| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Tumor Biology, The Johns Hopkins Oncology Center, Baltimore, Maryland 21231 [M. E., S. B. B., J. G. H.]; Cancer Epigenetics Laboratory, Molecular Pathology Program, Centro Nacional de Investigaciones Oncologicas, Majadahonda 28220, Spain [M. E.]; First Department of Internal Medicine, Sapporo Medical University, Sapporo 060-8543, Japan [M. T.]; Institut Catala dOncologia and Institut de Recerca Oncologica, Hospital Duran i Reynals, Barcelona, Catalonia 08907, Spain [R-A. R., G. C., V. M., M. A. P.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Abnormalities in DNA repair and replication have long been considered as key elements in the genesis of mutations. Several mechanisms can be invoked to contribute to the infidelity of DNA synthesis, including imbalances in deoxynucleotide triphosphate pools, mutations in DNA polymerase-
, and slippage of DNA polymerase at nucleotide repeats (4, 5, 6)
. However, the relevance of each mechanism and candidate gene is still unknown. Recently, epigenetic alterations in two DNA repair genes, the mismatch repair gene hMLH1 and MGMT,3
have been linked to very specific genetic mutations in sporadic tumors (7, 8, 9, 10, 11)
. Germ-line mutations in the two DNA mismatch repair genes hMLH1 and hMSH2 are the genetic abnormalities responsible for the vast majority of hereditary nonpolyposis colorectal carcinoma cases (reviewed in Ref. 12
), where the presence of deletions and insertions in the microsatellite sequence is a common hallmark. However, in the nonfamilial cases, the presence of microsatellite instability is attributable to methylation-associated silencing of hMLH1 (7, 8, 9, 10, 11)
, which leads ultimately to mutations in target genes such as Bax or TGFRßII (reviewed in Ref. 13
).
The case of MGMT is also particularly interesting. The persistence of O6-methylguanine adducts, resulting from alkylating agents, may cause DNA polymerase to misread the base pairing because of the altered hydrogen-bonding properties of a base that contains an additional methyl or ethyl group. Thus, O6-methylguanine is read as an adenine and mispairs with thymine (14) . Supporting this data, the most common mutations caused by alkylating agents are G:C to A:T transitions (14) , exemplified in the frequent generation of G to A transitions in the oncogene K-ras when the carcinogen N-methylnitrosourea (that forms O6-methylguanine adducts) is used in experimentally induced tumor systems (15) . Avoidance of the mutagenic effect is directly related to the presence of a functional MGMT protein (16) . MGMT removes alkyl groups, as well as larger adducts involving chloroethylations, at the O6 position of guanine in a reaction that inactivates one MGMT molecule for each lesion repaired. In vitro assays show that endogenous MGMT expression protects mammalian cell lines from spontaneous G:C to A:T transitions in the aprt gene (17) . Animal models also show that transgenic mice overexpressing MGMT are protected against O6-methylguanine-DNA adducts caused by methylnitrosourea (18) and against G to A mutations in K-ras in aberrant colorectal crypt foci and lung tumors (19 , 20) . Furthermore, we have recently shown that MGMT is transcriptionally silenced by promoter hypermethylation in a wide spectrum of human neoplasms (21) and provided the first evidence in human primary tumors of the linkage between MGMT epigenetic inactivation and the appearance of G to A mutations in K-ras (11) .
MGMT inactivation is not likely to be limited to an association with only K-ras mutations. The tumor suppressor p53 is the most commonly mutated gene in human cancer, and transition mutations constitute the main type of p53 mutations observed (22
, 23)
. Approximately 52% of the mutational events are missense transitional changes, and, of this subset,
72% are G:C to A:T transitions (22)
. The profile of the mutational spectrum varies according to the tumor type. Lung and head and neck tumors of smokers have a higher number of transversions, whereas colorectal tumors have the highest rate of transition mutations, reaching 70% of the total number of p53 mutations (22)
. These last mutations occur frequently in CpG dinucleotides, which are normally methylated (23, 24, 25)
, through increased rates of spontaneous deamination at methylcytosine; although other mechanisms are also conceivable. However, 17% of p53 mutations are transition mutations in non-CpG dinucleotides, where this causality cannot be invoked (22)
.
Thus, G:C to A:T changes in p53 in non-CpG and CpG dinucleotides could be attributable, in part, to a defect in MGMT that allows the persistence of O6-methylguanine and its reading as an adenine. To address this question, we have examined in a large collection of colorectal tumors (n = 314) whether the presence of MGMT epigenetic inactivation was linked to transition mutations in p53. Our data show that promoter hypermethylation of MGMT is strongly linked to the presence of G:C to A:T transition mutations in p53, particularly in non-CpG dinucleotides.
| Materials and Methods |
|---|
|
|
|---|
Methylation-specific PCR.
DNA methylation patterns in the CpG island of MGMT were determined by chemical modification of the unmethylated, but not the methylated, cytosines to uracil and subsequent PCR using primers specific for either methylated or the modified unmethylated DNA (21
, 26) . Primer sequences of MGMT for the unmethylated reaction were 5'-TTT GTG TTT TGA TGT TTG TAG GTT TTT GT-3' (upper primer) and 5'-AAC TCC ACA CTC TTC CAA AAA CAA AAC A-3' (lower primer); for the methylated reaction they were 5'-TTT CGA CGT TCG TAG GTT TTC GC-3' (upper primer) and 5'-GCA CTC TTC CGA AAA CGA AAC G-3' (lower primer). The annealing temperature was 59°C. Placental DNA treated in vitro with Sss I methyltransferase (New England Biolabs) was used as positive control for methylated alleles of MGMT, and DNA from normal lymphocytes was used as negative control for methylated alleles of MGMT.
Briefly, 1 µg of DNA was denatured by NaOH and modified by sodium bisulfite. Then DNA samples were purified using Wizard DNA purification resin (Promega), again treated with NaOH, precipitated with ethanol, and resuspended in water. Controls without DNA were performed for each set of PCR. Ten µl of each PCR reaction was directly loaded onto nondenaturing 6% polyacrylamide gels, stained with ethidium bromide, and visualized under UV illumination.
Detection of p53 Mutations.
p53 mutations in exons 49 were analyzed by single-strand conformational polymorphism analysis. Briefly, a first PCR was performed using primers 12979U (GCT GCC GTG TTC CAG TTG CT) and 14875D (AGG CAT CAC TGC CCC CTG AT). The resulting 1897-bp fragment was then used as a template to amplify separately a fragment of 410 bp including exons 5 and 6 (with primers 13054U, TAC TCC CCT GCC CTC AAC AAG; and 13463D, CTC CTC CCA GAG ACC CCA GT) and a fragment of 622 bp including exons 7 and 8 (with primers 13966U, CTGGCCTCATCTTGGGCCTG; and 14587D, CTCGCTTAGTGCTCCCTGGG). These two fragments were then digested with the restriction enzyme HpaII, and the resulting fragments were run on a 6% polyacrylamide gel without glycerol (0.2 h at 30 W and 56 h at 6 W) and with 10% glycerol (0.2 h at 30 W and 1314 h at 6 W) to detect mobility shifts. Mutations were confirmed by direct cycle sequencing of the PCR products using the AmpliCycle Sequencing Kit (Perkin-Elmer, Branchburg, NJ). Exons 4 and 9 were only analyzed on those samples negative for mutations in exons 58. Exon 4 was amplified directly from DNA using primers 12019U (GTC CCC CTT GCC GTC CCA AG) and 12349D (TAC GGC CAG GCA TTG AAG TC). The resulting 331-bp fragment was run without previous digestion on a 6% polyacrilamide/10% glycerol gel for 0.2 h at 30 W and for 19 h at 6 W. To analyze exon 9, a fragment of 788 bp including exons 79 was amplified with primers 13966U (CTG GCC TCA TCT TGG GCC TG) and 14753D (CTG AAG GGT GAA ATA TTC TCC) and digested with HhaI to produce two fragments of 548 and 240 bp, the last one containing exon 9.
| Results |
|---|
|
|
|---|
|
| Discussion |
|---|
|
|
|---|
Our finding that MGMT promoter hypermethylation is associated with the presence of G:C to A:T transition mutations in p53 provides another target gene for MGMT-deficiency in human cancer cells, after the initial linkage between MGMT methylation and G to A mutations in K-ras (11) . We have been able to observe a direct relation between MGMT aberrant methylation and G:C to A:T transitions in p53 in colorectal tumors, even with the "masking" effect attributable to spontaneous deamination of the methylcytosine in the CpG dinucleotide. It is not known at the present moment which is the real quantitative contribution of each lesion, a promutagenic O6-methylguanine or a methylcytosine, to the appearance of p53 mutations. However, when the G:C to A:T mutation occurs in a non-CpG dinucleotide, the association with MGMT inactivation is clearly evident.
The relation observed with p53 is itself highly relevant, because transition mutations of p53 in human cancer are common and happen in all malignant cell types. Some of these tumors, such as those derived from the brain, lung, head and neck, and lymphomas, also have MGMT hypermethylation-associated inactivation (21) . Thus, the epigenetic defect in the MGMT gene may be proposed as a clear predisposition factor to acquire p53 transition mutations also in these cell types. In the case of colorectal tumors, the promutagenic lesion affecting the O6-guanine can be caused by alkylating agents provided from dietary nitrates reduced in the proximal colon by bacteria or by nitrosation of amines and amides derived from protein catabolism (30, 31, 32) . Interestingly, the appearance of gliomas, the second tumor type with a higher rate of MGMT methylation, also has been related to nitrosamine exposure (33) , and the presence of MGMT promoter hypermethylation "marks" those tumors highly sensitive to chemotherapy (34) . Additional evidence of causality between the epigenetic and genetic event is provided by the timing of both alterations. MGMT abnormal methylation can be found in early lesions, such as colorectal adenomas, preceding the appearance of p53 mutations in the more advanced stages.
Another very interesting aspect, derived from our present research, that needs to be studied further in the future is to know how many target genes and sequences can be affected by the lack of MGMT repair capacity. Putative target genes where similar associations may be observed include other tumor suppressor genes or oncogenes such as H-ras and N-ras. It is even possible, using the similarity with the mismatch repair deficiency, that those tumors with MGMT promoter hypermethylation have a special mutator phenotype characterized for numerous transition mutations, some affecting important genes, others affecting only repeated sequences, through their genomes. Overall, our data strongly suggest that the silencing of the DNA repair gene MGMT by promoter hypermethylation confers to the cancer cell additional mutability, specifically the capacity to acquire G:C to A:T transition mutations. This finding provides us with another example, like hMLH1, of how epigenetic lesions can cause genetic lesions.
| FOOTNOTES |
|---|
1 Supported in part by NIH Grant CA54396 and grants from the Fondo de Investigacion Sanitaria and the Comision Interministerial de Ciencia y Tecnología. R. A. R. was a fellow of the Comissio Interdepartamental de Recerca i Innovacio Tecnologica (CIRIT). ![]()
2 To whom requests for reprints should be addressed, at Tumor Biology, The Johns Hopkins Oncology Center, Room 543, 1650 Orleans Street, Baltimore, MD 21231. Phone: (410) 955-8506; Fax: (410) 614-9884; E-mail: hermanji{at}welchlink.welch.jhu.edu ![]()
3 The abbreviation used is: MGMT, O6-methylguanine-DNA methyltransferase. ![]()
Received 3/21/01. Accepted 5/ 1/01.
| REFERENCES |
|---|
|
|
|---|
. Proc. Natl. Acad. Sci. USA, 80: 797-801, 1983.This article has been cited by other articles:
![]() |
S. de Vogel, M. P. Weijenberg, J. G. Herman, K. A. D. Wouters, A. F. P. M. de Goeij, P. A. van den Brandt, A. P. de Bruine, and M. van Engeland MGMT and MLH1 promoter methylation versus APC, KRAS and BRAF gene mutations in colorectal cancer: indications for distinct pathways and sequence of events Ann. Onc., July 1, 2009; 20(7): 1216 - 1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Sepulveda, D. Jones, S. Ogino, W. Samowitz, M. L. Gulley, R. Edwards, V. Levenson, V. M. Pratt, B. Yang, K. Nafa, et al. CpG Methylation Analysis--Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics: A Report of the Association for Molecular Pathology J. Mol. Diagn., July 1, 2009; 11(4): 266 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Billson, K. L. Harrison, N. P. Lees, C. N. Hall, G. P. Margison, and A. C. Povey Dietary variables associated with DNA N7-methylguanine levels and O6-alkylguanine DNA-alkyltransferase activity in human colorectal mucosa Carcinogenesis, April 1, 2009; 30(4): 615 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Asaka, Y. Arai, Y. Nishimura, K. Yamaguchi, T. Ishikubo, T. Yatsuoka, Y. Tanaka, and K. Akagi Microsatellite instability-low colorectal cancer acquires a KRAS mutation during the progression from Dukes' A to Dukes' B Carcinogenesis, March 1, 2009; 30(3): 494 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Vogelbaum, B. Berkey, D. Peereboom, D. Macdonald, C. Giannini, J. H. Suh, R. Jenkins, J. Herman, P. Brown, D. T. Blumenthal, et al. Phase II trial of preirradiation and concurrent temozolomide in patients with newly diagnosed anaplastic oligodendrogliomas and mixed anaplastic oligoastrocytomas: RTOG BR0131 Neuro-oncol, January 1, 2009; 11(2): 167 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Suehiro, C. W. Wong, L. R. Chirieac, Y. Kondo, L. Shen, C. R. Webb, Y. W. Chan, A. S.Y. Chan, T. L. Chan, T.-T. Wu, et al. Epigenetic-Genetic Interactions in the APC/WNT, RAS/RAF, and P53 Pathways in Colorectal Carcinoma Clin. Cancer Res., May 1, 2008; 14(9): 2560 - 2569. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ogino, T. Kawasaki, G. J Kirkner, Y. Suemoto, J. A Meyerhardt, and C. S Fuchs Molecular correlates with MGMT promoter methylation and silencing support CpG island methylator phenotype-low (CIMP-low) in colorectal cancer Gut, November 1, 2007; 56(11): 1564 - 1571. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sanchez-de-Abajo, M. de la Hoya, M. van Puijenbroek, A. Tosar, J.A. Lopez-Asenjo, E. Diaz-Rubio, H. Morreau, and T. Caldes Molecular Analysis of Colorectal Cancer Tumors from Patients with Mismatch Repair Proficient Hereditary Nonpolyposis Colorectal Cancer Suggests Novel Carcinogenic Pathways Clin. Cancer Res., October 1, 2007; 13(19): 5729 - 5735. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. V. Jacinto and M. Esteller Mutator pathways unleashed by epigenetic silencing in human cancer Mutagenesis, July 1, 2007; 22(4): 247 - 253. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Brena and J. F. Costello Genome-epigenome interactions in cancer Hum. Mol. Genet., April 15, 2007; 16(R1): R96 - R105. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Herceg Epigenetics and cancer: towards an evaluation of the impact of environmental and dietary factors Mutagenesis, March 1, 2007; 22(2): 91 - 103. [Abstract] [Full Text] [PDF] |
||||
![]() |
N P Lees, K L Harrison, C N Hall, G P Margison, and A C Povey Human colorectal mucosal O6-alkylguanine DNA-alkyltransferase activity and DNA-N7-methylguanine levels in colorectal adenoma cases and matched referents Gut, March 1, 2007; 56(3): 380 - 384. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Ishii, J Murakami, K Notohara, H M Cullings, H Sasamoto, T Kambara, Y Shirakawa, Y Naomoto, M Ouchida, K Shimizu, et al. Oesophageal squamous cell carcinoma may develop within a background of accumulating DNA methylation in normal and dysplastic mucosa Gut, January 1, 2007; 56(1): 13 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
J J L Wong, N J Hawkins, and R L Ward Colorectal cancer: a model for epigenetic tumorigenesis Gut, January 1, 2007; 56(1): 140 - 148. [Full Text] [PDF] |
||||
![]() |
L. Wang, H. Liu, Z. Zhang, M. R. Spitz, and Q. Wei Association of Genetic Variants of O6-Methylguanine-DNA Methyltransferase with Risk of Lung Cancer in Non-Hispanic Whites Cancer Epidemiol. Biomarkers Prev., December 1, 2006; 15(12): 2364 - 2369. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. de Vogel, M. van Engeland, M. Luchtenborg, A. P. de Bruine, G. M. J. M. Roemen, M. H. F. M. Lentjes, R. A. Goldbohm, P. A. van den Brandt, A. F. P. M. de Goeij, and M. P. Weijenberg Dietary Folate and APC Mutations in Sporadic Colorectal Cancer J. Nutr., December 1, 2006; 136(12): 3015 - 3021. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guo, J. Ren, M. G. House, Y. Qi, M. V. Brock, and J. G. Herman Accumulation of Promoter Methylation Suggests Epigenetic Progression in Squamous Cell Carcinoma of the Esophagus Clin. Cancer Res., August 1, 2006; 12(15): 4515 - 4522. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Ogino, M Cantor, T Kawasaki, M Brahmandam, G J Kirkner, D J Weisenberger, M Campan, P W Laird, M Loda, and C S Fuchs CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies Gut, July 1, 2006; 55(7): 1000 - 1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Fox, D. T. Leahy, R. Geraghty, H. E. Mulcahy, D. Fennelly, J. M. Hyland, D. P. O'Donoghue, and K. Sheahan Mutually Exclusive Promoter Hypermethylation Patterns of hMLH1 and O6-Methylguanine DNA Methyltransferase in Colorectal Cancer J. Mol. Diagn., February 1, 2006; 8(1): 68 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Giovannucci and S. Ogino DNA Methylation, Field Effects, and Colorectal Cancer J Natl Cancer Inst, September 21, 2005; 97(18): 1317 - 1319. [Full Text] [PDF] |
||||
![]() |
J. K. Wiencke, K. Aldape, A. McMillan, J. Wiemels, M. Moghadassi, R. Miike, K. T. Kelsey, J. Patoka, J. Long, and M. Wrensch Molecular Features of Adult Glioma Associated with Patient Race/Ethnicity, Age, and a Polymorphism in O6-Methylguanine-DNA-Methyltransferase Cancer Epidemiol. Biomarkers Prev., July 1, 2005; 14(7): 1774 - 1783. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Halford, A Rowan, E Sawyer, I Talbot, and I Tomlinson O6-methylguanine methyltransferase in colorectal cancers: detection of mutations, loss of expression, and weak association with G:C>A:T transitions Gut, June 1, 2005; 54(6): 797 - 802. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Brandes, M. van Engeland, K. A.D. Wouters, M. P. Weijenberg, and J. G. Herman CHFR promoter hypermethylation in colon cancer correlates with the microsatellite instability phenotype Carcinogenesis, June 1, 2005; 26(6): 1152 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koga, Y. Kitajima, A. Miyoshi, K. Sato, K. Kitahara, H. Soejima, and K. Miyazaki Tumor Progression Through Epigenetic Gene Silencing of O6-Methylguanine-DNA Methyltransferase in Human Biliary Tract Cancers Ann. Surg. Oncol., May 1, 2005; 12(5): 354 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R.J. Kohonen-Corish, J. J. Daniel, C. Chan, B. P.C. Lin, S. Y. Kwun, O. F. Dent, V. S. Dhillon, R. J.A. Trent, P. H. Chapuis, and E. L. Bokey Low Microsatellite Instability Is Associated With Poor Prognosis in Stage C Colon Cancer J. Clin. Oncol., April 1, 2005; 23(10): 2318 - 2324. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Frigola, X. Sole, M. F. Paz, V. Moreno, M. Esteller, G. Capella, and M. A. Peinado Differential DNA hypermethylation and hypomethylation signatures in colorectal cancer Hum. Mol. Genet., January 15, 2005; 14(2): 319 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nagasaka, H. Sasamoto, K. Notohara, H. M. Cullings, M. Takeda, K. Kimura, T. Kambara, D. G. MacPhee, J. Young, B. A. Leggett, et al. Colorectal Cancer With Mutation in BRAF, KRAS, and Wild-Type With Respect to Both Oncogenes Showing Different Patterns of DNA Methylation J. Clin. Oncol., November 15, 2004; 22(22): 4584 - 4594. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Lees, K. L. Harrison, C. N. Hall, G. P. Margison, and A. C. Povey Reduced MGMT activity in human colorectal adenomas is associated with K-ras GC->AT transition mutations in a population exposed to methylating agents Carcinogenesis, July 1, 2004; 25(7): 1243 - 1247. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zuo, L. Ai, P. Ratliff, J. Y. Suen, E. Hanna, T. P. Brent, and C.-Y. Fan O6-Methylguanine-DNA Methyltransferase Gene: Epigenetic Silencing and Prognostic Value in Head and Neck Squamous Cell Carcinoma Cancer Epidemiol. Biomarkers Prev., June 1, 2004; 13(6): 967 - 975. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T.C. Chan, Q. Tao, K. D. Robertson, I. W. Flinn, R. B. Mann, B. Klencke, W. H. Kwan, T. W.-T. Leung, P. J. Johnson, and R. F. Ambinder Azacitidine Induces Demethylation of the Epstein-Barr Virus Genome in Tumors J. Clin. Oncol., April 15, 2004; 22(8): 1373 - 1381. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kopelovich, J. A. Crowell, and J. R. Fay The Epigenome as a Target for Cancer Chemoprevention J Natl Cancer Inst, December 3, 2003; 95(23): 1747 - 1757. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nagasaka, G. B. Sharp, K. Notohara, T. Kambara, H. Sasamoto, H. Isozaki, D. G. MacPhee, J. R. Jass, N. Tanaka, and N. Matsubara Hypermethylation of O6-Methylguanine-DNA Methyltransferase Promoter May Predict Nonrecurrence after Chemotherapy in Colorectal Cancer Cases Clin. Cancer Res., November 1, 2003; 9(14): 5306 - 5312. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, J. M. Cunningham, J. L. Winters, J. C. Guenther, A. J. French, L. A. Boardman, L. J. Burgart, S. K. McDonnell, D. J. Schaid, and S. N. Thibodeau BRAF Mutations in Colon Cancer Are Not Likely Attributable to Defective DNA Mismatch Repair Cancer Res., September 1, 2003; 63(17): 5209 - 5212. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, W. Lu, X. Miao, D. Xing, W. Tan, and D. Lin Inactivation of DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation and its relation to p53 mutations in esophageal squamous cell carcinoma Carcinogenesis, June 1, 2003; 24(6): 1039 - 1044. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Jass Serrated Adenoma of the Colorectum: A Lesion with Teeth Am. J. Pathol., March 1, 2003; 162(3): 705 - 708. [Full Text] [PDF] |
||||
![]() |
J R Jass, M Barker, L Fraser, M D Walsh, V L J Whitehall, B Gabrielli, J Young, and B A Leggett APC mutation and tumour budding in colorectal cancer J. Clin. Pathol., January 1, 2003; 56(1): 69 - 73. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Margison, M. F. Santibanez Koref, and A. C. Povey Mechanisms of carcinogenicity/chemotherapy by O6-methylguanine Mutagenesis, November 1, 2002; 17(6): 483 - 487. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Esteller, M. Guo, V. Moreno, M. A. Peinado, G. Capella, O. Galm, S. B. Baylin, and J. G. Herman Hypermethylation-associated Inactivation of the Cellular Retinol-Binding-Protein 1 Gene in Human Cancer Cancer Res., October 15, 2002; 62(20): 5902 - 5905. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Richman and J. Adlard Left and right sided large bowel cancer BMJ, April 20, 2002; 324(7343): 931 - 932. [Full Text] [PDF] |
||||
![]() |
A. O.-O. Chan, J.-P. J. Issa, J. S. Morris, S. R. Hamilton, and A. Rashid Concordant CpG Island Methylation in Hyperplastic Polyposis Am. J. Pathol., February 1, 2002; 160(2): 529 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Esteller, G. Gaidano, S. N. Goodman, V. Zagonel, D. Capello, B. Botto, D. Rossi, A. Gloghini, U. Vitolo, A. Carbone, et al. Hypermethylation of the DNA Repair Gene O6-Methylguanine DNA Methyltransferase and Survival of Patients With Diffuse Large B-Cell Lymphoma J Natl Cancer Inst, January 2, 2002; 94(1): 26 - 32. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |