| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
Iconix Pharmaceuticals, Mountain View, California 94043
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
A key cellular response to genomic damage is the posttranslational modification of nuclear proteins in response to DNA strand breaks (2 , 3) . One known modification is the addition to specific proteins of up to 200 residues of ADP-ribose to form branched polymers. These polymers act as binding sites for repair proteins that play a central role in DNA metabolism (4) . The enzyme responsible for the addition of these polymers is PARP1.2 PARP1 associates with DNA and with chromatin-binding proteins such as histones, transcription factors, and key DNA repair proteins (4) . Although a number of nuclear proteins such as histones are substrates for PARP1, a major substrate is PARP1 itself, via automodification of the BRCA1 COOH-terminal homology region (4) . Regulation of automodification of PARP1 is twofold: through PARP1-DNA interactions and PARP1-PARP1 dimerization (5) .
PARP1 acts together with the DNA damage repair system to regulate DNA base excision repair, apoptosis, and necrosis (4)
. Studies of mouse strains lacking the PARP1 gene have identified two roles for this encoded protein, depending on the extent of DNA damage (6, 7, 8)
. Moderate damage elicits a protection response similar to that observed for checkpoint genes, leaving PARP1 knockout mice vulnerable to
-irradiation and alkylating reagents (8)
. In cases of extensive DNA damage, PARP1 activity depletes cellular energy pools, which eventually leads to cell death (3
, 6)
.
PARP1 also has a putative role in signaling DNA damage and in recruiting proteins to sites of double-strand breaks. This hypothesis was based on the ability of proteins, such as p53 and other repair enzymes, to bind to the poly(ADP) polymers present on PARP1 (4 , 9) . PARP1 inhibitors exaggerate the cytotoxic effects of DNA damage by limiting the ability of cells to regulate DNA base excision repair. In this role, PARP inhibitors are being tested as chemosensitizing agents during cancer chemotherapy (10 , 11) .
Another response to more extensive DNA damage mediated by PARP1 is the promotion of cell death, as seen in cases of ischemic injury (12) . This process can occur when PARP1 activation is highly stimulated and thus consumes large amounts of NAD, the source of ADP-ribose. This condition depletes the cellular energy stores (13) . PARP1 knockout mice are highly resistant to ischemia during steptozocin-induced type I diabetes, myocardial infarction, stroke, and neurodegeneration (6 , 14) . In support of a role for PARP1 in cell death in various inflammation processes, several studies have shown protection against cellular injury in numerous target cells by using known PARP1 inhibitors (12) .
For many years PARP1 has been the only known PARP. However, modification of cellular proteins with ADP-ribose polymers still occurs in PARP1 knockout mice, suggesting the presence of other proteins with PARP activity (15) . Indeed, new members of the PARP family have been identified based on the presence of domains that share considerable sequence similarity with the catalytic domain of PARP1 (16, 17, 18, 19, 20) . Although some members of the PARP family do not possess a well-defined Zn2+ finger DNA-binding motif or an automodification domain such as that described for PARP1, they still catalyze the formation of ADP-ribose polymers in a DNA-dependent manner and are capable of automodification (16 , 17) .
Two additional members of the PARP family are tankyrase and VPARP (18 , 20) . Tankyrase is associated with the telomerase complex that acts to regulate telomere length at replication, and VPARP is a component of a multisubunit complex referred to as a "vault" (21, 22, 23) . The name vault is based on its observed structure by electron microscopy (22) . The cellular location of VPARP is predominantly cytoplasmic; however, there is a small fraction associated with the mitotic spindle (18) . Unlike PARP1, tankyrase and VPARP are not activated by DNA damage (18 , 20) . Tankyrase modifies the telomere-binding protein TRF1 in vitro (15) . TRF1 stabilizes the ends of chromosomes, and it has been proposed that modification of TRF1 with ADP-ribose polymers serves to regulate its ability to form a loop structure at chromosome ends (15 , 23) . In other studies, tankyrase has been shown to promote telomere elongation in human cells (24) . A substrate of VPARP is the major vault protein, MVP (it is also capable of automodification); these complexes are up-regulated in multidrug-resistant cancer cell lines (25 , 26) . The various cellular locations and domain structures of the PARP family members strongly suggest that they have distinct cellular roles. Identification of selective inhibitors might help elucidate the function of these enzymes.
Poly(ADP-ribose) polymers can be removed by PARG, a member of a large family of related enzymes (27, 28, 29, 30) . This enzyme is thought to regulate the cellular function of PARP family members by removing ADP-ribose units, which results in changes in the branching pattern of the polymers (15 , 27) . There is some evidence to support the hypothesis that polymers synthesized by different PARP orthologues might be hydrolyzed by specific PARGs (27) . Although a complete understanding of the physiological activities of PARPs remains unclear, inhibitors of the activity of PARP1 and related proteins could provide new therapeutic approaches to both cancer and ischemia caused by reperfusion injury and inflammatory processes (12) .
Kaiser et al. (31) found that the constitutive expression of PARP1 in Saccharomyces cerevisiae is only possible with simultaneous inhibition of ADP-ribosylation activity through the addition of the known inhibitor 3-methoxybenzamide to the growth media. Induction of fully active PARP1 under the conditional galactose promoter led to growth arrest (31 , 32) . The growth inhibition was relieved by removal of the NH2-terminal region of PARP1 that contains the DNA-binding domain. Yeast does not possess endogenous PARP1 activity (32) , so the cause of the growth arrest is unknown. Antibodies raised against polymers of poly(ADP-ribose) were used to determine that a protein of approximately 116,000 kDa, the size of PARP1 itself, was ADP-ribosylated in yeast cells expressing PARP1 (31) . This led to the proposal that growth inhibition in yeast might occur through sequestration of chromosomal proteins by the ADP-ribose-decorated PARP1 protein rather than toxicity due to direct modification of a yeast protein by PARP (31) .
In this work, we demonstrate that PARP2, a protein closely related to PARP1, also causes growth inhibition when conditionally expressed in yeast. The reduced growth phenotype was used as an assay to screen for novel inhibitors of these proteins by selecting those compounds that can restore growth to yeast expressing PARP1 or PARP2. The inhibitors identified in our screen also inhibit recombinant PARP1 activity in vitro. Certain inhibitors show selectivity for PARP1 or PARP2. These compounds are the first to be reported that specifically recognize PARP orthologues in cells. Our data demonstrate the utility of yeast as a screening system to identify inhibitors of human genes and gene families, even when the protein is not highly conserved with any yeast proteins. Thus, our purpose is not to understand the interaction of heterologous genes with endogenous yeast proteins. Rather, we use the "biochemical activity" of the proteins expressed in yeast to obtain inhibitors that can then be used as tools to dissect function in a relevant mammalian assay.
| MATERIALS AND METHODS |
|---|
|
|
|---|
allele was deleted at bp 101 through 4149 of the PDR5 open reading frame, and the snq2
allele was deleted for bp 235 through 4105 of SNQ2, resulting in strain YPB63. To construct strain EIS20-2B, YPB63 was backcrossed to W303-1
, and retention of the pdr5
and snq2
alleles was confirmed by whole cell PCR and increased sensitivity to cyclohexamide, a toxic pump substrate (data not shown). YAN100 is an EIS20-2B derivative that contains a complete deletion of the HIS3 gene. The yeast media protocols and genetic molecular biology techniques used for these studies are standard protocols (36)
.
The genotype of the strains is as follows: (a) EIS20-2B and YPB63; MATaade2-1 his3-1115 leu2-3, 112 trp1-1, ura3-1, can1-100, pdr5
, snq2
; (b) YAN100, MATaade2-1 his3
::KanMx, leu2-3,112 trp1-1, ura3-1, canr1-100, pdr5
, snq2
; (c) W303
(-W303-1B), MATaade2-1 his3-11,15 leu2-3,112 trp1-1, ura3-1, can1-100, pdr5
, snq2
; and (d) YM4, MATa ade2-101 his3
200 leu2-3,112 trp1-1 ura3-52.
Cloning and Analysis of PARP1, PARP2, and PARG.
The cDNAs corresponding to the complete open reading frames of PARP1 and PARP2 were PCR-amplified from pooled total cDNAs initially synthesized from placental, fetal brain, and fetal liver polyadenylated mRNAs (Clontech). First- and second-strand cDNA synthesis was performed using Superscript II reverse transcriptase (Life Technologies, Inc.) as described previously (37)
. The 5' and 3' oligonucleotides for PARP1 PCR amplification were, YS5PRP (5'-GTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACGGGAGGATGGCGGAGTCTTCGGATAAG) and YS3PRP (5'-TGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCCTCTCCCAATTACCACAGGGAGGTC), respectively, and the 5' and 3' oligonucleotides for PARP2 were 5YSADP2lac (5'-GTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACGGAATTGTGAGCGGATAACAATGGCTCCAAAGCCGAAGCCCTGGGTAC) and 3YSADP2 (5'-TGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCGGGCACTCAGAGGTGGACCTCCAGC), respectively. The oligonucleotide 5YSADP21ac contains the lacO operator site. PCR amplification was carried out using either Bio-X-ACT (Bioline USA Inc., Kenilworth, NJ) or pfuTurbo (Stratagene, La Jolla, CA) high-fidelity thermostable DNA polymerases according to the manufacturers instructions. All oligonucleotides were designed to amplify their target cDNAs and carry approximately 40 bp of homology at their 5' ends with the yeast expression vector pYES2. The pYES2 vector (Invitrogen, Carlsbad, CA) contains the yeast GAL1 promoter, CYC1 transcription terminator, 2µ replication origin, and the URA3 gene.
After PCR, the amplified target cDNAs were agarose gel-purified. Approximately 50 ng of target cDNA were cotransformed with approximately 200 ng of EcoRI-digested pYES2 into W303
, and transformants were selected for uracil prototrophy. Homologous recombination of the target cDNAs into pYES2 was confirmed by yeast whole cell PCR. After the synthetic lethal phenotype of the expressed PARP1 and PARP2 was verified, plasmids from at least three independent transformants were subsequently rescued into the Escherichia coli strain XL10-GOLD (Stratagene) via electroporation and further characterized by restriction enzyme analysis and DNA sequencing of the 5' and 3' cloning junctions. These studies verified the presence of the desired structures.
During the course of this work, it was noted that the pYES2-PARP2 plasmid in E. coli was toxic (data not shown), thus the primer 5YSADP2lac incorporated a lacO repressor-binding site: this established the plasmid during its propagation in XL10-GOLD (which carries the lacIq gene). This vector construction still exhibited instability during growth in yeast. Thus the GAL1-lac-PARP2-CYC1 terminator cassette was recombinationally cloned into yeast URA3 2µ vector YEP24 (38) using the oligonucleotides Y24smacyct (5'-TCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCGGGGGCGCGCCGCAAATTAAAGCCTTCGAGC) and Y24pvu2gal1 (5'-GGGCGAGCCGCCGAAGATTAGGCAAATTTGGTCGACGGAGCGCGCAAAGCCACTACTGCCACTTTTGGAGACTGT), effectively putting the cassettes between the SmaI and PvuII sites of YEP24 and eliminating the tetracycline resistance gene.
For compound screening and subsequent genetic testing, the PARP1 and PARP2 expression cassettes were integrated into the indicated strains using the pARC series of dual episomal/integrative plasmid constructs. A brief summary will be presented in lieu of a detailed description of the steps used to construct the pARC series of vectors. The vectors are derived from the pRS series of vectors (39
, 40)
. The basic elements of the pARC plasmids include a 713-bp SphI/BamHI fragment containing the S. cerevisiae GAL1 promoter and a 243-bp Bg/II/HindIII fragment containing the GAL4 terminator region. This region surrounds a 45-bp polylinker that contains unique sites for PstI, SalI, SpeI, XhoI and AvaI and replaces the pRS polylinker; the base vector and polylinker of the pRS vectors is pBluescript II. Both CEN- and 2µ-based vectors were generated with 44 bp of the 5' end of the LYS2 gene (bp 8-52 of the LYS2 ORF) and 43 bp of the 3' end of the LYS2 gene (bp 4133-4176 of the LYS2 ORF) flanking the CEN-ARSH4 element or the 2µ replication origin. In addition, SfiI sites flank the CEN-ARSH4 or 2µ elements, such that digestion with this restriction enzyme liberates the elements and allows the subsequent integration into the endogneous LYS2 locus via a
deletion mechanism (40)
. For this work, integrants were selected for
-aminoadipate resistance and by marker prototrophy, e.g., Leu+ or Ura+; integration was confirmed by PCR.
For integration of PARP1, a SpeI/MluI (the MluI site made blunt with Klenow) GAL1-PARP1-CYC1 terminator fragment from pYES2-PARP1 was ligated into a SpeI/EcoRI-cut pARC35A, a CEN-ARSH4 LEU2 vector containing the original pBluescript II polylinker; these steps resulted in plasmid pARC35APARP1. Digestion with SfiI allowed integration of the PARP1 expression cassette into the LYS2 locus. For integration of PARP2, the GAL1-PARP2-CYC1 terminator fragment from pYES2-PARP2 was amplified by PCR using pfuTurbo with primers YSPRC (5'-GATGTATAAATGAAAGAAATTGAGATGGTGCACGATGCACAGTTGTGAATGTAAGCGTGACATAACTAATTAC, a primer containing homology at the 5' end to the GAL4 terminator) and GLUAS1 (5'-TGAAGTACGGATTAGAAGCCGCCG, a primer with homology to the GAL1 UAS element). This fragment was cotransformed into yeast with XhoI-digested pARC25B (2µ LEU2 GAL1 promoter and GAL4 terminator). As before, the recombinants were verified by phenotypic analysis and PCR before rescue into E. coli. The resulting pARC25BPARP2 plasmid was digested with SfiI and integrated into the LYS2 locus.
Phenotypic expression of the PARP1 and PARP2 clones was confirmed by constructing green fluorescent protein fusions to the COOH-terminal end of the proteins using green fluorescent protein-KanMX cassettes (41, 42, 43) . Expression was assessed via fluorescence microscopy and Western blot analysis. All active site mutations were confirmed by sequencing.
PARG was isolated and cloned using primers 5YSPARG (5'-GTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACATGAATGCGGGCCCCGGCTGTGAACC) and 3YSPARG (5'-TGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCTCAGGTCCCTGTCCTTTGCCCTGAATGGTC) to amplify the complete ORF from a testes cDNA library (37) . The purified PCR product was cotransformed with digested pYES2 plasmid into EIS20-2B, and the resulting recombinants were confirmed using whole cell PCR. Transformed isolates were subsequently reisolated and transformed into E. coli XL10-GOLD and confirmed by restriction enzyme analysis resulting in plasmid pYES2-PARG. To assess whether expressed PARG could suppress the synthetic lethality caused by PARP1 and PARP2, plasmid pYES2-PARG was transformed into EIS20-2B cells containing an integrated chromosomal copy of PARP1 or PARP2. Purified transformants were subsequently inoculated into galactose-containing media, and their growth was assayed.
PARP Activity Assays.
A PARP Activity Assay Kit (Trevigen, Inc., Gaithersburg, MD) was used to measure the functional activity of human PARP1 and PARP2. Human PARP1 (supplied in the PARP Activity Assay Kit from Trevigen, Inc.) or crude cell extracts of yeast expressing a cDNA encoding the full-length human PARP1 or PARP2 gene were used in the assay. Activity was measured by determining the level of incorporation of radiolabeled NAD in a TCA-precipitable polymer composed of ADP-ribose units.
Crude cell lysates were prepared as described by Collinge and Althaus (32) . Protein concentrations were determined using the Bio-Rad Protein Assay Kit (Bio-Rad Inc., Hercules, CA). Quantitative values for PARP activity were determined by scintillation counting of the acid-insoluble counts using 20 µg of total protein from crude cell lysates in a reaction containing 1 mM NAD, 1 mg/ml histones, 2 mCi 32P NAD, and 10 µg of sheared salmon testes DNA. The timed enzymatic reaction was initiated by the addition of the cell lysates, incubated at room temperature, and stopped by the addition of 20% TCA to precipitate ribosylated proteins. The protein precipitate was suspended in liquid scintillation fluid and analyzed using a scintillation counter. Each reaction was done in triplicate, and the results are shown as the mean counts/min.
Compound Screening of PARP1 and PARP2 Inhibitors.
Strain YPB63 containing integrated PARP1 was screened against a pilot library of 16,000 low molecular weight organic compounds as well as 22 compounds chosen based on computed three-dimensional structural similarity to the known inhibitor 6(5H)-phenanthridinone. The 22 computationally selected compounds were chosen from the Iconix corporate library, based on molecular similarity. The algorithms defining this methodology have been described previously, and they form the basis of a rapid chemical structural similarity search method (44)
. The pilot library represents a small but diverse portion of the Iconix collection, which is derived from multiple commercial sources. All screening was done in duplicate at initial compound concentrations of 10 µg/ml. Cells were grown overnight in synthetic media with 2% glucose (repressed) to late logarithmic/early stationary phase. The next day, cells were washed once with synthetic media without a carbon source and diluted to a final A600 nm of 0.04 in synthetic media containing 2% galactose (induced). The diluted cells (90 µl) were added immediately to 96-well plates containing the test compound. The final volume in each well was 100 µl and contained DMSO at a final concentration of 1%. As a control, cells containing vector (YPB63 with integrated vector plasmid) were similarly grown, washed, and diluted to the same absorbance and then inoculated.
The plates were incubated at 30°C for 40-42 h, and A600 nm was read with a microtiter plate reader (Molecular Device, Menlo Park, CA) after shaking. The effect of compounds was measured as a percentage of growth restoration using the following equation: percentage of growth restoration = (TEST - MEDarc)/(MEDvec - MEDarc) x 100, where TEST is A600 nm of the well with test compound, MEDarc is the median value of A600 nm of the cells without compound, and MEDvec is the median value of A600 nm of vector-containing cells. Compounds showing
10% of growth restoration in duplicate tests were scored as hits.
Hit Confirmation.
Hit compounds identified from the primary screening were confirmed by generating a dose-response curve using YAN100 cells expressing either PARP1 or PARP2. For the confirmation test, the compounds were solubilized from powder and serially diluted (usually from 128 µM to 0.125 µM). The compounds were tested against a vector control strain (YAN100 carrying the integrated vector) and other isogenic strains expressing different cDNAs that also elicit synthetic lethal phenotypes but are not related to PARP1.
| RESULTS |
|---|
|
|
|---|
|
|
A Known Inhibitor of PARP1, Phenanthridinone, Reversed the Growth Inhibition Caused by the Expression of PARP1 and PARP2, Thereby Validating the Assay.
To screen for small molecule inhibitors of PARP1 and PARP2, yeast strains expressing these genes from a chromosomal locus were used. The chromosomal expression of the genes increases the robustness of the screen by not allowing variation of plasmid copy number.
To further validate that the phenotype of growth inhibition observed in the integrated strains was due to the activity of PARP1 and PARP2 and that this phenotype would be amenable to compound screening (i.e., reversed by compounds), we determined whether the known chemical inhibitor 6(5H)-phenanthridinone would reverse the growth inhibition (Fig. 3)
. Yeast carrying a chromosomal copy of PARP1, PARP2, or no human cDNA was exposed to varying concentrations of 6(5H)-phenanthridinone (0128 µM; experiments performed in triplicate). Cell growth was restored when yeast was exposed to increasing concentrations of 6(5H)-phenanthridinone; the EC50 value was 10.2 µM for PARP1 and 36.3 µM for PARP2.
|
|
and snq2
strains (YPB63, which lacks the two pumps) or (W303, wild-type for PDR5 and SNQ2; see Fig. 5
|
Potential Selectivity Is Observed among the Compounds Identified as Hits in the Yeast Cell-based Screen.
To identify new classes of inhibitors, we screened the yeast strain carrying integrated PARP1 against a 16,000-member pilot library of small organic "drug-like" compounds for their ability to restore growth while PARP1 was expressed (in the presence of galactose). Ten hits showed dose-dependent growth restoration on cells expressing PARP1 (see Figs. 4
and 7
; the computationally chosen analogue ICX56259835 was also identified as a screening hit). We then tested the ability of the confirmed hits to restore growth to yeast expressing PARP2. Those values in Fig. 4
labeled NA were compounds that were found to have no activity against PARP2 at the highest concentration tested (128 µM), and ND (not determined) refers to those compounds that were not tested under the specific conditions in Fig. 4
. Unlike the results observed for the analogues of 6(5H)-phenanthridinone, some of the 10 compounds identified by screening showed patterns suggestive of selectivity for PARP1 or PARP2 (Fig. 4)
.
|
|
Dose-response curves were constructed for three of the compound hits (ICX56304405, ICX56290675, and ICX56258231) and included 6(5H)-phenanthridinone and its inactive analogue, ICX56225328 (Fig. 7)
. These results show clearly that the compounds identified in the yeast screen are direct inhibitors of PARP1.
Compounds That Restored Growth Activity Also Inhibit the Activity of PARP1 and PARP2 from Yeast Cell Extracts.
The activity of PARP1 or PARP2 in extracts from cells grown to log phase over 8 h in 2% glucose (uninduced) was negligible. However, cells grown under similar conditions but in the presence of 2% galactose (induced) showed an increase of 20-fold for PARP1 activity and 10-fold for PARP2 activity (Fig. 8)
. The screening compounds were then tested for their ability to inhibit the activity of PARP1 and PARP2 observed in the yeast extracts. All the compounds inhibited PARP activity as effectively as the known inhibitor with the exception of the inactive analogue, ICX56225328 (Fig. 9)
.
|
|
| DISCUSSION |
|---|
|
|
|---|
The chemical inhibitors found in this study confirm previous reports of small molecule PARP1 inhibitors found using other methods and demonstrate the possibility of previously unreported selective inhibition of PARP isoforms. The phenanthridinone analogues selected from our corporate library using a chemoinformatic approach were mainly of the phthalazinone class (Fig. 4)
. This nonselective class of inhibitors has been described previously and served to confirm and validate our screening approach. More interesting compounds were uncovered in the pilot screen (Fig. 6)
in terms of both potential selectivity of inhibition and chemical structure. The known phthalazinone (ICX56225770) and quinazolinone (ICX56244215, ICX56280834, ICX56290675, and ICX56304405) inhibitor classes showed modest potency. For one compound, ICX56290675, some selectivity for PARP1 was observed. The thiochromenone ICX56222404 and the benzothiazinone ICX56259537 are novel inhibitors with what appears to be more pronounced selectivity for PARP1. Finally, the results for the substituted phthalazine ICX56258231 suggest selectivity for PARP2. As discussed above, we have determined that the growth interference caused by PARP1 and PARP2 is due to their poly(ADP)-ribosylation activity. Normally the catalytic activity of PARP1 in mammalian cells is activated by double-strand DNA breaks. What activates PARP1 and PARP2 in yeast and the mechanism of the observed growth inhibition are less clear. Kaiser et al. (31)
have shown that truncation of the NH2 terminus containing the DNA-binding domain of PARP has no effect on the nuclear localization of PARP1, but can no longer cause growth interference in yeast. These results imply that the catalytic activity of PARP1 requires DNA binding in yeast. Perhaps chromosomal breaks that occur during normal metabolism, replication, and mitosis stimulate PARP activation in yeast. In mammalian cells, when DNA damage is severe, high levels of ADP-ribosylation result in a depletion of cellular NAD stores. Low NAD levels result in a failure of cellular metabolism and cell death through apoptosis (3
, 4)
. However, previous investigators have shown that the NAD levels of yeast remain unchanged when PARP is expressed, suggesting that the growth interference is not due to depletion of NAD levels and subsequent effects on cellular metabolism (31
, 32)
.
Many researchers have expressed foreign proteins in yeast to identify those that functionally complement a yeast mutation (46, 47, 48) . This approach requires the metabolic pathway affected by the yeast mutation to overlap with a conserved pathway in metazoans. The ability of a foreign protein to replace a yeast protein allows one to study variants of the human protein in a genetically tractable organism. These variants can be in the form of mutants up-regulated in a specific disease tissue or genes containing nucleotide polymorphisms.
However, yeast is not limited to the study of processes that are conserved between metazoans and yeast. Investigators have shown that yeast can be used to identify novel members of the apoptotic pathway, even though no such process exists in unicellular organisms (49, 50, 51, 52) . These investigators were able to identify two mammalian genes, using a screen based on growth interference in yeast, that inhibit the induction of apoptosis in mammalian cells (49 , 52) . As in the case for BAX and BCL2, the yeast genome does not encode a protein with similarity to PARP.
Growth interference phenotypes have not been as widely used as complementation assays for compound screening. A benefit of our screen is the elimination of false positives caused by toxic compounds because toxic compounds do not restore growth in yeast. One criticism is that growth interference phenotypes caused by the expression of a mammalian cDNA might not reflect the normal activity of the encoded protein. Therefore, screening such an assay for compounds that reverse the growth interference phenotype might not be relevant if they do not inhibit the mammalian protein but inhibit a yeast protein instead. We have routinely shown that active site mutations eliminate the growth interference in yeast caused by a wide variety of mammalian enzyme types; the active site mutation thus directly connects the biochemical activity of the introduced mammalian protein to its growth-interfering activity. In addition, we have tested a number of different families of mammalian proteins and found many that cause growth interference in yeast, e.g., kinases, small GTPases, and guanine exchange factors (data not shown). For those proteins for which a biochemical assay is available, we have tested the screening hits and observed that they act directly on the human protein;3 oftentimes the rank order potency is preserved.
Our study demonstrates the usefulness of yeast growth interference assays for the identification of chemicals that block the activity of a human protein causing the growth defect. This same approach was used to screen for inhibitors of the influenza M2 ion channel, a viral protein that results in lethality when expressed in yeast (53) . We have used cell-based assays to identify compounds that inhibit two members of the PARP family. We have shown that using these assays, we can identify compounds that specifically inhibit the biochemical activity of the mammalian protein in vitro and from yeast cell extracts. By using two members of the PARP family, we have also shown that our assays are sensitive enough to detect structural activity differences between a few compounds. Thus, the yeast cell-based assay is excellent as a means to assay mammalian proteins, even if there is no counterpart in yeast. These assays potentially allow differentiation of compound sensitivity of family members and thus define structure-activity relationships important in the development of specific inhibitors.
| FOOTNOTES |
|---|
1 To whom requests for reprints should be addressed, at Iconix Pharmaceuticals, 320 Logue Avenue, Mountain View, CA 94043. Phone: (650) 567-5508; Fax: (650) 567-5545; E-mail: tmelese{at}iconixpharm.com ![]()
2 The abbreviations used are: PARP, poly(ADP-ribose) polymerase; PARG, poly(ADP-ribose) glycohydrolase; VPARP, vault poly(ADP-ribose) polymerase; ORF, open reading frame; TCA, trichloroacetic acid. ![]()
Received 12/20/00. Accepted 3/16/01.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Eltze, R. Boer, T. Wagner, S. Weinbrenner, M. C. McDonald, C. Thiemermann, A. Burkle, and T. Klein Imidazoquinolinone, Imidazopyridine, and Isoquinolindione Derivatives as Novel and Potent Inhibitors of the Poly(ADP-ribose) Polymerase (PARP): A Comparison with Standard PARP Inhibitors Mol. Pharmacol., December 1, 2008; 74(6): 1587 - 1598. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Wierenga, K. Lai, P. Buchwald, and M. Tang High-Throughput Screening for Human Galactokinase Inhibitors J Biomol Screen, June 1, 2008; 13(5): 415 - 423. [Abstract] [PDF] |
||||
![]() |
D. W. Koh, A. M. Lawler, M. F. Poitras, M. Sasaki, S. Wattler, M. C. Nehls, T. Stoger, G. G. Poirier, V. L. Dawson, and T. M. Dawson Failure to degrade poly(ADP-ribose) causes increased sensitivity to cytotoxicity and early embryonic lethality PNAS, December 21, 2004; 101(51): 17699 - 17704. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Oliver, J.-C. Ame, S. M. Roe, V. Good, G. de Murcia, and L. H. Pearl Crystal structure of the catalytic fragment of murine poly(ADP-ribose) polymerase-2 Nucleic Acids Res., January 22, 2004; 32(2): 456 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chiarugi, E. Meli, M. Calvani, R. Picca, R. Baronti, E. Camaioni, G. Costantino, M. Marinozzi, D. E. Pellegrini-Giampietro, R. Pellicciari, et al. Novel Isoquinolinone-Derived Inhibitors of Poly(ADP-ribose) Polymerase-1: Pharmacological Characterization and Neuroprotective Effects in an in Vitro Model of Cerebral Ischemia J. Pharmacol. Exp. Ther., June 1, 2003; 305(3): 943 - 949. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Virag and C. Szabo The Therapeutic Potential of Poly(ADP-Ribose) Polymerase Inhibitors Pharmacol. Rev., September 1, 2002; 54(3): 375 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tugendreich, E. Perkins, J. Couto, P. Barthmaier, D. Sun, S. Tang, S. Tulac, A. Nguyen, E. Yeh, A. Mays, et al. A Streamlined Process to Phenotypically Profile Heterologous cDNAs in Parallel Using Yeast Cell-Based Assays Genome Res., November 1, 2001; 11(11): 1899 - 1912. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |