancy by Vitamin E Succinate Ann. Surg. Oncol., December 1, 2002; 9(10): 1023 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kaluz, M. Kaluzova, A. Chrastina, P. L. Olive, S. Pastorekova, J. Pastorek, M. I. Lerman, and E. J. Stanbridge Lowered Oxygen Tension Induces Expression of the Hypoxia Marker MN/Carbonic Anhydrase IX in the Absence of Hypoxia-inducible Factor 1{alpha} Stabilization: A Role for Phosphatidylinositol 3'-Kinase Cancer Res., August 1, 2002; 62(15): 4469 - 4477. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takahashi, Y. Kureishi, J. Yang, Z. Luo, K. Guo, D. Mukhopadhyay, Y. Ivashchenko, D. Branellec, and K. Walsh Myogenic Akt Signaling Regulates Blood Vessel Recruitment during Myofiber Growth Mol. Cell. Biol., July 1, 2002; 22(13): 4803 - 4814. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liang, X.-Y. Li, E. J. Rebar, P. Li, Y. Zhou, B. Chen, A. P. Wolffe, and C. C. Case Activation of Vascular Endothelial Growth Factor A Transcription in Tumorigenic Glioblastoma Cell Lines by an Enhancer with Cell Type-specific DNase I Accessibility J. Biol. Chem., May 24, 2002; 277(22): 20087 - 20094. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Salnikow, T. Kluz, M. Costa, D. Piquemal, Z. N. Demidenko, K. Xie, and M. V. Blagosklonny The Regulation of Hypoxic Genes by Calcium Involves c-Jun/AP-1, Which Cooperates with Hypoxia-Inducible Factor 1 in Response to Hypoxia Mol. Cell. Biol., March 15, 2002; 22(6): 1734 - 1741. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |