| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Carcinogenesis |
Department of Internal Medicine, Graduate School of Medicine, University of Tokyo, Tokyo 113-8655 [K. M., Y. S., H. F., H. M., T. Ts., S. K., K. K.]; Biodynamic Chemistry Laboratory, Tohoku University Graduate School of Life Science and Agriculture, Sendai 980-8575 [K. N., T. M.]; Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113-0033 [T. S., K. Im.]; Daiichi Pharmaceuticals, Tokyo 134-0081 [K. Is.]; Department of Pharmacology, University of Chiba, Chiba 260-8670 [T. H.]; and Department of Laboratory Medicine, Keio University School of Medicine, Tokyo 160-8582 [T. To.], Japan
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Endogenous oxidants generated by multiple intracellular pathways are an important class of naturally occurring carcinogens (8 , 9) . ROS are endogenous oxygen-containing molecules formed as normal products during aerobic metabolism (10) . ROS include a number of species such as superoxide, hydroxyl, and peroxyl radicals and certain nonradicals such as singlet oxygen and hydrogen peroxide that can be easily converted into radicals. ROS can induce genetic mutations as well as chromosomal alterations and thus contribute to cancer development in multistep carcinogenesis (11 , 12) . Moreover, a number of recent studies have demonstrated that ROS at submicromolar levels act as novel intra- and intercellular secondary messengers and thus modulate various aspects of cellular functions including proliferation, apoptosis, and gene expression (13) . Most markers of oxidative injury used reflect free radical attack on polyunsaturated fatty acids, with the classical route of attack involving lipid peroxidation, which generates hydroperoxides and endoperoxides.
In the present study, we explored the oxidant/antioxidant status in the liver of a transgenic mouse model of HCC in HCV infection, before development of HCC, by sequential quantification of hydroperoxide level, GSH level, and catalase activity and comparison of these parameters with those of age-matched nontransgenic control mice. We found an age-dependent increase in oxidative stress in the livers of transgenic mice that develop HCC in the absence of inflammation as a consequence of core protein expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals.
Unless otherwise stated, all chemicals were of reagent quality and purchased from Wako Chemicals (Tokyo, Japan).
Lipid Extraction from the Liver.
For determination of hydroperoxide levels, liver tissues were used immediately after sacrifice of the mice and never used after storage, even at -70°C, because storage inevitably results in an increase in peroxide products (17)
. Liver samples (100 mg) were homogenized in 2 ml of 0.15 M NaCl solution. Four ml of chloroform/methanol (2:1, v/v) containing 90 nM butylated hydroxytoluene as an antioxidant were added to 1 ml of homogenate and mixed vigorously for 1 min. The mixture was centrifuged at 1000 x g for 15 min. Then, the lower chloroform layer was collected and evaporated to dryness under nitrogen stream. The liver total lipids were dissolved in an appropriate amount of chloroform/methanol (2:1, v/v) and subjected to analysis (18)
.
Determination of PCOOH and PEOOH Hydroperoxides.
Hydroperoxide products of PCOOH and PEOOH in liver total lipids were determined by CL-HPLC, as described previously (18
, 19)
. The system consisted of a Jasco HPLC system (Japan Spectroscopic Co., Tokyo, Japan) and postcolumn CL detection. The HPLC column was a Jasco Finepak SIL NH2-5 (5 µm; 250 x 4.6 mm), the column mobile phase was 2-propanol/methanol/water (135:45:20, v/v/v), and the flow rate was 1.0 ml/min. Postcolumn CL detection was carried out using a CLD-100 detector (Tohoku Electronic Industries Co., Sendai, Japan), which employs a cooled photomultiplier tube, to suppress photomultiplier tube dark current and improve the S:N ratio of HPLC analysis. A mixture of luminol and cytochrome c in 50 mM borate buffer (pH 10.0) was used as a hydroperoxide-specific postcolumn CL reagent (18
, 19)
. Calibration was carried out using authentic PCOOH as a standard, as described previously (18)
. Protein concentrations were determined by Lowrys method using BSA as the protein standard.
Determination of Catalase Activity and GSH Level.
Catalase activity was measured spectrophotometrically (at 240 nm) by following the decrease in absorbance of hydrogen peroxide after the addition of 0.1 ml of supernatant to 0.9 ml of 15 nM H2O2 in 50 nM phosphate buffer (pH 6.8; Ref. 20
). Reduced GSH and GSSG levels were measured as described previously (21)
. Briefly, tissues were homogenized with Physcotron (Niti-on, Tokyo, Japan) after the addition of 4 ml/g wet tissue of 5% trichloroacetic acid containing 5 mM Na2EDTA and centrifuged at 1850 x g for 10 min. After the addition of 4-(aminosulfonyl)-7-fluoro-2,1,3-benzoxadiazole and ethyl acetate to the supernatant liquid followed by vigorous shaking, the sample was centrifuged at 3000 rpm for 5 min. Then the solution was reacted with ammonium 7-fluoro-2,1,3-benzoxadiazole under the reduction of disulfides with tri-n-butylphosphine in acetonitrile. After cooling on ice water, the solution was adjusted to pH 2 with HCl, and 10 ml of the acidic solution were injected onto the HPLC column. The total amount of GSH was computed by adding the amounts obtained for GSH and GSSG.
Spontaneous in Situ Liver Surface CL.
The spontaneous in situ surface CL of the liver was monitored using a photon counter (Johnson Research Foundation, Philadelphia, PA) with a model 9658 photomultiplier responsive over the range of 350850 nm as described elsewhere (22
, 23)
. CL in the intact organ is the result of different photoemissive reactions: ROS and lipid radicals are primary contributors to tissue CL (22
, 23)
. Intrinsic low-level light emission by living tissues is measured by a very sensitive photomultiplier. A mouse is fixed in a light-tight chamber supplied with necessary physiological equipment, and the liver is exposed to the photomultiplier, which is placed as close as possible to the organ surface. To avoid CL from other organs, the mouse is covered with aluminum foil, and only the liver is exposed to the photomultiplier. Emission was expressed in counts/s/cm2 liver surface. Spectral analysis of liver CL was performed with cutoff Kodak Wratten filters (Eastman Kodak, Rochester, NY) as described elsewhere (24)
.
Electron Microscopy.
For standard electron microscopic techniques, mouse liver was perfused with 1.6% glutaraldehyde (TAAB Laboratory Equipment, Reading, United Kingdom), excised, and fixed at 4°C for 1 h.
DNA Isolation and Analysis of mtDNA.
Total DNA was isolated from the liver as described previously (25)
. Detection of mtDNA deletion present between the direct repeats of mtDNA (direct repeat 17 corresponding to bp 979-5650 of mouse mtDNA; Ref. 26
) was performed by PCR with primers TAAGTCGTAACAAGGTAAGC (bp 979998) and GATGGTGGTAGGAGTCAAAA (bp 56505631). Amplification was carried out in a thermal cycler for a total of 35 cycles consisting of 94°C for 40 s, 50°C for 30 s, and 72°C for 2 min in 100 µl of the reaction mixture containing 200 µM deoxynucleotide triphosphates, 1.0 µM each of the primers, 1x PCR buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, and 0.001% (w/v) gelatin], and 2 units of Ampli-Taq polymerase (Perkin-Elmer Cetus Corp., Norwalk, CT). The PCR product of the intact repeat is 4671-bp long, whereas the predicted size of the deletion between the direct repeats is 3821 bp, producing a PCR deletion product of 851 bp. The PCR products were analyzed by electrophoresis in a 2% agarose gel.
Statistical Analysis.
Results are expressed as the means ± SE. The significance of the difference in means was determined by Students t test.
| RESULTS |
|---|
|
|
|---|
Lipid Peroxidation in HCV Core Gene Transgenic Mice.
We investigated the levels of lipid peroxidation as a measure of accumulated oxidative damage to membrane lipids. Lipid peroxidation is important because it amplifies the free radical production process, and its products could lead to cellular and tissue damage (27)
. Direct determination of the primary products of oxidative attack has been shown to be the most accurate measure of lipid peroxidation (28)
. We chose to determine the levels of PCOOH and PEOOH by the CL-HPLC method because these are the most reliable parameters for lipid peroxidization (18
, 19)
. We first determined the levels of PCOOH and PEOOH in the liver of young HCV core gene transgenic and nontransgenic control mice ages 312 months. There was no significant difference in the levels of PCOOH (0.89 ± 0.16 versus 0.83 ± 0.08 nmol/g protein; P = 0.46) or PEOOH (0.43 ± 0.11 versus 0.42 ± 0.14 nmol/g protein; P = 0.90) in these mice, as shown in Fig. 1A
. In contrast, in older mice that were >16 months old, when the core gene transgenic mice start to develop HCC (4
, 29)
, the levels of both PCOOH (2.30 ± 0.42 versus 0.83 ± 0.19 nmol/g protein; P < 0.01) and PEOOH (1.04 ± 0.32 versus 0.42 ± 0.15 nmol/g protein; P < 0.05) were significantly higher than those in nontransgenic control mice (Fig. 1B)
. There was a correlation between ROS generation and the level of the core protein when old core gene transgenic mice were analyzed (data not shown). The levels of PCOOH in the livers of 16-month-old simple obese mice, which showed a moderate grade of hepatic steatosis, were not significantly different from those in the livers of nontransgenic control mice (0.98 ± 0.33 versus 0.83 ± 0.19 nmol/g protein; P = 0.41). The levels of PCOOH in the livers of 16-month-old transgenic mice expressing the HCV envelope proteins under the same regulatory region as that in the core gene transgenic mice were not significantly elevated compared to nontransgenic control mice (0.79 ± 0.27 versus 0.83 ± 0.19 nmol/g protein; P = 0.82). This indicates that not the regulatory feature of protein expression driven by the hepatitis B virus regulatory region used in the current study but the expressed protein itself, i.e., the core protein, is responsible for the excessive production of ROS in the mouse liver.
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
We determined the levels of PCOOH and PEOOH in the liver as a measure of the extent of lipid peroxidization. Lipid peroxidization is the most reliable marker of excessive ROS activity in vivo and generates hydroperoxides, endoperoxides, long-lived aldehydes, and the end products malondialdehyde, ethane, and pentane (28) . Determining hydroperoxide products, particularly PCOOH or PEOOH, is one of the most reliable methods for evaluating lipid peroxidation (18) , in contrast to measuring the level of thiobarbituric acid reactive substances, which is troublesome due to a number of artifacts and nonspecific reactions (28) .
HCV core gene transgenic mice showed an increase in hydroperoxide levels in an age-dependent manner. Hydroperoxide levels were increased in old transgenic mice but not in young mice as determined by the CL-HPLC method, whereas the determination of hydroperoxide by the spontaneous in situ liver surface CL method revealed the elevation of hydroperoxide levels also in young mice. This is probably due to the difference in the two methods used. Because the spontaneous in situ liver surface CL method can be used to detect hydroperoxides generated in the liver in real time before elimination by the antioxidant system, there could be a discrepancy between determinations using this method and CL-HPLC of homogenized tissues. In fact, the antioxidant systems such as catalase and GPx were also activated in young mice, suggesting that, at a young age, the generation of hydroperoxides was counterbalanced by the antioxidant systems, but the balance was terminated when the mice became older. Catalase and GPx play important roles in cellular antioxidant defense by reducing the levels of hydroperoxides, which can otherwise be converted to highly reactive hydroxyl radicals through the metal-mediated Fenton reaction (45)
. Thus, the production of ROS was initiated in the young mice and became evident in the livers of the older core gene transgenic mice. It has been suggested that the generation of ROS increases in the brains or livers of old normal rats (46
, 47)
, but this was not observed in the livers of the parental mouse strain C57BL/6 mouse used in this study (Fig. 1, A and B)
, a finding that is harmonious with the very low incidence of spontaneous liver tumors in this strain (48
, 49)
.
Starting from the age of 2 months, there was a significantly higher incidence of mtDNA deletion in the livers of transgenic mice than in the livers of nontransgenic control mice, which may be associated with the increase in production of ROS. mtDNA is known to be 1015-fold more sensitive to oxidative damage than nuclear DNA (31
, 50)
. Enhanced ROS generation and the progressive accumulation of mtDNA damage have been described in aging rodents and human livers in degenerative diseases associated with oxidative liver damage (51, 52, 53)
. Increased ROS generation in the livers of core gene transgenic mice may lead to premature oxidative damage of hepatic mtDNA and play a part in the development of HCC. The search for gross chromosomal alterations in HCC that developed in transgenic mice is currently under way. Recent studies have demonstrated that ROS at submicromolar levels act as intracellular secondary messengers and thus regulate various aspects of cellular functions including proliferation, apoptosis, and gene expression (13)
. It would therefore be interesting to know whether or not the intracellular signaling pathways, such as nuclear factor
B or AP-1, are activated. In this mouse model, AP-1, but not nuclear factor
B, is activated.4
In the current study, a synergy was revealed between the core protein and alcohol administration with respect to the generation of hydroperoxide in mouse liver. This is of great interest because a synergy between excessive alcohol intake and HCV infection has been documented in the development of HCC in chronic hepatitis C patients (34, 35, 36) . In these studies, alcohol is one of the independent cofactors accelerating the development of HCC in chronic hepatitis C patients. Our result may explain this synergy in chronic hepatitis C patients. In addition, there was a greater increase in hydroperoxide levels in CCl4-treated transgenic mice than in CCl4-treated nontransgenic control mice: the difference, however, was not statistically significant, which may be due to the fact that CCl4 is a very strong inducer of ROS (54) . These results indicate that the HCV core protein not only induces ROS production in hepatocytes but also predisposes hepatocytes to the generation of more ROS when stimulated by ROS-inducing factors such as alcohol or inflammation. In this sense, ROS production in hepatitis C might differ, by the presence of the HCV core protein, from that in hepatitis caused by other factors; e.g., autoimmune chronic active hepatitis, which is not associated with HCC development (55 , 56) .
In this mouse model for HCV-associated hepatocarcinogenesis, the development of HCC is preceded by hepatic steatosis, which is one of the histological characteristics of hepatitis C (57) . Steatosis in core gene transgenic mice is age dependent and characterized by the appearance of micro- and macrovesicular fat droplets (4) . The pathogenesis of steatosis in these mice is not completely clear, but both the ß-oxidation of fatty acids in mitochondria and secretion of triacylglycerol from the liver were found to be impaired.5 Because no significant elevation was observed in the levels of hydroperoxide in steatite liver tissues from mice with simple obesity, not steatosis but the core protein per se or steatosis with the core protein may play a central role in the generation of ROS in the transgenic mouse liver. It is not yet clear how the core protein induces ROS overproduction. However, we recently obtained some evidence in the core gene transgenic mice suggesting an impairment of the mitochondrial electron transfer system,5 which leads to the ROS overproduction (58) . This may explain how excessive ROS are produced in the liver of HCV core gene transgenic mice. This may also explain the mechanism of synergy between alcohol and the core protein in inducing ROS. Alcohol has been shown to induce ROS in the liver through acetaldehyde formation and mitochondrial damage and so forth. (59) . Therefore, a low dose of alcohol, which is not enough to induce ROS by itself, can be synergistic with the core protein.
In conclusion, our results indicate that the HCV core protein induces ROS in the liver in the absence of inflammation, which may be responsible in part for the development of HCC in this mouse model as well as in chronic hepatitis C patients. Other mechanisms, such as modulation of cellular gene expression by the core protein or interaction of the core protein with cellular proteins, may also play a role in the development of HCC.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported in part by a Grant-in-Aid for Scientific Research on Priority Area (C) from the Ministry of Education, Science, Sports and Culture of Japan and by grants from the Sankyo Foundation of Life Science and the Life Science Foundation of Japan. ![]()
2 To whom requests for reprints should be addressed, at Department of Infectious Diseases, Department of Internal Medicine, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan. Phone: 81-3-5800-8801; Fax: 81-3-5800-8807; E-mail: kkoike-tky{at}umin.ac.jp ![]()
3 The abbreviations used are: HCV, hepatitis C virus; HCC, hepatocellular carcinoma; PCOOH, phosphatidylcholine; ROS, reactive oxygen species; PEOOH, phosphatidylethanolamine; CL, chemiluminescence; HPLC, high-performance liquid chromatography; GSH, glutathione; GSSG, oxidized glutathione; GPx, glutathione peroxidase; mtDNA, mitochondrial DNA; AP-1, activator protein 1. ![]()
4 T. Tsutsumi, T. Suzuki, K. Moriya, H. Yotsuyanagi, Y. Shintani, H. Fujie, Y. Matsuura, S. Kimura, K. Koike, and T. Miyamura. HCV core protein modulates expression of intrahepatic cytokines and activates AP-1 in transgenic mice, submitted for publication. ![]()
5 K. Moriya, T. Todoroki, K. Watanabe, H. Fujie, Y. Shintani, T. Tsutsumi, H. Miyoshi, K. Ishibashi, T. Takayama, M. Makuuchi, T. Miyamura, S. Kimura, and K. Koike, unpublished data. ![]()
Received 10/23/00. Accepted 3/21/01.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Kuroki, Y. Ariumi, M. Ikeda, H. Dansako, T. Wakita, and N. Kato Arsenic Trioxide Inhibits Hepatitis C Virus RNA Replication through Modulation of the Glutathione Redox System and Oxidative Stress J. Virol., March 1, 2009; 83(5): 2338 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Machida, H. Tsukamoto, H. Mkrtchyan, L. Duan, A. Dynnyk, H. M. Liu, K. Asahina, S. Govindarajan, R. Ray, J.-h. J. Ou, et al. Toll-like receptor 4 mediates synergism between alcohol and HCV in hepatic oncogenesis involving stem cell marker Nanog PNAS, February 3, 2009; 106(5): 1548 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ibusuki, K. Nakagawa, A. Asai, S. Oikawa, Y. Masuda, T. Suzuki, and T. Miyazawa Preparation of pure lipid hydroperoxides J. Lipid Res., December 1, 2008; 49(12): 2668 - 2677. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tran The role of hepatitis C virus in the pathogenesis of hepatocellular carcinoma Bioscience Horizons, June 1, 2008; 1(2): 167 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ohishi, S. Fujiwara, J. B. Cologne, G. Suzuki, M. Akahoshi, N. Nishi, I. Takahashi, and K. Chayama Risk Factors for Hepatocellular Carcinoma in a Japanese Population: A Nested Case-Control Study Cancer Epidemiol. Biomarkers Prev., April 1, 2008; 17(4): 846 - 854. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Peng, L.-Q. Li, M.-H. Peng, Z.-M. Liu, T.-W. Liu, Y. Guo, K.-Y. Xiao, Z. Qin, X.-P. Ye, X.-S. Mo, et al. Evaluation of oxidative stress in a group of adolescents exposed to a high level of aflatoxin B1 a multi-center and multi-biomarker study Carcinogenesis, November 1, 2007; 28(11): 2347 - 2354. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Thursz Iron, haemochromatosis and thalassaemia as risk factors for fibrosis in hepatitis C virus infection Gut, May 1, 2007; 56(5): 613 - 614. [Full Text] [PDF] |
||||
![]() |
H. Miyamoto, K. Moriishi, K. Moriya, S. Murata, K. Tanaka, T. Suzuki, T. Miyamura, K. Koike, and Y. Matsuura Involvement of the PA28{gamma}-Dependent Pathway in Insulin Resistance Induced by Hepatitis C Virus Core Protein J. Virol., February 15, 2007; 81(4): 1727 - 1735. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y Sato, J Kato, R Takimoto, K Takada, Y Kawano, K Miyanishi, M Kobune, Y Sato, T Takayama, T Matunaga, et al. Hepatitis C virus core protein promotes proliferation of human hepatoma cells through enhancement of transforming growth factor {alpha} expression via activation of nuclear factor-{kappa}B Gut, December 1, 2006; 55(12): 1801 - 1808. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakai, T. Okamoto, T. Kimura-Someya, K. Ishii, C. K. Lim, H. Tani, E. Matsuo, T. Abe, Y. Mori, T. Suzuki, et al. Oligomerization of Hepatitis C Virus Core Protein Is Crucial for Interaction with the Cytoplasmic Domain of E1 Envelope Protein J. Virol., November 15, 2006; 80(22): 11265 - 11273. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. MacCallum, S. C. Jack, P. A. Egan, B. T. McDermott, R. M. Elliott, and S.-W. Chan Cap-dependent and hepatitis C virus internal ribosome entry site-mediated translation are modulated by phosphorylation of eIF2{alpha} under oxidative stress. J. Gen. Virol., November 1, 2006; 87(Pt 11): 3251 - 3262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Choi and J.-H. James Ou Mechanisms of Liver Injury. III. Oxidative stress in the pathogenesis of hepatitis C virus Am J Physiol Gastrointest Liver Physiol, May 1, 2006; 290(5): G847 - G851. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Yuan, Y.-T. Gao, C.-N. Ong, R. K. Ross, and M. C. Yu Prediagnostic level of serum retinol in relation to reduced risk of hepatocellular carcinoma. J Natl Cancer Inst, April 5, 2006; 98(7): 482 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Korenaga, T. Wang, Y. Li, L. A. Showalter, T. Chan, J. Sun, and S. A. Weinman Hepatitis C Virus Core Protein Inhibits Mitochondrial Electron Transport and Increases Reactive Oxygen Species (ROS) Production J. Biol. Chem., November 11, 2005; 280(45): 37481 - 37488. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Suzuki, S. Sakamoto, T. Tsutsumi, A. Rikimaru, K. Tanaka, T. Shimoike, K. Moriishi, T. Iwasaki, K. Mizumoto, Y. Matsuura, et al. Molecular Determinants for Subcellular Localization of Hepatitis C Virus Core Protein J. Virol., January 15, 2005; 79(2): 1271 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Nascimento, M. E. Suliman, A. Bruchfeld, S. Y. Hayashi, R. C. Manfro, A. R. Qureshi, R. Pecoits-Filho, M. A. Pachaly, L. Renner, P. Stenvinkel, et al. The influence of hepatitis C and iron replacement therapy on plasma pentosidine levels in haemodialysis patients Nephrol. Dial. Transplant., December 1, 2004; 19(12): 3112 - 3116. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Thoren, A. Romero, M. Lindh, C. Dahlgren, and K. Hellstrand A hepatitis C virus-encoded, nonstructural protein (NS3) triggers dysfunction and apoptosis in lymphocytes: role of NADPH oxidase-derived oxygen radicals J. Leukoc. Biol., December 1, 2004; 76(6): 1180 - 1186. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schwer, S. Ren, T. Pietschmann, J. Kartenbeck, K. Kaehlcke, R. Bartenschlager, T. S. B. Yen, and M. Ott Targeting of Hepatitis C Virus Core Protein to Mitochondria through a Novel C-Terminal Localization Motif J. Virol., August 1, 2004; 78(15): 7958 - 7968. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Alonzi, C. Agrati, B. Costabile, C. Cicchini, L. Amicone, C. Cavallari, C. D. Rocca, A. Folgori, C. Fipaldini, F. Poccia, et al. Steatosis and intrahepatic lymphocyte recruitment in hepatitis C virus transgenic mice J. Gen. Virol., June 1, 2004; 85(6): 1509 - 1520. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hino and K. Okita Interferon therapy as chemoprevention of hepatocarcinogenesis in patients with chronic hepatitis C J. Antimicrob. Chemother., January 1, 2004; 53(1): 19 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bergqvist, S. Sundstrom, L. Y. Dimberg, E. Gylfe, and M. G. Masucci The Hepatitis C Virus Core Protein Modulates T Cell Responses by Inducing Spontaneous and Altering T-cell Receptor-triggered Ca2+ Oscillations J. Biol. Chem., May 23, 2003; 278(21): 18877 - 18883. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Isoyama, S. Kuge, and A. Nomoto The Core Protein of Hepatitis C Virus Is Imported into the Nucleus by Transport Receptor Kap123p but Inhibits Kap121p-dependent Nuclear Import of Yeast AP1-like Transcription Factor in Yeast Cells J. Biol. Chem., October 11, 2002; 277(42): 39634 - 39641. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |