Cancer Research Aziza Shad  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Asamoto, M.
Right arrow Articles by Shirai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asamoto, M.
Right arrow Articles by Shirai, T.
[Cancer Research 61, 4693-4700, June 15, 2001]
© 2001 American Association for Cancer Research


Carcinogenesis

Prostate Carcinomas Developing in Transgenic Rats with SV40 T Antigen Expression under Probasin Promoter Control Are Strictly Androgen Dependent1

Makoto Asamoto2, Naomi Hokaiwado, Young-Man Cho, Satoru Takahashi, Yoshihisa Ikeda, Katsumi Imaida and Tomoyuki Shirai

First Department of Pathology, Nagoya City University Medical School, Nagoya 467-8601, Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have generated a transgenic rat with the SV40 T antigen under probasin promoter control, allowing prostate-specific gene expression. Males demonstrate atypical epithelial cell proliferation in the prostate from 4 weeks of age and develop prostate carcinomas at 100% incidence before they are 15 weeks old. Castration at 5 weeks of age was found to inhibit the prostate tumor formation completely, whereas testosterone propionate administration induced marked cell proliferation as well as microinvasion in prostate carcinomas. Castration at 20 weeks of age, after tumor development, even with testosterone propionate treatment, induced complete tumor involution within 5 weeks. To investigate the underling processes, sequential histological changes were monitored 1, 2, 3, 7, 14, and 21 days after castration. At days 1–3, many apoptotic bodies and inflammatory cells, including foam cells, were observed, and clear glandular structures were no longer evident in the tumors. Seven days after castration, most glands were involved, and nuclei of the cells did not show atypia. After 14 and 21 days, only atrophic glands were observed. During this process, expression of caspase 3, caspase 6, BAX, bcl-x, TRPM-2, and MMP7 genes was apparently increased. Comparison of the gene expression profile between a prostate carcinoma in a transgenic animal and a normal prostate of a wild-type rat by a cDNA array technique was also conducted. The results suggested that our model is suitable to investigate mechanisms of carcinogenesis, including androgen dependence, involution, and apoptosis.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prostate cancer, the most common malignant disease in the Western world, has increased dramatically over the past decade. In the United States, it ranks second only to lung cancer as a cause of cancer related deaths (1) . Despite this serious situation, the basic biology, etiology, and risk factors for prostate cancer remain largely to be elucidated. Several mouse transgenic models have already been established (2) , which may contribute to analyze molecular, cellular, and physiological events in prostate carcinogenesis. However, rats have advantages for this purpose (2, 3, 4) , their larger size, e.g., allowing adequate materials to be obtained. Furthermore, several rat prostate models using chemical carcinogens have been established (5 , 6) , and data for hormone effects and modifying agents have accumulated (7, 8, 9, 10, 11, 12, 13, 14, 15, 16) . The problem is that these models are labor intensive and require long periods to induce tumors, which are usually microscopic and not suitable for molecular biological analysis. Therefore, we have established a rat transgenic prostate cancer model using the probasin gene promoter and the SV40 T antigen gene. The rat probasin gene encodes an androgen- and zinc-regulated protein specific to the dorsolateral epithelium of the prostate (17) . cis-acting androgen-response regions within the 5' flanking region have been identified (18) , and recently, the ability of the prostate-specific rat probasin gene promoter to target heterologous genes specifically in the prostate of transgenic mice was demonstrated (19 , 20) . In rats also, the gene promoter would be expected to work in the same way because this was the species from which it was originally isolated (17) . The SV40 early-region tumor antigen has the ability to induce transformation in vivo (21) , the SV40 large tumor T antigen (Tag) acting as an oncoprotein through interactions with retinoblastoma (22) and p53 tumor-suppressor gene products (23 , 24) ; the small t antigen interacts with protein phosphatase 2A (25) . SV40 Tag in particular has been used successfully in transgenic mice to induce tumors in a variety of organs, including the prostate (20 , 26 , 27) . It also proved useful in the liver of transgenic rats (28) .

Probasin-SV40 T antigen transgenic rats were here generated by microinjection of recombinant DNA of the probasin gene promoter, fused to the SV 40 T antigen, into pronuclei of Sprague Dawley rat embryos. In this paper, we describe the resultant prostate tumors and their androgen dependence in the transgenic rats, as well as sequential changes in histology and gene expression during involution after castration. Gene expression profiles were also compared between a prostate tumor in a transgenic animal and a normal prostate of a wild-type rat by a cDNA array technique.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Construction of the Transgene
The rat probasin gene promoter region (-426 to +33; Ref. 19 ) was obtained by PCR using primers GGAATTCAGCTTCCACAAGTGCATTTA and CATGCCATGGAGCTCTGTAGGTATCTGGAC with addition of restriction endonuclease recognition sites for EcoRI and NcoI, respectively. The SV40 Tag gene in pBluescriptII KS(-) (VG042, pBS-SVT) was obtained from Health Science Research Resource Bank (Osaka, Japan). The PCR products for the rat probasin gene promoter region and the SV40 Tag gene in pBluescriptII KS(-) were digested with EcoRI and NcoI and then ligated, resulting in a pBS-Probain-SVT plasmid. To prepare a linear transgene and remove plasmid sequences for microinjection, the plasmid was digested with EcoRI and BamHI, purified by agarose gel electrophoresis, and recovered using a QIAquick gel extraction kit (Qiagen, Tokyo, Japan).

Production and Screening of Transgenic Rats
Generation of transgenic rats was performed by DNX transgenic Science (Princeton, NJ). DNA isolation from rat tails, and the PCR-base screening assay were performed as described previously (3) . Sequences of the PCR primers were 5'-GTCAGCAGTAGCCTCATCAT-3' and 5'-GGTTGATTGCTACTGCTTCG-3'. Heterologous transgenic males for the studies were routinely obtained by mating heterologous transgenic males and wild-type Sprague Dawley rats (Clea, Tokyo, Japan).

Animal Treatment
Experiment 1.
A total of 25 transgenic male rats were divided into five groups. In group 1, five rats were maintained until 25 weeks old, when they were killed. In group 2, five rats were castrated at 20 weeks of age and kept until 25 weeks old, when they were killed. In group 3, five rats were castrated at 5 weeks of age and were kept until 25 weeks. In groups 4 and 5, 1.5-cm long Silastic tubes containing 30 mg of testosterone propionate (Sigma Chemical Co., St. Louis, MO) were implanted into the subcutis of the dorsal region of five animals each at 5 weeks old of age; they were then killed when 25 weeks old. In group 5, castration and removal of the testosterone tubes were performed at 20 weeks of age.

Experiment 2.
In a total of 21 transgenic male rats, 1.5-cm long Silastic tubes containing 30 mg of testosterone propionate were implanted at 5 weeks of age. Castration and removal of the testosterone tubes were performed at 15 weeks of age, and rats were killed 0, 1, 2, 3, 7, 14, and 21 days thereafter.

Preparation and Analysis of Tissues
One-half of each prostate collected at necropsy was routinely fixed in 10% phosphate-buffered formalin for 48 h and then processed for embedding in paraffin. Five-µm-thick sections were cut and stained with H&E. Immunohistochemical analyses of SV40 Tag, and androgen receptor were performed using mouse anti-SV40 large T antigen monoclonal antibody (PharMingen, San Diego, CA), and rabbit polyclonal anti-androgen receptor antibody (Affinity Bioreagents, Golden, CO). Binding was visualized with a Vectastain Elite ABC kit (Vector Lab, Burlingame, CA) and light hematoxylin counterstaining was conducted to facilitate microscopic examination. Photographs were taken with a digital camera (DP11, Olympus, Tokyo, Japan) and printed out using a digital printer (Pictrography 3000, Fujifilm, Tokyo, Japan). The other half of each prostate was frozen in liquid nitrogen for extraction of RNA.

Extraction of Total RNA, Quantitative RT-PCR, and cDNA Array Analysis
Total RNA extraction and DNase treatment were performed according to the manufacturer’s instructions using the Atlas Pure Total RNA Labeling system (Clontech, Palo Alto, CA). One microgram of the RNA was converted to cDNA with avian myoblastosis virus reverse transcriptase (Takara, Otus, Japan) in 20 µl of reaction mixture. Aliquots of 2 µl of cDNA samples were subjected to quantitative PCR in 20-µl reactions using FastStart DNA Master SYBR Green I and a Light Cycler apparatus (Roche Diagnostics, Mannheim, Germany). Primers used for caspase 3 were 5'-GCCGACTTCCTGTATGCTTA-3' and 5'-CACGGGATCTGTTTCTTTGC-3'; for caspase 6, 5'-AGACCTTGACTGGCTTGTTC-3' and 5'-GCTGAGAGACCTTCCTGTTC-3'; for bcl-x, 5'-TACCAGGAGAACCACTACTA-3' and 5'-AGCTGATCTGAGGAAAAACC-3'; for BAX, 5'-GGAGCTGCAGAGGATGATTG-3' and 5'-TGAGCGAGGCGGTGAGGACT-3'; for MMP7, 5'-TGGGTCTGGGTCACTCTTCT-3' and 5'-CACAGCTTGTTCCTCTTTCC-3'; for TRPM-2, 5'-CATGGAATGAGACAGAAGCA-3' and 5'-GAACCCAGAGGAAGGAGAGG-3'; for cyclophilin, 5'-TGCTGGACCAAACACAAATG-3' and 5'-GAAGGGGAATGAGGAAAATA-3'. Initial denaturation at 95°C for 10 min was followed by 40 cycles with denaturation at 95°C for 15 s, annealing at 55°C (except at 50°C for MMP7 and at 45°C for TRPM-2) for 5 s, and elongation at 72°C for 30 s. The fluorescence intensity of the double-strand specific SYBR Green I, reflecting the amount of formed PCR-product, was monitored at the end of each elongation step. Cyclophilin mRNA levels were used to normalize the sample cDNA content. Three samples per each point (carcinomas from transgenic rats 0, 1, 2, 3, and 7 days after castration, and normal prostates of wild-type littermates) were analyzed.

For probe synthesis of cDNA arrays, poly(A)+ RNA enrichment and 32P labeling were performed according to the manufacturer’s instructions (Atlas Pure Total RNA Labeling System; Clontech). Atlas Rat 1.2 Array (Clontech) was used for comparing gene expression profiles between normal prostate of a wild-type littermate and a prostate carcinoma in a probasin-SV40 Tag transgenic rat at 15 weeks of age. Signals were detected and analyzed by image analyzer (FLA-3000G; Fujifilm, Tokyo) with Array Gauge software (Fujifilm).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Four male founder rats were obtained. Two of them fertilized females, which gave birth to viable pups. The transgenic rats of both lines developed prostate lesions from an early age, just after weaning at 4 weeks. One line made more pups; therefore, the transgenic rats from this line were used for the experiments. In the preliminary observation period, prostate lesions in the transgenic rats showed marked epithelial proliferation with formation of irregular glands and luminal bridging to give a cribriform pattern. Their nuclei demonstrated enlargement and severe atypia. These lesions are compatible with adenocarcinomas in human cases and were, therefore, diagnosed as such. Glands with less proliferation were also observed. These exhibited crowding of stratified epithelial cells with irregular spacing and occasional luminal bridging. Although nuclear atypia were severe, basic glandular structures were maintained, similar to normal prostates, and the lesions were diagnosed as PIN,3 comparable with the human case. Prostate adenocarcinomas in the ventral, dorsolateral, and anterior lobes were observed at 100% incidence before 15 weeks of age, but no tumors were noted in the seminal vesicles. In addition to the prostate carcinomas, the transgenic rats developed taste bud neuroblastomas (details published in Ref. 29 ).

In experiment 1, effects of administration of testosterone propionate and castration on prostate carcinogenesis were investigated in probasin-SV40 Tag transgenic rats. Macroscopically, prostates of the transgenic rats in the nontreated group (group 1) showed slight enlargement and irregular surfaces but no apparent nodule or mass formations (Fig. 1a)Citation . Castration at 20 weeks of age (group 2) caused severe atrophy in both the prostate and the seminal vesicles (Fig. 1b)Citation . Testosterone propionate treatment, in contrast, caused enlargement, especially in the anterior lobes and seminal vesicles. Surfaces of these prostates were irregular; and in anterior lobes, hemorrhage was frequently observed (Fig. 1c)Citation . Castration after testosterone propionate treatment induced prostate and seminal vesicle atrophy (Fig. 1d)Citation . Data for weights of prostates and seminal vesicles with urinary bladders are summarized in Table 1Citation . Treatment with testosterone propionate (group 4) caused increase, whereas castration (groups 2, 3, and 5) resulted in dramatic decrease.



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Representative macroscopic appearance of prostates of 25-week-old transgenic rats. a, nontreated (group 1). b, castrated at 20 weeks of age (group 2). c, treated with testosterone propionate (group 4). d, treated with testosterone propionate and then castration at 20 weeks of age (group 5).

 

View this table:
[in this window]
[in a new window]

 
Table 1 Weights of urogenital organs including prostate, seminal vesicle, and urinary bladder in the transgenic rats

 
In the nontreatment group (group 1), the transgenic rats developed PINs and adenocarcinomas in the ventral, dorsolateral, and anterior prostates at very high incidences (Fig. 2a)Citation . Almost all of the glands consisted of atypical cells, diagnosed as PINs or adenocarcinomas. This may be a reason that the prostate of the transgenic rats looks enlarged, but without obvious formation of masses or nodules. Castration at 20 weeks of age (group 2) caused involution completely after 5 weeks, when no neoplastic lesions were found, and only atrophic glands without atypia and fibrosis were observed. Castration at 5 weeks of age (group 3) suppressed tumor development completely. In this group, atrophic glands without atypia surrounded by slight fibrosis were found (Fig. 2b)Citation . Testosterone propionate treatment enhanced atypical cell proliferation with formation of solid adenocarcinomas featuring cribriform patterns (Fig. 2c)Citation . Microinvasion was often observed in this group, but, no metastases were noted. Even after enhancement of cell proliferation by testosterone, castration caused complete involution, leaving only atrophic glands without atypia and severe fibrosis and no neoplastic lesions retained in group 5 at week 25 (Fig. 2dCitation , see Table 2Citation ).



View larger version (183K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Representative histopathology of ventral prostates of 25-week-old transgenic rats (experiment 1). a, nontreated (group 1). Atypical glands diagnosed as well-differentiated adenocarcinoma are evident in the center, and high-grade PINs (marked with *) is also apparent. b, castrated at 5 weeks of age. Note atrophic glands with slight increase in fibrosis. c, treated with testosterone propionate (group 4). A well-differentiated adenocarcinoma with enhanced atypical cell proliferation forming cribriform pattern with microinvasion is apparent. d, treated with testosterone propionate and then castration at 20 weeks of age (group 5). Atrophic glands are surrounded by severe fibrosis.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Development of prostate lesions in the transgenic rats: effects of testosterone and castration

 
In experiment 2, involution of the adenocarcinomas with enhanced cell proliferation attributable to testosterone propionate was induced by castration. One to 3 days after castration, numerous apoptotic bodies were observed (Fig. 3, c and d)Citation , and inflammatory cells including neutrophils, lymphocytes, and foamy cells had infiltrated the lesions (Fig. 3, e and f)Citation . After 7 days, atrophic glands and fibrosis were frequently observed, and nuclear atypia of the glands were minimal (Fig. 3, g and h)Citation . Therefore, these lesions could no longer be diagnosed as carcinomas. Degree of atrophy of the glands and fibrosis were increased 14 and 21 days after castration (Fig. 3, i and j)Citation . SV40 Tag expression was detected immunohistochemically in almost all cells of the prostate adenocarcinomas until 2 days after castration (Fig. 4a)Citation , but at day 3, only a small proportion showed positive reactions (Fig. 4b)Citation . After 7 days, almost no expression of the transgene was detected (Fig. 4, c and d)Citation . Expression of androgen receptors was dramatically diminished from just 1 day after castration (Fig. 4, e and f)Citation , and after day 2, no positive signals were detected immunohistochemically (Fig. 4, g and hCitation ; see Table 3Citation ).



View larger version (117K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Representative histopathology of ventral prostates during involution of the adenocarcinomas in transgenic rats after castration (experiment 2). a and b, a well-differentiated adenocarcinoma of the ventral prostate in a transgenic rat treated with testosterone propionate; many mitoses are present. c and d, 1 day after castration; many apoptotic bodies are observed in an adenocarcinoma. e and f, 3 days after castration; inflammatory cell infiltration is evident. Atypical cells are still observed, but glandular structures are undergoing destruction. g and h, 7 days after castration; atrophic glandular structures are apparent with fibrosis. i and h, 14 days after castration. Severely atrophic glands are observed with severe fibrosis and foamy cell infiltration. a, c, e, g, and i, low magnification (x40). b, d, f, h, and j, high magnification (x200).

 


View larger version (117K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Representative immunohistochemical analysis of the prostate carcinomas during involution for SV40 T antigen (a–d) and androgen-receptors (e–h). a, adenocarcinoma 1 day after castration. Most atypical cells have positive reactions for SV40 T antigen. b, 3 days after castration. Approximately one-half of the atypical cells are positive for SV40 T antigen. c, 7 days after castration. d, 14 days after castration. Most cells are negative for SV-40 T antigen. e, adenocarcinoma before castration. Most atypical cells are positive for androgen receptors. f, adenocarcinoma 1 day after castration. Most atypical cells are negative. g, 3 days after castration. h, 7 days after castration. All of the cells are negative for androgen receptors.

 

View this table:
[in this window]
[in a new window]

 
Table 3 Histological and immunohistochemical changes in prostate carcinomas after castration of PB/SV40 Tag transgenic rats

 
cDNA array analysis revealed differences in the gene expression profile between an adenocarcinoma in a transgenic rat and normal ventral prostate tissue in a wild-type animal. Genes with expression increased or decreased >2-fold are listed in Table 4Citation . Among these, increased expression of TRPM-2 and MMP7 in carcinomas was confirmed by quantitative RT-PCR (Fig. 5)Citation .


View this table:
[in this window]
[in a new window]

 
Table 4 List of genes with expression changed >2-fold in the ventral prostate carcinoma of the transgenic rat compared with normal ventral prostate of a wild-type littermate

 


View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Results of quantitative RT-PCR for TRPM-2, MMP7, caspase 3, caspase 6, BAX, and bcl-x during involution of the adenocarcinomas in transgenic rats. Y axis, relative expression values. Gene expression in normal wild-type ventral prostate is 1 in each case. Numbers on the X axis, mean days after castration.

 
Using the prostate materials obtained in experiment 2, expression of caspase 3, caspase 6, bcl-x, and BAX, as apoptosis-related genes, was investigated by quantitative RT-PCR, in addition to TRPM-2 and MMP7. Expression of caspase 3 and 6 in carcinomas before castration was higher than that in normal prostate tissue and increased to a peak 2 days after castration. Expression of bcl-x and BAX was also increased, but the peaks were at day 7. TRPM-2 and MMP7 expression also increased with peaks at day 3 (Fig. 5)Citation . Changes in TRPM-2 were furthermore confirmed by western blotting (data not shown).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Elucidation of the pathogenetic basis of prostate carcinogenesis can be facilitated greatly by laboratory models of the disease. We have developed a rat transgenic model producing well-differentiated prostate adenocarcinomas in all of the animals and in a short period using SV40 Tag under control of the probasin gene promoter. A transgenic mouse model of prostate carcinomas TRAMP, using the same gene construct was earlier established by Greenberg et al. (20) , featuring high-grade PIN and/or well-differentiated adenocarcinomas of the prostate by 10–12 weeks of age, with spontaneous development of invasive primary tumors that frequently metastasize to the lymph nodes and lungs in 30–36 week old animals (20) . Castration at 12 weeks of age did not inhibit progression to poorly differentiated and metastatic prostate carcinomas in TRAMP mice (30) . Earlier castration at 4 weeks of age reduced prostate cancer development, but some of the mice suffered from androgen-independent prostate carcinomas (31) . In our transgenic rats having the same transgene construct, well-differentiated adenocarcinomas similarly developed in the prostate. However, castration at 20 weeks of age caused complete regression or involution of these carcinomas and earlier castration at 5 weeks of age completely inhibited prostate carcinoma development, in clear contrast to the TRAMP case. Rapid decrease of expression of SV40 Tag and androgen-receptor in the prostate carcinomas after castration is in line with complete androgen-dependence. Because of this complete regression of the lesions and the macroscopic appearance of the prostates with no apparent masses or nodules, the lesion might be suspected of being hyperplastic in nature. However, histological characteristics such as structural and nuclear atypia and microinvasion are in line with a malignant neoplastic phenotype. Furthermore, the prostate lesions proved tumorigenic in nude mice (data not shown) without any pretreatment such as testosterone injection or Matrigel (32 , 33) , giving rise to adenocarcinomas similar to the original prostate lesions. Therefore, the data suggest that the prostate lesions in the transgenic rats are true malignancies (adenocarcinomas).

Small cell carcinomas were also occasionally observed in the prostates of transgenic rats, reminiscent of the poorly differentiated carcinomas noted in the TRAMP mouse prostate (20 , 30) . However, such small cell carcinomas in the transgenic rats demonstrated neuroendocrine tumor characteristics such as synaptophysin (34) and protein gene product 9.5 expression (35) , which were lacking in the TRAMP mice. Therefore, the origins of well-differentiated adenocarcinomas and small cell carcinomas may be very different, and development of small cell carcinomas is probably not a result of progression from well-differentiated adenocarcinomas. The transgenic rats also develop metastasizing taste bud neuroblastomas with the same histology, and these show androgen-independent growth (29) . Immunohistochemical phenotypes of most tumors were almost the same in the prostates and taste-buds (SV40 Tag, positive; protein gene product 9.5, positive; synaptophysin, positive; androgen receptors, negative). Whether the small cell carcinomas in the prostate are primary tumors or metastases from the taste bud tumors is, therefore, unclear. However, some showed weak positivity for androgen-receptor staining, which may indicate a prostate cell origin. In human cases, a small cell carcinoma with neuroendocrine character is an aggressive subtype of the prostate carcinomas (36, 37, 38) , and transgenic mouse models have been reported (39 , 40) . The present transgenic rats could also be useful in this respect.

The present prostate tumors are androgen-dependent and androgen-receptor positive, whereas the taste-bud tumors are androgen-independent and androgen-receptor negative. Both are positive for SV40 Tag. Therefore, in the prostate, the probasin gene promoter may function in a specific androgen-dependent fashion, whereas in the taste buds, other unknown factors may act in an androgen-independent way. In taste buds, probasin gene itself is not expressed.

Taking advantage of the rat prostate size, RNA was extracted from one-half of a transgenic prostate carcinoma and a wild-type littermate prostate in the present experiment to allow gene expression profiles to be investigated by cDNA array techniques. Although the number of genes on the array membrane (<1200) was limited, genes of interest for prostate carcinogenesis such as TRPM-2 and MMP7 were picked up as being up-regulated. TRPM-2, also known as clusterin or sulfated glycoprotein-2, was originally isolated from ram rete testes fluid (41) . It has been considered as a marker for cell death because of strong expression in various normal and malignant tissues undergoing apoptosis (42, 43, 44) . However, recently, conflicting data on the association between enhanced TRPM-2 expression and apoptotic activity were reported (45) . Introduction of TRPM-2 cDNA into LNCaP prostate cancer cells increases resistance to apoptosis induced by tumor necrosis factor {alpha} treatment (46) and promotes progression to androgen independence (47) . Elevated expression of TRPM-2 in human prostate cancer also correlates with increase in the Gleason score (48) and has been also reported in carcinogen-induced prostate cancers in rats (49) . In our transgenic rat model, TRPM-2 expression was found to be increased in carcinomas as compared with normal prostate, with further elevation during involution. Tissue undergoing apoptosis contains both apoptotic and remaining nonapoptotic cells. Therefore, these results may not conflict with the proposal that TRPM-2 is an antiapoptotic gene (47) , although TRPM-2 may have both apoptotic and antiapoptotic activities because of variation in glycosylation patterns (50) .

Degradation of the ECM is an essential step in tumor invasion and metastasis. The MMPs each have different substrate specificity within ECM and are important for this purpose; MMP7, for example, demonstrated increased expression in the prostate carcinomas of our transgenic rats and also in various human carcinomas, including prostate carcinomas (51, 52, 53, 54, 55) . MMP7 overexpression is also observed in involution of normal prostate (56) and prostate carcinomas in this study. During this process, tissue structure is dramatically changed, and degradation of ECM may be essential. MMP7 may, thus, have important roles for involution processes in addition to tumor invasion.

In our transgenic rat model of prostate carcinogenesis, the developed carcinomas are completely androgen dependent and castration causes complete regression in contrast to the compatible mice model. This has advantages for investigation of involution processes including apoptosis at the tissue level. Histologically, inflammatory cell infiltration was found to be involved in the present case. Increased expression of caspases 3 and 6, and BAX may reflect apoptotic activity and increased bcl-x may be caused by other cells escaping from apoptosis (57) .

In summary, we have developed a transgenic rat model featuring prostate carcinomas that are completely androgen dependent. This model may be useful to investigate mechanisms of development of androgen-dependent prostate carcinomas and processes of involution, and to evaluate strategies for prevention and treatment, including gene therapy. It should be remembered in this context that most human prostate cancers are androgen responsive before androgen ablation treatments.


    ACKNOWLEDGMENTS
 
We thank Dr. Malcolm A. Moore for his kind linguistic advice during preparation of the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by research grants from CREST (Core Research for Evolutional Science and Technology) of the Japan Science and Technology Corp. (JST), the Ministry of Health and Welfare of Japan, the Ministry of Education, Science, Sports and Culture of Japan, and the Society for Promotion of Toxicologic Pathology, Nagoya. Back

2 To whom requests for reprints should be addressed, at the First Department of Pathology, Nagoya City University Medical School, Kawasumi 1, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan. Back

3 The abbreviations used are: PIN, prostatic intraepithelial neoplasia; RT-PCR, reverse transcription PCR; MMP, matrix metalloproteinase; TRPM-2, testosterone-repressed prostate message 2; Tag, T antigen; ECM, extracellular matrix. Back

Received 11/28/00. Accepted 4/17/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Landis S. H., Murray T., Bolden S., Wingo P. A. Cancer statistics, 1999. CA Cancer J. Clin., 49: 8-31, 1999.[Abstract/Free Full Text]
  2. Sharma P., Schreiber-Agus N. Mouse models of prostate cancer. Oncogene, 18: 5349-5355, 1999.[Medline]
  3. Asamoto M., Ochiya T., Toriyama-Baba H., Ota T., Sekiya T., Terada M., Tsuda H. Transgenic rats carrying human c-Ha-ras proto-oncogenes are highly susceptible to N-methyl-N-nitrosourea mammary carcinogenesis. Carcinogenesis (Lond.), 21: 243-249, 2000.[Abstract/Free Full Text]
  4. Morimura S., Suzuki T., Hochi S., Yuki A., Nomura K., Kitagawa T., Nagatsu I., Imagawa M., Muramatsu M. Transactivation of glutathione transferase P gene during chemical hepatocarcinogenesis of the rat. Proc. Natl. Acad. Sci. USA, 90: 2065-2068, 1993.[Abstract/Free Full Text]
  5. Shirai T., Takahashi S., Cui L., Futakuchi M., Kato K., Tamano S., Imaida K. Experimental prostate carcinogenesis–rodent models. Mutat. Res., 462: 219-226, 2000.[Medline]
  6. Lucia M. S., Bostwick D. G., Bosland M., Cockett A. T. K., Knapp D. W., Leav I., Pollard M., Rinker-Schaeffer C., Shirai T., Watkins B. A. Workgroup I: rodent models of prostate cancer. Prostate, 36: 49-55, 1998.[Medline]
  7. Shirai T., Imaida K., Masui T., Iwasaki S., Mori T., Kato T., Ito N. Effects of testosterone, dihydrotestosterone, and estrogen on 3,2'-dimethyl-4-aminobiphenyl-induced rat prostate carcinogenesis. Int. J. Cancer, 57: 224-228, 1994.[Medline]
  8. Shirai T., Iwasaki S., Masui T., Mori T., Kato T., Ito N. Enhancing effect of cadmium on rat ventral prostate carcinogenesis induced by 3,2'-dimethyl-4-aminobiphenyl. Jpn. J. Cancer Res., 84: 1023-1030, 1993.[Medline]
  9. Shirai T., Sano M., Imaida K., Takahashi S., Mori T., Ito N. Duration dependent induction of invasive prostatic carcinomas with pharmacological dose of testosterone propionate in rats pretreated with 3,2'-dimethyl-4-aminobiphenyl and development of androgen-independent carcinomas after castration. Cancer Lett., 83: 111-116, 1994.[Medline]
  10. Shirai T., Tamano S., Sano M., Imaida K., Hagiwara A., Futakuchi M., Takahashi S., Hirose M. Site-specific effects of testosterone propionate on the prostate of rat pretreated with 3,2'-dimethyl-4-aminobiphenyl: dose-dependent induction of invasive carcinomas. Jpn. J. Cancer Res., 86: 645-648, 1995.[Medline]
  11. Kawabe M., Shibata M. A., Sano M., Takesada Y., Tamano S., Ito N., Shirai T. Decrease of prostaglandin E2 and 5-bromo-2'-deoxyuridine labeling but not prostate tumor development by indomethacin treatment of rats given 3,2'-dimethyl-4-aminobiphenyl and testosterone propionate. Jpn. J. Cancer Res., 88: 350-355, 1997.[Medline]
  12. Miyata E., Kawabe M., Sano M., Takesada Y., Takahashi S., Shirai T. Effects of tamoxifen, an antiestrogen, on rat prostate carcinogenesis by 3,2'-dimethyl-4-aminobiphenyl and testosterone do not support an estrogen role in testosterone promotion. Prostate, 31: 9-13, 1997.[Medline]
  13. Cui L., Mori T., Takahashi S., Imaida K., Akagi K., Yada H., Yaono M., Shirai T. Slight promotion effects of intermittent administration of testosterone propionate and/or diethylstilbestrol on 3,2'-dimethyl-4-aminobiphenyl-initiated rat prostate carcinogenesis. Cancer Lett., 122: 195-199, 1998.[Medline]
  14. Tsukamoto S., Akaza H., Onozawa M., Shirai T., Ideyama Y. A five-{alpha} reductase inhibitor or an anti-androgen prevents the progression of microscopic prostate carcinoma to macroscopic carcinoma in rats. Cancer (Phila.), 82: 531-537, 1998.[Medline]
  15. Bosland M. C. Use of animal models in defining efficacy of chemoprevention agents against prostate cancer. Eur. Urol., 35: 459-463, 1999.[Medline]
  16. McCormick D. L., Rao K. V., Steele V. E., Lubet R. A., Kelloff G. J., Bosland M. C. Chemoprevention of rat prostate carcinogenesis by 9-cis-retinoic acid. Cancer Res., 59: 521-524, 1999.[Abstract/Free Full Text]
  17. Dodd J. G., Sheppard P. C., Matusik R. J. Characterization and cloning of rat dorsal prostate mRNAs. Androgen regulation of two closely related abundant mRNAs. J. Biol. Chem., 258: 10731-10737, 1983.[Abstract/Free Full Text]
  18. Rennie P. S., Bruchovsky N., Leco K. J., Sheppard P. C., McQueen S. A., Cheng H., Snoek R., Hamel A., Bock M. E., MacDonald B. S., et al Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol. Endocrinol., 7: 23-36, 1993.[Abstract/Free Full Text]
  19. Greenberg N. M., DeMayo F. J., Sheppard P. C., Barrios R., Lebovitz R., Finegold M., Angelopoulou R., Dodd J. G., Duckworth M. L., Rosen J. M., Matusik R. J. The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol. Endocrinol., 8: 230-239, 1994.[Abstract/Free Full Text]
  20. Greenberg N. M., DeMayo F., Finegold M. J., Medina D., Tilley W. D., Aspinall J. O., Cunha G. R., Donjacour A. A., Matusik R. J., Rosen J. M. Prostate cancer in a transgenic mouse. Proc. Natl. Acad. Sci. USA, 92: 3439-3443, 1995.[Abstract/Free Full Text]
  21. Brinster R. L., Chen H. Y., Messing A., van Dyke T., Levine A. J., Palmiter R. D. Transgenic mice harboring SV40 T-antigen genes develop characteristic brain tumors. Cell, 37: 367-379, 1984.[Medline]
  22. DeCaprio J. A., Ludlow J. W., Figge J., Shew J. Y., Huang C. M., Lee W. H., Marsilio E., Paucha E., Livingston D. M. SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell, 54: 275-283, 1988.[Medline]
  23. Lane D. P., Crawford L. V. T antigen is bound to a host protein in SV40-transformed cells. Nature (Lond.), 278: 261-263, 1979.[Medline]
  24. Linzer D. I., Levine A. J. Characterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell, 17: 43-52, 1979.[Medline]
  25. Pallas D. C., Shahrik L. K., Martin B. L., Jaspers S., Miller T. B., Brautigan D. L., Roberts T. M. Polyoma small and middle T antigens and SV40 small t antigen form stable complexes with protein phosphatase 2A. Cell, 60: 167-176, 1990.[Medline]
  26. Adams J. M., Cory S. Transgenic models of tumor development. Science (Wash. DC), 254: 1161-1167, 1991.[Abstract/Free Full Text]
  27. Shibata M. A., Ward J. M., Devor D. E., Liu M. L., Green J. E. Progression of prostatic intraepithelial neoplasia to invasive carcinoma in C3(1)/SV40 large T antigen transgenic mice: histopathological and molecular biological alterations. Cancer Res., 56: 4894-4903, 1996.[Abstract/Free Full Text]
  28. Hully J. R., Su Y., Lohse J. K., Griep A. E., Sattler C. A., Haas M. J., Dragan Y., Peterson J., Neveu M., Pitot H. C. Transgenic hepatocarcinogenesis in the rat. Am. J. Pathol., 145: 386-397, 1994.[Abstract]
  29. Asamoto, M., Hokaiwado, N., Cho, Y-M., Ikeda, Y., Takahashi, S., and Shirai, T. Metastasizing neuroblastomas from taste buds in rats transgenic for the Simian virus 40 large T antigen under control of the probasin gene promoter. Toxicol. Pathol., in press, 2001.
  30. Gingrich J. R., Barrios R. J., Kattan M. W., Nahm H. S., Finegold M. J., Greenberg N. M. Androgen-independent prostate cancer progression in the TRAMP model. Cancer Res., 57: 4687-4691, 1997.[Abstract/Free Full Text]
  31. Eng M. H., Charles L. G., Ross B. D., Chrisp C. E., Pienta K. J., Greenberg N. M., Hsu C. X., Sanda M. G. Early castration reduces prostatic carcinogenesis in transgenic mice. Urology, 54: 1112-1119, 1999.[Medline]
  32. Pretlow T. G., Delmoro C. M., Dilley G. G., Spadafora C. G., Pretlow T. P. Transplantation of human prostatic carcinoma into nude mice in Matrigel. Cancer Res., 51: 3814-3817, 1991.[Abstract/Free Full Text]
  33. Pretlow T. G., Wolman S. R., Micale M. A., Pelley R. J., Kursh E. D., Resnick M. I., Bodner D. R., Jacobberger J. W., Delmoro C. M., Giaconia J. M., et al Xenografts of primary human prostatic carcinoma. J. Natl. Cancer Inst. (Bethesda), 85: 394-398, 1993.[Abstract/Free Full Text]
  34. Wiedenmann B., Kuhn C., Schwechheimer K., Waldherr R., Raue F., Brandeis W. E., Kommerell B., Franke W. W. Synaptophysin identified in metastases of neuroendocrine tumors by immunocytochemistry and immunoblotting. Am. J. Clin. Pathol., 88: 560-569, 1987.[Medline]
  35. Ermisch B., Schwechheimer K. Protein gene product (PGP) 9.5 in diagnostic (neuro-) oncology. An immunomorphological study. Clin. Neuropathol., 14: 130-136, 1995.[Medline]
  36. Sandhu S. S., Denton A., Jarmulowicz M., Pigott K., Kaisary A. V. Pure small cell carcinoma of the prostate. Clin. Oncol. (R. Coll. Radiol.), 9: 412-414, 1997.[Medline]
  37. Schron D. S., Gipson T., Mendelsohn G. The histogenesis of small cell carcinoma of the prostate. An immunohistochemical study. Cancer (Phila.), 53: 2478-2480, 1984.[Medline]
  38. Helpap B., Kollermann J. Undifferentiated carcinoma of the prostate with small cell features: immunohistochemical subtyping and reflections on histogenesis. Virchows Arch., 434: 385-391, 1999.[Medline]
  39. Garabedian E. M., Humphrey P. A., Gordon J. I. A transgenic mouse model of metastatic prostate cancer originating from neuroendocrine cells. Proc. Natl. Acad. Sci. USA, 95: 15382-15387, 1998.[Abstract/Free Full Text]
  40. Perez-Stable C., Altman N. H., Mehta P. P., Deftos L. J., Roos B. A. Prostate cancer progression, metastasis, and gene expression in transgenic mice. Cancer Res., 57: 900-906, 1997.[Abstract/Free Full Text]
  41. Blaschuk O., Burdzy K., Fritz I. B. Purification and characterization of a cell-aggregating factor (clusterin), the major glycoprotein in ram rete testis fluid. J. Biol. Chem., 258: 7714-7720, 1983.[Abstract/Free Full Text]
  42. Sensibar J. A., Griswold M. D., Sylvester S. R., Buttyan R., Bardin C. W., Cheng C. Y., Dudek S., Lee C. Prostatic ductal system in rats: regional variation in localization of an androgen-repressed gene product, sulfated glycoprotein-2. Endocrinology, 128: 2091-2102, 1991.[Abstract/Free Full Text]
  43. Kyprianou N., English H. F., Isaacs J. T. Programmed cell death during regression of PC-82 human prostate cancer following androgen ablation. Cancer Res., 50: 3748-3753, 1990.[Abstract/Free Full Text]
  44. Wright P. S., Cross-Doersen D., Th’ng J. P., Guo X. W., Crissman H. A., Bradbury E. M., Montgomery L. R., Thompson F. Y., Loudy D. E., Johnston J. O., Bitonti A. J. A ribonucleotide reductase inhibitor, MDL 101,731, induces apoptosis and elevates TRPM-2 mRNA levels in human prostate tumor xenografts. Exp. Cell Res., 222: 54-60, 1996.[Medline]
  45. Ho S. M., Leav I., Ghatak S., Merk F., Jagannathan V. S., Mallery K. Lack of association between enhanced TRPM-2/clusterin expression and increased apoptotic activity in sex-hormone-induced prostatic dysplasia of the Noble rat. Am. J. Pathol., 153: 131-139, 1998.[Abstract/Free Full Text]
  46. Sensibar J. A., Sutkowski D. M., Raffo A., Buttyan R., Griswold M. D., Sylvester S. R., Kozlowski J. M., Lee C. Prevention of cell death induced by tumor necrosis factor {alpha} in LNCaP cells by overexpression of sulfated glycoprotein-2 (clusterin). Cancer Res., 55: 2431-2437, 1995.[Abstract/Free Full Text]
  47. Miyake H., Nelson C., Rennie P. S., Gleave M. E. Testosterone-repressed prostate message-2 is an antiapoptotic gene involved in progression to androgen independence in prostate cancer. Cancer Res., 60: 170-176, 2000.[Abstract/Free Full Text]
  48. Steinberg J., Oyasu R., Lang S., Sintich S., Rademaker A., Lee C., Kozlowski J. M., Sensibar J. A. Intracellular levels of SGP-2 (clusterin) correlate with tumor grade in prostate cancer. Clin. Cancer Res., 3: 1707-1711, 1997.[Abstract]
  49. Kadomatsu K., Anzano M. A., Slayter M. V., Winokur T. S., Smith J. M., Sporn M. B. Expression of sulfated glycoprotein 2 is associated with carcinogenesis induced by N-nitroso-N-methylurea in rat prostate and seminal vesicle. Cancer Res., 53: 1480-1483, 1993.[Abstract/Free Full Text]
  50. Lakins J., Bennett S. A., Chen J. H., Arnold J. M., Morrissey C., Wong P., O’Sullivan J., Tenniswood M. Clusterin biogenesis is altered during apoptosis in the regressing rat ventral prostate. J. Biol. Chem., 273: 27887-27895, 1998.[Abstract/Free Full Text]
  51. Miyazaki K., Hattori Y., Umenishi F., Yasumitsu H., Umeda M. Purification and characterization of extracellular matrix-degrading metalloproteinase, matrin (pump-1), secreted from human rectal carcinoma cell line. Cancer Res., 50: 7758-7764, 1990.[Abstract/Free Full Text]
  52. McDonnell S., Navre M., Coffey R. J., Jr., Matrisian L. M. Expression and localization of the matrix metalloproteinase pump-1 (MMP-7) in human gastric and colon carcinomas. Mol. Carcinog., 4: 527-533, 1991.[Medline]
  53. Matsushima T., Mori M., Kido A., Adachi Y., Sugimachi K. Preoperative estimation of neural invasion in rectal carcinoma. Oncol. Rep., 5: 73-76, 1998.[Medline]
  54. Pajouh M. S., Nagle R. B., Breathnach R., Finch J. S., Brawer M. K., Bowden G. T. Expression of metalloproteinase genes in human prostate cancer. J. Cancer Res. Clin. Oncol., 117: 144-150, 1991.[Medline]
  55. Knox J. D., Wolf C., McDaniel K., Clark V., Loriot M., Bowden G. T., Nagle R. B. Matrilysin expression in human prostate carcinoma. Mol. Carcinog., 15: 57-63, 1996.[Medline]
  56. Powell W. C., Domann F. E., Jr., Mitchen J. M., Matrisian L. M., Nagle R. B., Bowden G. T. Matrilysin expression in the involuting rat ventral prostate. Prostate, 29: 159-168, 1996.[Medline]
  57. Green D. R. Apoptotic pathways: the roads to ruin. Cell, 94: 695-698, 1998.[Medline]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
N. Hokaiwado, F. Takeshita, A. Naiki-Ito, M. Asamoto, T. Ochiya, and T. Shirai
Glutathione S-transferase Pi mediates proliferation of androgen-independent prostate cancer cells
Carcinogenesis, June 1, 2008; 29(6): 1134 - 1138.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Wang, R. M. Luque, R. D. Kineman, V. H. Ray, K. T. Christov, D. D. Lantvit, T. Shirai, S. Hedayat, T. G. Unterman, M. C. Bosland, et al.
Disruption of Growth Hormone Signaling Retards Prostate Carcinogenesis in the Probasin/TAg Rat
Endocrinology, March 1, 2008; 149(3): 1366 - 1376.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Yamashita, K. Wakazono, T. Nomoto, Y. Tsujino, T. Kuramoto, and T. Ushijima
Expression Quantitative Trait Loci Analysis of 13 Genes in the Rat Prostate
Genetics, November 1, 2005; 171(3): 1231 - 1238.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
N. Hokaiwado, M. Asamoto, K. Ogawa, and T. Shirai
Transgenic Disruption of Gap Junctional Intercellular Communication Enhances Early but Not Late Stage Hepatocarcinogenesis in the Rat
Toxicol Pathol, October 1, 2005; 33(6): 695 - 701.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y. Zeng, M. Yokohira, K. Saoo, H. Takeuchi, Y. Chen, K. Yamakawa, Y. Matsuda, Y. Kakehi, and K. Imaida
Inhibition of prostate carcinogenesis in probasin/SV40 T antigen transgenic rats by raloxifene, an antiestrogen with anti-androgen action, but not nimesulide, a selective cyclooxygenase-2 inhibitor
Carcinogenesis, June 1, 2005; 26(6): 1109 - 1116.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Omezzine, C. Mauduit, E. Tabone, N. Nabli, A. Bouslama, and M. Benahmed
Caspase-3 and -6 Expression and Activation Are Targeted by Hormone Action in the Rat Ventral Prostate During the Apoptotic Cell Death Process
Biol Reprod, September 1, 2003; 69(3): 752 - 760.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Grzmil, P. Thelen, B. Hemmerlein, S. Schweyer, S. Voigt, D. Mury, and P. Burfeind
Bax Inhibitor-1 Is Overexpressed in Prostate Cancer and Its Specific Down-Regulation by RNA Interference Leads to Cell Death in Human Prostate Carcinoma Cells
Am. J. Pathol., August 1, 2003; 163(2): 543 - 552.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. J. Thompson, N. N. C. Tam, J. M. Joyce, I. Leav, and S.-m. Ho
Gene Expression Profiling of Testosterone and Estradiol-17{beta}-Induced Prostatic Dysplasia in Noble Rats and Response to the Antiestrogen ICI 182,780
Endocrinology, June 1, 2002; 143(6): 2093 - 2105.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. O. Hellawell, G. D. H. Turner, D. R. Davies, R. Poulsom, S. F. Brewster, and V. M. Macaulay
Expression of the Type 1 Insulin-like Growth Factor Receptor Is Up-Regulated in Primary Prostate Cancer and Commonly Persists in Metastatic Disease
Cancer Res., May 1, 2002; 62(10): 2942 - 2950.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Asamoto, N. Hokaiwado, Y.-M. Cho, and T. Shirai
Effects of genetic background on prostate and taste bud carcinogenesis due to SV40 T antigen expression under probasin gene promoter control
Carcinogenesis, March 1, 2002; 23(3): 463 - 467.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Asamoto, M.
Right arrow Articles by Shirai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asamoto, M.
Right arrow Articles by Shirai, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online