| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
B Kinase Activity Correlates with Nuclear Factor-
B Activation in Human Melanoma Cells1
Veterans Affairs Medical Center [A. R.] and Department of Cancer Biology [J. Y., A. R.], Vanderbilt University School of Medicine, Nashville, Tennessee 37232
| ABSTRACT |
|---|
|
|
|---|
B
phosphorylation and degradation contribute to the high level of endogenous nuclear factor-
B (NF-
B) activation in Hs294T melanoma cells as compared with RPE cells (R. L. Shattuck-Brandt and A. Richmond, Cancer Res., 57: 30323039, 1997; M. N. Devalaraja et al., Cancer Res., 59: 13721377, 1999). To determine whether this endogenous NF-
B activation was characteristic of melanoma, we examined the level of constitutive activation of NF-
B in a number of melanoma cell lines. We demonstrate here that eight melanoma cell lines exhibit increased I
B kinase (IKK) activity, enhanced phosphorylation of I
B
and p65, and enhanced nuclear localization of p65/p50 in comparison to normal human epidermal melanocytes. The chemokines, CXC ligand 1 (CXCL1) and CXCL8, but not CXCL5, are highly expressed in most of the melanoma cell lines, suggesting that the constitutive production of chemokines is highly correlated to endogenous NF-
B activity. Our failure to observe a direct relationship between the fold activation of IKK, CXCL1, or CXCL8 mRNA levels and secretion of these chemokines into the culture medium suggest that regulation of chemokine expression also occurs at the posttranscription level of mRNA stability and/or translational control. Moreover, recombinant CXCL1 can directly induce IKK activity in normal human epidermal melanocytes in a concentration-dependent manner after up-modulation of CXCL1 protein expression, whereas inhibition of IKKß activity results in down-modulation of CXCL1 protein expression. Finally, CXCL1 antibody blocks IKK activity and inhibits the proliferation of melanoma cells to further support the concept that the constitutive activation of NF-
B and autocrine effects of CXCL1 play an important role in the pathogenesis of melanoma. | INTRODUCTION |
|---|
|
|
|---|
and ß, nerve growth factor, IL3
-1, IL-6, TNF
and ß, CXCL8 (IL-8), CXCL1 (MGSA
/GRO
), CCL5 (RANTES), CXCL10 (IP-10), CXCL9 (mig), and monocyte chemotactic and activating factor (1, 2, 3, 4, 5, 6, 7, 8, 9, 10)
. Overexpression of CXCL1, CXCL2, or CXCL3 (MGSA
, MGSAß, or MGSA
) in immortalized melanocytes results in tumor formation (11
, 12)
. CXCL8 has also been shown to enhance the growth, invasiveness, and metastatic potency of melanoma cells by a way of autocrine mechanism in mouse models (10
, 13)
and in human melanomas in vivo (14)
.
The CXC chemokine, MGSA
/GRO
or CXCL1, is highly secreted into the culture of human Hs294T malignant melanoma cells. CXCL1 protein was first purified and characterized in our lab (15
, 16) and was subsequently found to be the same as the growth-regulated gene, GRO (17)
. We now know that CXCL1 or GRO is a member of the CXC family of chemotactic cytokines and is chemotactic for cells expressing its receptor, CXCR2, including neutrophils, keratinocytes, melanocytes, and dendritic cells (18, 19, 20, 21, 22)
. Since then, two additional genes encoding proteins (CXCL2 and CXCL3) with high homology to CXCL1 have been identified (23, 24, 25)
, and these chemokines are aberrantly expressed in viral, inflammatory, and neoplastic disease (26
, 27)
, especially in melanoma cells but not in normal melanocytes (12
, 28, 29, 30)
.
Aberrant overexpression of CXCL1 has been implicated in transformation and melanoma tumor progression both in vivo and ex vivo (12
, 28 , 31, 32, 33, 34)
. During melanoma tumor progression, both the CXCL1 mRNA and protein levels are deregulated (34)
. In Hs294T melanoma cells, CXCL1 but not CXCL2 or CXCL3 is shown to exhibit high constitutive expression (35)
. The constitutive basal transcription appears to occur through activation of the NF-
B element in the proximal 5' regulatory region of the gene (35, 36, 37)
, although additional regulatory components are likely responsible for the selective constitutive expression of CXCL1 but not CXCL2 and CXCL3.
NF-
B is a heterodimeric transcription factor that is predominantly composed of Mr 65,000 and Mr 50,000 subunits of the Rel family. NF-
B modulation of gene expression is required for inflammatory response, the immune response, and cell growth and differentiation (38, 39, 40)
. In resting cells, NF-
B is largely retained in the cytoplasm by a family of inhibitory proteins known as I
B (mainly
, ß, and
), which contain multiple ankyrin repeats that interact with NF-
B to mask its nuclear translocation signal and sequester NF-
B proteins in the cytoplasm (41, 42, 43)
. The I
B (
, ß, and
) proteins contain two serine residues at the NH2 terminus that regulate protein stability (44)
. I
B
and I
Bß also contain a COOH-terminal PEST domain that contributes to basal protein turnover (45)
. Upon stimulation of cells by such cytokines as TNF-
, IL-1, and lipopolysaccharide, serine residues in the NH2 terminus of I
B are phosphorylated. The I
B protein is then ubiquitinated and degraded by the 26S proteasome, freeing the NF-
B proteins for translocation to the nucleus for subsequent transactivation of NF-
B responsive genes (43)
. We have demonstrated that the increased I
B
degradation results in the increased nuclear basal NF-
B activity in Hs294T cells, in contrast to ARPE cells, a variant of normal retinal pigment epithelial (36)
.
A family of I
B kinases (IKK
, IKKß, and IKK
) have been found to exist in a high molecular weight cytoplasmic complex (Mr 600,000 and Mr 900,000; Refs. 46, 47, 48, 49
). The kinase activity of IKK
and IKKß is induced with cytokine challenge with a consequent phosphorylation of I
B proteins (50)
. Within the high molecular weight IKK complex, two members of MAP3K family, MEKK1 and NIK, were identified (51
, 52)
. These kinases modulate the cytokine induction of the IKKs. NIK preferentially phosphorylates IKK
(53)
, and MEKK1 preferentially phosphorylates IKKß (54)
. In contrast to IKK
and IKKß, IKK
/NEMO/IKKAP1 and IKAP function as scaffold proteins and bind to NIK and IKKs to assemble them into an active kinase complex (55, 56, 57)
. Upon cytokine stimulation, active IKK
/ß phosphorylate I
B
as major mechanism for NF-
B activation. Our previous work has shown that during melanoma tumorigenesis, elevated endogenous IKK activity and increased degradation of I
B
lead to constitutive NF-
B activation and increased basal CXCL1 transcription in Hs294T malignant melanoma cells as compared with RPE cells. These events are implicated as a major molecular mechanism for melanocyte transformation (11
, 36
, 37)
. However, it needs to be determined whether: (a) the molecular alterations in Hs294T cells were common in other melanoma-derived cell lines; (b) other chemokines in addition to CXCL1 are expressed in melanoma cells; (c) CXCL1 could directly regulate IKK activity in normal human epidermal melanocytes and blockage of IKK activity could reduce CXCL1 secretion in melanoma cells; and (d) antibody to neutralize CXCL1 produced in melanoma cell cultures could block IKK activity and cell proliferation.
Toward this aim, this study has used normal human epidermal melanocytes as control cells and investigated eight human melanoma cell lines (Hs294T, Sk Mel 2, Sk Mel 5, Sk Mel 28, WM 115, WM 164, WM 852, and A375) for the endogenous activation of IKK and the level of expression of the CXC chemokines, CXCL1, CXCL5, and CXCL8 (MGSA
/GRO
, ENA-78, and IL-8, respectively). We found that all of the melanoma cells involved in this study exhibit high endogenous IKK activity, hyperphosphorylated I
B
, increased nuclear localization of p65/p50, and increased promoter activity of NF-
B, CXCL1, and AP-1. In addition, we determined that CXCL1 can up-regulate IKK activity in a concentration-dependent manner, and anti-CXCL1 inhibits the IKK activity and slows melanoma cell growth. There was diversity among the melanoma cell lines with regard to whether CXCL1, CXCL8, and/or CXCL5 were expressed endogenously. In contrast to chemokines, IL-1ß was either undetected or detected in very low levels in the culture medium of the melanoma cell cultures. These data suggest that constitutive activation of IKK with resultant endogenous expression of chemokines is a common feature of human melanoma.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies.
Anti-IKK
(H-744), IKKß (H-470), I
B
(C-21), actin (I-19), NF-
B p65 (C-20), and NF-
B p50 (NLS) antibodies were purchased from Santa Cruz Biotechnology and anti-phospho-I
B
(Ser-32) antibody was from New England Biolabs.
Western Blot Analysis.
Cytoplasmic extracts were prepared from cells cultured for 24 h in serum-free medium. Cells were mechanically released from tissue culture plates by scraping in cold PBS according to standard protocols. Cells were collected by centrifugation (800 x g), then resuspended in buffer A [10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.1% NP40, 1 mM DTT, and 0.5 mM phenylmethylsulfonyl fluoride] with Complete protein inhibitors (Boehringer Mannheim). Nuclei were collected by microcentrifugation (10,000 x g) at 4°C, washed twice in buffer A, and then spun through 0.25 M sucrose. Nuclei were lysed by shaking vigorously in buffer B [20 mM HEPES (pH 7.9), 0.4 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM phenylmethylsulfonyl fluoride] at 4°C for 20 min, and the resulting nuclear extracts were cleared by microcentrifugation (10,000 x g) at 4°C for 10 min. Cleared nuclear extracts were collected in the supernatant, and protein content was determined by Bio-Rad assay. An aliquot containing 50 µg of protein from each cell lysate was resolved on 10% SDS-PAGE, transferred to nitrocellulose membrane (Bio-Rad Lab), blotted in TBS-T with 5% Carnation fat-free instant milk, probed with the appropriate antibodies, and visualized by enhanced chemiluminescence assay.
Immunoprecipitation and Kinase Assay in Vitro.
To analyze the IKK activity, 200 µg of cytoplasmic extracts prepared using the procedures described for Western analysis were incubated with 1 µg of both IKK
and IKKß polyclonal antibodies (Santa Cruz Biotechnology) and 60 µg of Protein A/G agarose-conjugated beads for 3 h or overnight at 4°C. After washing with buffer C [50 mM HEPES (pH 7.0), 250 mM NaCl, 5 mM EDTA, and 0.1% NP40] twice and kinase buffer once, the beads were incubated with 20 µl of kinase buffer [20 mM HEPES (pH 7.4), 10 mM MgCl2, 2 mM MnCl2, 25 mM ß-glycerophosphate (Sigma Chemical Co. G-6251), 4 mM NaF, 0.1 mM sodium orthovanadate, and 1 mM DTT] containing 100 µM ATP, 5 µCi of [
-32P]ATP, and 1 µg of bacterially expressed glutathione S-transferase protein fused to amino acids 154 of I
B
(GST-I
B
) as a substrate of the I
B kinase at 30°C for 30 min. An expression vector for GST-I
B
(amino acids 154) was generated by inserting human I
B
cDNA encoding amino acids 154 into the BamHI-EcoRI site of pGEX-2T (Pharmacia) as described (58)
. The p65 kinase assay was performed as described (59)
with slight modification. Briefly, the immunoprecipitated IKK
/ß from cytosolic extracts was washed twice with buffer C and once with kinase buffer and incubated with 1 µg of GST-fused p65 (amino acids 354551; kindly provided by Dr. Wataru Toriumi, Discovery Research Laboratory, Tanabe Seiyaku Co., Ltd., Osaka, Japan) in kinase buffer [20 mM HEPES (pH 7.4), 20 mM MgCl2, 2 mM DTT, 20 mM ATP, 20 mM ß-glycerophosphate, 0.1 mM sodium orthovanadate, and 5 µCi of [
-32P]ATP] at 30°C for 30 min. The reaction mixtures were resolved by SDS-PAGE, transferred to nitrocellulose membrane, and followed by autoradiography. The same membrane was used for Western blot using the polyclonal antibodies to IKK
and IKKß to quantitate and normalize the kinase activities.
Transfection and Luciferase Reporter Activity Assay.
Melanoma cells and NHEM cells were seeded in a six-well plate, and the next day, 80% confluent cells were transfected with the respective constructs using the Effectene Transfection Reagent kit (Qiagen) according to the manufacturers protocol. The HIV-long terminal repeat-luciferase construct, containing two NF-
B binding sites, was the kind gift of Dr. Richard Gaynor (University of Texas Southwest Medical Center, Dallas, TX). The MGSA/GRO luciferase promoter construct included 350-bp of the CXCL1 promoter (-306 to +45) inserted into the pGL3-Luciferase reporter vector. The pRSV ß-galactosidase reporter vector was purchased from Promega Corp. (Madison, WI). Extracts from cultured cells were prepared, and the luciferase and ß-galactosidase were detected using a Dual-Light kit (Tropix) according to manufacturers instructions.
RT-PCR.
For RNA isolation and cDNA synthesis, total RNA was purified from 24-h, serum-free cultured melanoma cells and NHEM cells using Ultraspec RNA (Biotecx Laboratory, Inc.) according to manufacturers protocol. For removing DNA contamination, total RNA was processed using the Message Clean Kit (GenHunter Corp.). Briefly, 20 µg of RNA were digested with 10 units of DNase I at 37°C for 30 min, extracted with phenol:chloroform (3:1), precipitated with ethanol, washed with 70% ethanol, and finally dissolved in 20 µl of diethylpyrocarbonate-treated distilled water. To generate the first-strand cDNA from polyadenylated mRNA, the SuperScript Preamplification System (Life Technologies, Inc.) was used. Briefly, 0.5 µg of oligo-dT (1218 bp) as a primer and 200 units of SuperScript-2 reverse transcriptase were reacted with 2 µg of total RNA for 50 min at 42°C in the presence of 0.5 mM deoxynucleotide triphosphates, 10 mM DTT, and 1x First Strand buffer.
PCR Amplification.
PCR was carried out in a reaction volume of 25 µl using bulk master mixes, except template cDNA was prepared for multiple reactions. Each PCR reaction consisted of 1.25 units of Taq DNA polymerase (Sigma Chemical Co.), 1x PCR buffer, 0.2 mM deoxynucleotide triphosphates (Promega Corp.), 1 µl of cDNA, 200 nM of each pair of specific primers (CXCL1 primer, sense ATGGCCCGCGCTGCTCTCTCC and antisense CTTAACTATGGGGGATGCAGG; CXCL8 primer, sense GCAGCTCTGTGTGAAGGTGCA and antisense AACTTCTCCACAACCCTCTG) and 100 nM of each of the primers for GAPDH as a reference gene. The PCR was conducted as follows: denature at 95°C for 4 min followed by 35 cycles of 95°C for 1 min, anneal primers 1 min at 54°C for CXCL1 or 50°C for CXCL8, 72°C for 3 min, and a final extension at 72°C for 10 min. After PCR amplification, 12 µl of the PCR product mixed with loading buffer were subjected to electrophoresis in a 2% agarose gel under 1x TAE buffer [40 mM Tris · acetate, 2 mM Na2EDTA · 2H2O (pH 8.5)]. The PCR product size for CXCL1 or CXCL8 is 282 and 224 bp, respectively. The CXC chemokine PCR product was compared with the GAPDH PCR product as an internal control for the same cDNA, using the same master mixture and polymerase dilution, at the same time. To rule out the possibility that contaminating DNA was responsible for positive RT-PCR results, reactions carried out without cDNA (using water and/or purified RNA without reverse transcriptase treatment) did not show any positive signal in PCR product.
[3H]Thymidine Incorporation Assay.
[methyl-3H]Thymidine was purchased from Amersham Pharmacia Biotech, and the procedures described previously for monitoring incorporation of radiolabeled thymidine into DNA (15)
were slightly modified. Briefly, melanoma cells were placed into 24-well plates at a density of 104 cells/well in 10% FBS medium for overnight to allow attachment. The following day, cells were washed with PBS and cultured in serum-free medium with addition of 800 ng/ml of either anti-CXCL1 monoclonal antibody (MAB275; R&D) or IgG1 (MAB002; R&D) as a control antibody for 36 h. [methyl-3H]Thymidine (2 µCi/well) was then added to cultured cells, and incubation was continued for an additional 8 h. Cultured cells were fixed and washed with a 3:1 mixture of methanol:ethanol and collected in 6 ml of Scintiverse fluid. Radioactivity incorporated into DNA was counted in a Beckman Model LS-3801 liquid scintillation counter. The intraassay coefficient of variation was
17%.
ELISA Assay.
Melanoma cells and NHEM cells were seeded on six-well plates and cultured to 80% confluence in DMEM/F12 medium containing 10% FBS. The monolayers were washed in serum-free culture medium and then incubated in serum-free medium for an additional 24 h at 37°C, at which time the supernatant was collected and cleared by centrifugation. Aliquots were then subjected to ELISA assay (R&D system) according to the manufacturers protocol. Cells were lysed in RIPA buffer and assayed for total protein (Bio-Rad). Chemokine levels were calculated as chemokine/cytokine concentration/mg protein in the lysate.
| RESULTS |
|---|
|
|
|---|
B is common in melanoma tumor progression, we compared the expression of CXCL1, CXCL8, CXCL5, and IL-1ß in eight human melanoma cell lines and NHEM cells. The results in Table 1
|
B Kinases in Melanoma Cells.
B by cytokines involves transient activation of IKK. The recent findings of constitutively active IKK in adult leukemia cells infected with HTLV suggests that IKKs may play a potential role in lymphocyte transformation (58)
. Our previous study has demonstrated that IKK activity was higher in malignant melanoma Hs294T cells than in RPE cells (37)
. This led us to further explore whether the endogenous IKK activity existed in other melanoma cell lines as well. We assessed the levels of IKK activity in eight melanoma cell lines and compared that to the activity present in primary cultured normal human epidermal melanocytes. Using the protocols described in "Materials and Methods," IKK activity was assessed after immunoprecipitation of IKK
and IKKß, and the GST-I
B
(amino acids 154) as a substrate for the I
B kinase. The results showed that, compared with NHEM, the activities of I
B kinases were 314-fold higher in the melanoma cells as compared with the NHEM cultures (Fig. 1A)
|
B
in Melanoma Cells.
B
, the inhibitor of transcription factor NF-
B, at serine 32 and serine 36 (44)
. We studied the expression of I
B
protein and its phosphorylation in eight different malignant human melanoma cell lines as compared with NHEM. After culturing 24 h in serum-free medium, 50 µg of cytosolic extracts were subjected to Western blot for I
B
with anti-I
B
polyclonal antibody (c-21; Santa Cruz Biotechnology) and with a monoclonal antibody specific for phospho-serine 32 of I
B
(New England Biolabs). The density of the blots was quantified by densitometric scanning, and the ratio of phospho-I
B
to I
B
was calculated. As expected, the constitutive phosphorylation of I
B
in melanoma cells was obviously higher than that of normal human epidermal melanocytes (Fig. 2A)
B
protein appeared similar in melanoma cells as compared with NHEM (Fig. 2B)
B
. Moreover, the phosphorylation of I
B
is almost parallel with the IKK activity in melanoma cells as compared with normal melanocytes. The hyperphosphorylation of I
B
within the NF-
B complex in melanoma cells, taken together with its rapid degradation, is consistent with our previous results obtained from Hs294T and RPE or ARPE cells (36
, 37)
.
|
B Accumulation in Melanoma Cells and p65 Phosphorylation.
B
. To study the nuclear transactivation of p65/p50 in melanoma cells, we prepared cytosolic and nuclear extracts from melanoma cells and NHEM cells cultured for 24 h in serum-free medium as described in "Materials and Methods." A 50-µg aliquot of protein from each cell lysate was loaded per lane onto a 10% SDS-PAGE, transferred to nitrocellulose membrane, and immunoblotted with anti-NF-
B p65 and p50 polyclonal antibodies. Results revealed that both p65 and p50 protein were highly enriched in nuclei of melanoma cells as compared with NHEM cells, whereas p65/p50 proteins were almost equally expressed in the cytoplasm of both melanoma cells and NHEM (Fig. 3, A and B)
B and transactivating capacity of NF-
B (60)
, we examined the p65 phosphorylation by IKK
/ß in melanoma cells and normal melanocytes. On the basis of results from the in vitro p65 kinase assay, we found that the cytoplasmic p65 can be potentially phosphorylated by activated IKK in all melanoma cell lines involved in this experiment (Fig. 3C)
|
B, transcriptional up-regulation of CXCL1 is expected to occur in other melanoma cells, in addition to the Hs294T cells (35)
. To clarify this issue, total RNA was extracted from melanoma cells, and NHEM cells were cultured for 24 h in serum-free medium. DNA contamination was removed from RNA using DNase I digestion. The RT-PCR was conducted as described in "Materials and Methods" for CXCL1 mRNA in melanoma cell lines and normal human epidermal melanocytes using the reference gene GAPDH as a internal control. As expected, the expression of mRNA of both CXCL1 and CXCL8 was barely detectable in NHEMs and relatively high in most melanoma cells (Fig. 4)
|
B, CXCL1/350 bp, and AP-1 Promoter Luciferase Reporters in Melanoma Cells.
B, CXCL1/350 bp, and AP-1 promoter-luciferase constructs and 0.5 µg of the pRSV ß-galactosidase reporter vector using Effectene Transfection Reagent kit (Qiagen). Extracts from cultured cells were prepared, and the activities of luciferase and ß-galactosidase were detected using the Dual-Light kit (Tropix). Results in Table 2
B, CXCL1, and AP-1 by melanoma cells is higher than in that of NHEM cells.
|
B nuclear localization and expression of CXCL1 protein is prevalent in most melanoma cell lines, it is not known whether CXCL1 can directly induce IKK activity in normal human epidermal melanocytes. To resolve this issue, we treated serum-starved, 80% confluent cultures of NHEMs for 24 h with CXCL1. The cytoplasmic IKK
/ß complex was immunoprecipitated with anti-IKK
/ß polyclonal antibodies (Santa Cruz Biotechnology). IKK activity was detected using the specific substrate of recombinant GST-I
B
(amino acids 154) at 30°C for 30 min in the presence of [
-32P]ATP. Interestingly, CXCL1 can induce IKK activity in NHEM cells in a dose-dependent manner (Fig. 5)
|
/ß complex was immunoprecipitated with 1 µg of anti-IKK
/ß polyclonal antibodies (Santa Cruz Biotechnology). IKK activity was detected in vitro using the specific substrate of recombinant GST-I
B
(amino acids 154) as described in "Materials and Methods." The results in Fig. 6A
|
|
| DISCUSSION |
|---|
|
|
|---|
B complex and express a high level of CXCL1 as compared with RPE cells (36
, 37)
. To extend this finding, we studied eight cell lines derived from human malignant melanomas to monitor expression of CXCL1, CXCL5, and CXCL8 and the constitutive activation of NF-
B in malignant melanoma cells as compared with primary cultures of normal human epidermal melanocytes. Melanoma cells studied here were cultured under serum-free conditions to investigate the deregulation of signal transduction in melanoma cells, because serum contains growth factors that can induce activation of the IKK-NF-
B pathway. These data showed that most of the eight melanoma cell lines, as compared with NHEM, exhibit constitutive activation of the pathway leading to chemokine transcription, resulting in deregulation of CXCL1 and CXCL8 but not CXCL5 (with exception of Hs294T). The regulation of chemokine expression is complex, involving both transcription, mRNA stability, translation, and secretion, often resulting in varied expression of CXC chemokines among the melanoma cell lines. For example, CXCL5 is overexpressed in Hs294T but not the other melanoma cell lines, or RPE cells. At this time, we do not have an explanation for elevation in expression of CXCL5 in Hs294T melanoma cells. The promoter for CXCL5 remains poorly characterized.
In normal resting cells, the activity of the transcription factor NF-
B is tightly controlled in the cytoplasm by the inhibitory proteins, I
Bs. In the I
B family, I
B
plays a major role in regulating p65/p50 heterodimers of NF-
B because of the presence of a PEST sequence (P-E-D-S) in the COOH terminus of I
B
, which functions as a degradation signal to target the phospho-I
B
protein for rapid degradation (45)
. Recent studies have identified two cytokine-inducible I
B kinases, termed IKK
and IKKß, that target I
B
for degradation via phosphorylation at Ser-32 and Ser-36 (44)
. In the melanoma cells used in these experiments, both I
B kinase
and ß exhibit higher activities than in NHEM cells, resulting in hyperphosphorylation of I
B
followed by rapid degradation of I
B in melanoma cells. This leads to translocation of p65/p50 NF-
B heterodimers to the nuclei for increased transcription of NF-
B response genes. In agreement with the HTLV-I-infected T-cell system, our finding here further supports the concept that constitutive IKK activity and phosphorylation of I
B
are common mechanisms for the persistent NF-
B activation in the transformed cells. In fact, the cellular NF-
B signal pathway is phosphorylation dependent. In addition to phosphorylation of I
B
leading to its degradation and subsequently nuclear translocation of p65/p50, inducible phosphorylation of p65, by either TNF-
in HeLa cells and B cells (61)
or by acetaldehyde in HEPG2 (60)
, is reported to enhance the DNA binding activity of NF-
B p65 and the transactivating capability of NF-
B. Sakurai et al. (59)
demonstrated that upon stimulation of HeLa cells by TNF-
, IKKs directly phosphorylate p65 in vivo and in vitro. Here we reveal that p65 is readily phosphorylated by IKK immunoprecipitated from melanoma cells but is barely phosphorylated by the IKK complex immunoprecipitated from NHEMs. Moreover, both p65 and I
B
become strongly phosphorylated by IKK
/ß with the same kinetics (data not shown). Thus, our data suggest that p65 phosphorylation by IKK might contribute to the nuclear NF-
B activity in melanoma cells. This endogenous NF-
B in the tumor cells in turn allows escape from apoptosis and thus contributes to the malignant phenotype (62)
.
Interestingly, all of the melanoma cell lines involved in this study exhibit constitutive IKK activity, hyperphosphorylation of I
B
, and persistent translocation of nuclear p65/p50. These results correlated with NF-
B luciferase reporter assay results. However, differences in the degradation rate of phospho-I
B
in the Sk Mel 2 cells may contribute to the phenomenon of high IKK activity accompanied by accumulation of only a low level of phosphorylated I
B
in this cell line. Specifically, CXCL1 and CXCL8 mRNA were highly expressed in all melanoma cells but were barely detectable in normal human epidermal melanocytes. These data are in general agreement with the high level of CXCL1 and CXCL8 protein produced in most melanoma cell lines involved in this study. These results indicate that activation of NF-
B is sufficient to induce CXCL1 expression, but other variables may also affect chemokine expression, such as mRNA stability, translation, and posttranslational processing, resulting in failure to observe a simple linear correlation between fold induction of IKK activities, NF-
B activation, CXCL1 mRNA, and secreted protein levels between melanoma cell lines. For example, induction of IL-8 transcription requires coordinate activation of NF-
B and AP-1 or CAAT/enhancer binding protein. In several of the melanoma cell lines studied here, AP-1 is endogenously activated concomitantly with NF-
B. Thus, similar to CXCL1, CXCL8 is also involved in maintenance of the malignant phenotype of some of melanoma cell lines (10
, 13)
.
To explore the possibility that CXCL1 might directly activate NF-
B as a mechanism in the tumorigenesis of human melanoma, normal human epidermal melanocytes were stimulated with exogenous CXCL1, and effects on NF-
B activation were monitored. We observed that CXCL1 induces IKK activity in normal human epidermal melanocytes in a dose-dependent fashion, demonstrating that CXCL1 itself may participate in the maintenance of constitutive NF-
B activity. To obtain more insight into the causal relationship between NF-
B signaling and production of the CXCL1 oncoprotein, the constitutive IKK activity in melanoma was reduced by sulindac, an IKKß inhibitor (63)
, and this decrease in IKK activity resulted in decrease in CXCL1 production. These data suggested that IKKß plays a major but not a exclusive role in modulation of CXCL1 expression in normal human epidermal melanocyte culture followed CXCL1 or IL-ß induction (data not shown). To further explore the role that CXCL1 plays as an autocrine factor on IKK-NF-
B signaling, anti-CXCL1 antibody was added to various melanoma cell cultures to block the binding of secreted CXCL1 to the CXCR2 receptor. This resulted in down-regulation of IKK activity in the SK Mel 5 melanoma cell line in a concentration-dependent manner. Treatment of ligand with 50-fold excess of CXCL1 antibody partially blocked IKK activity and inhibited cell proliferation in all of the melanoma cell lines, with the exception of the WM 852 cell line, which showed only slight inhibition in proliferation. The low level of CXCL1 in WM 852 cells may indicate that other chemokines/cytokines are involved in the IKK-NF-
B activation. Genetic differences among melanoma cell lines may also contribute to the differences between WM 852 and the other melanomas (64)
. Anti-CXCL8 also partially inhibited the growth of melanoma cells (data not shown). Even more effective inhibition of cell proliferation occurred by blockage of the CXCR2 receptor with 100 mM SB225002, a highly selective CXCR2 inhibitor (data not shown). These data support our hypothesis that autocrine effects of CXCL1 and CXCL8 participate in melanocyte transformation and maintenance of the malignant state.
NF-
B is a crucial transcription factor involved in the control of gene expression of several chemokines, cytokines, and enzymes that protect cells from death (65, 66, 67)
or from apoptosis (68, 69, 70, 71)
and for regulating several tumorigenic and angiogenic factors (72)
. Data provided here further demonstrate that the constitutive expression of NF-
B occurs not only in Hs294T melanoma cells but also in the malignant melanoma cell lines of Sk Mel 2, Sk Mel 5, Sk Mel 28, WM 115, WM 164, WM 852, and A 375. Alterations in NF-
B activity in these melanoma cells are strongly correlated with melanocyte transformation. Our melanoma model is similar to the leukemia model, where the tax oncoprotein encoded by HTLV-I stimulates the constitutive nuclear expression of transcription factor NF-
B. This activated NF-
B regulates antigen-directed T-cell proliferation (39
, 73)
, leading to the loss of cell cycle control and development of an aggressive malignant adult T-cell leukemia (74)
. In the melanoma model, overexpression of CXCL1 and/or CXCL8 is highly associated with the constitutive activation of NF-
B and malignant phenotype. Antisense studies of the transcriptional regulation of NF-
B further support the role of NF-
B in the pathogenesis of cancer. Similar to HTLV-I-infected T cells, mammary carcinoma, head and neck squamous cell carcinoma, and melanoma all exhibit constitutive activation of NF-
B (37
, 75, 76, 77, 78)
. The experiments described here enhance our understanding of the mechanism by which CXCL1 and CXCL8 expression increases as melanocytes progress to malignant melanoma (29
, 32
, 79)
. Because both CXCL1 and CXCL8 may serve as autocrine growth factors for several melanoma cell lines (10
, 13
, 16
, 80)
, antibodies to both CXCL1 and CXCL8, or inhibitors which block the CXCR2 receptor, inhibit the autocrine loop and slow the proliferation of melanoma cells. These findings strongly indicate that development of better strategies for selectively inhibiting NF-
B activity in melanoma tumor cells will have significant therapeutic benefit.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by the NCI Grant CA56704 (to A. R.), a Department of Veterans Affairs Career Scientist Award (to A. R.), and Grant 5P30 AR41943 from the Skin Disease Research Center. ![]()
2 To whom requests for reprints should be addressed, at Department of Cell Biology, T2212 Medical Center North, Vanderbilt University School of Medicine, Nashville, TN 37232. Phone: (615) 343-7777; Fax: (615) 343-4539; E-mail: Ann.Richmond{at}mcmail.Vanderbilt.edu ![]()
3 The abbreviations used are: IL, interleukin; TNF, tumor necrosis factor; MGSA, melanoma growth stimulatory activity; NF-
B, nuclear factor-
B; NIK, NF-
B-inducing kinase; RPE, retinal pigment epithelial; NHEM, normal human epidermal melanocyte; CXCL, CXC ligand; GRO, growth-regulated protein; IL, interleukin; IKK, I
B kinase; AP-1, activator protein 1; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FBS, fetal bovine serum; HTLV, human T-cell leukemia virus; GST, glutathione S-transferase. ![]()
Received 9/21/00. Accepted 4/16/01.
| REFERENCES |
|---|
|
|
|---|
, interleukin-1ß, endothelin-1, and tumour necrosis factor-
. Br. J. Dermatol., 39: 216-224, 1998.
on melanocyte transformation. Oncogene, 6: 1115-1124, 1991.[Medline]
proteins. Int. J. Cancer, 73: 94-103, 1997.[Medline]
and its correlation with that of the inflammatory cytokine GRO. J. Acquir. Immune Defic. Syndr., 5: 1099-1104, 1992.
-chemokines inhibits the tumor growth and pulmonary metastasis of human melanoma cells in nude mice. Melanoma Res., 9: 105-114, 1999.[Medline]
B
contributes to endogenous activation of NF-
B in Hs294T melanoma cells. Cancer Res., 57: 3032-3039, 1997.
B kinase activity and I
B
phosphorylation in Hs294T melanoma cells leads to increased basal MGSA/GRO-
transcription. Cancer Res., 59: 1372-1377, 1999.
B. Nature (Lond.), 376: 167-170, 1995.[Medline]
B. Ten years after. Cell, 87: 13-20, 1996.[Medline]
B antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science (Wash. DC), 281: 1680-1683, 1998.
B interacts with the nuclear localization sequences of the subunits of NF-
B: a mechanism for cytoplasmic retention. Genes Dev., 6: 1899-1913, 1992.
B
: a mechanism for NF-
B activation. Mol. Cell. Biol., 13: 3301-3310, 1993.
B and I
B proteins: new discoveries and insights. Annu. Rev. Immunol., 14: 649-683, 1996.[Medline]
B kinase complex. Science (Wash. DC), 278: 818-819, 1997.
B
in vitro and in vivo requires the acidic C-terminal domain of the protein. Mol. Cell. Biol., 15: 2413-2419, 1995.[Abstract]
B kinase that activates the transcription factor NF-
B. Nature (Lond.), 388: 548-554, 1997.[Medline]
B kinases essential for NF-
B activation. Science (Wash. DC), 278: 860-866, 1997.
B kinase. Cell, 90: 373-383, 1997.[Medline]
B kinase-ß. NF-
B activation and complex formation with I
B kinase-
and NIK. Science (Wash. DC), 278: 866-869, 1997.
B by IKK
and IKKß: discrimination between free and NF-
B-bound substrate. Science (Wash. DC), 281: 1360-1363, 1997.
B induction by TNF, CD95, and IL-1. Nature (Lond.), 385: 540-544, 1997.[Medline]
B kinases by mitogen-activated protein kinase kinase kinase 1 and NF-
B-inducing kinase. Mol. Cell. Biol., 18: 7336-7343, 1998.
B-inducing kinase activates IKK-
by phosphorylation of Ser-176. Proc. Natl. Acad. Sci. USA, 95: 3792-3797, 1998.
B kinase
and ß by two upstream kinases, NF-
B-inducing kinase and mitogen-activated protein kinase/ERK kinase kinase-1. Proc. Natl. Acad. Sci. USA, 95: 3537-3542, 1998.
B kinase complex essential for NF-
B activation. Cell, 93: 1231-1240, 1998.[Medline]
is an essential regulatory subunit of the I
B kinase complex. Nature (Lond.), 395: 297-300, 1998.[Medline]
B activity and as a target of an adenovirus inhibitor of tumor necrosis factor
-induced apoptosis. Proc. Natl. Acad. Sci. USA, 96: 1042-1047, 1999.
mediates the interaction of cellular I
B kinases with the tax transforming protein of human T cell leukemia virus type 1. J. Biol. Chem., 274: 15297-15300, 1999.
B kinases phosphorylate NF-
B p65 subunit on serine 536 in the transactivation domain. J. Biol. Chem., 274: 30353-30356, 1999.
B and AP-1 by acetaldehyde in HEPG2 cells. J. Biol. Chem., 275: 14684-14690, 2000.
B in vivo is regulated by multiple phosphorylations. EMBO J., 13: 4597-4607, 1994.[Medline]
B activity correlates with growth, angiogenesis, and metastasis of human melanoma cells in nude mice. Clin. Cancer Res., 6: 2573-2581, 2000.
B pathway. J. Biol. Chem., 274: 27307-273114, 1999.
B/Rel is apoptogenic in cytokine withdrawal-induced programmed cell death. Cancer Res., 60: 1202-1205, 2000.
B is required for H-ras oncogene induced abnormal cell proliferation and tumorigenesis. Oncogene, 19: 841-849, 2000.[Medline]
, MnSOD, and IL-6. Anticancer Res., 20: 451-458, 2000.[Medline]
B/Rel family of transcription factors in oncogenic transformation and apoptosis. Mutat. Res., 437: 231-243, 1999.[Medline]
-induced apoptosis by NF-
B. Science (Wash. DC), 274: 787-789, 1996.
B. Science (Wash. DC), 274: 784-787, 1996.
B and Rel protein: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol., 16: 225-260, 1998.[Medline]
B element in the IL-2 receptor
gene. Science (Wash. DC), 241: 1652-1655, 1988.
B/Rel expression and the pathogenesis of breast cancer. J. Clin. Investig., 100: 2952-2960, 1997.[Medline]
B during progression of breast cancer to hormone-independent growth. Mol. Cell. Biol., 17: 3629-3639, 1997.[Abstract]
)B, AP-1, and NF-IL6 in human head and neck squamous cell carcinoma cell lines that express pro-inflammatory and pro-angiogenic cytokines. Mol. Carcinog., 26: 119-129, 1999.[Medline]
B/Rel occurs early during neoplastic transformation of mammary cells. Carcinogenesis (Lond.), 21: 871-879, 2000.This article has been cited by other articles:
![]() |
J. Yang, S. Zaja-Milatovic, Y.-M. Thu, F. Lee, R. Smykla, and A. Richmond Molecular determinants of melanoma malignancy: selecting targets for improved efficacy of chemotherapy Mol. Cancer Ther., March 1, 2009; 8(3): 636 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xia, R. C. Padre, T. H. De Mendoza, V. Bottero, V. B. Tergaonkar, and I. M. Verma Phosphorylation of p53 by I{kappa}B kinase 2 promotes its degradation by {beta}-TrCP PNAS, February 24, 2009; 106(8): 2629 - 2634. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dhawan, Y. Su, Y. M. Thu, Y. Yu, P. Baugher, D. L. Ellis, T. Sobolik-Delmaire, M. Kelley, T. C. Cheung, C. F. Ware, et al. The Lymphotoxin-{beta} Receptor Is an Upstream Activator of NF-{kappa}B-mediated Transcription in Melanoma Cells J. Biol. Chem., May 30, 2008; 283(22): 15399 - 15408. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sethi, B. Sung, and B. B. Aggarwal Nuclear Factor-{kappa}B Activation: From Bench to Bedside Experimental Biology and Medicine, January 1, 2008; 233(1): 21 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Braunstein, S. C. Formenti, and R. J. Schneider Acquisition of Stable Inducible Up-Regulation of Nuclear Factor-{kappa}B by Tumor Necrosis Factor Exposure Confers Increased Radiation Resistance without Increased Transformation in Breast Cancer Cells Mol. Cancer Res., January 1, 2008; 6(1): 78 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Bieche, C. Chavey, C. Andrieu, M. Busson, S. Vacher, L. Le Corre, J.-M. Guinebretiere, S. Burlinchon, R. Lidereau, and G. Lazennec CXC chemokines located in the 4q21 region are up-regulated in breast cancer Endocr. Relat. Cancer, December 1, 2007; 14(4): 1039 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zhang, X. Jin, F. Wang, S. Wang, C. Deng, Z. Gao, and C. Guo Combined Prognostic Value of Both RelA and I{kappa}B-{alpha} Expression in Human Non Small Cell Lung Cancer Ann. Surg. Oncol., December 1, 2007; 14(12): 3581 - 3592. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, W.-H. Pan, G. A. Clawson, and A. Richmond Systemic Targeting Inhibitor of {kappa}B Kinase Inhibits Melanoma Tumor Growth Cancer Res., April 1, 2007; 67(7): 3127 - 3134. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Fernandez-Majada, C. Aguilera, A. Villanueva, F. Vilardell, A. Robert-Moreno, A. Aytes, F. X. Real, G. Capella, M. W. Mayo, L. Espinosa, et al. Nuclear IKK activity leads to dysregulated Notch-dependent gene expression in colorectal cancer PNAS, January 2, 2007; 104(1): 276 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Loewe, T. Valero, S. Kremling, B. Pratscher, R. Kunstfeld, H. Pehamberger, and P. Petzelbauer Dimethylfumarate Impairs Melanoma Growth and Metastasis Cancer Res., December 15, 2006; 66(24): 11888 - 11896. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Sosman and I. Puzanov Molecular targets in melanoma from angiogenesis to apoptosis. Clin. Cancer Res., April 1, 2006; 12(7): 2376s - 2383s. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, K. I. Amiri, J. R. Burke, J. A. Schmid, and A. Richmond BMS-345541 Targets Inhibitor of {kappa}B Kinase and Induces Apoptosis in Melanoma: Involvement of Nuclear Factor {kappa}B and Mitochondria Pathways Clin. Cancer Res., February 1, 2006; 12(3): 950 - 960. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Matsumoto, J.-i. Namekawa, M. Muta, T. Nakamura, H. Bando, K. Tohyama, M. Toi, and K. Umezawa Targeting of Nuclear Factor {kappa}B Pathways by Dehydroxymethylepoxyquinomicin, a Novel Inhibitor of Breast Carcinomas: Antitumor and Antiangiogenic Potential In vivo Clin. Cancer Res., February 1, 2005; 11(3): 1287 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cheng, C. Cenciarelli, G. Nelkin, R. Tsan, D. Fan, C. Cheng-Mayer, and I. J. Fidler Molecular Mechanism of hTid-1, the Human Homolog of Drosophila Tumor Suppressor l(2)Tid, in the Regulation of NF-{kappa}B Activity and Suppression of Tumor Growth Mol. Cell. Biol., January 1, 2005; 25(1): 44 - 59. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Brar, C. Grigg, K. S. Wilson, W. D. Holder Jr., D. Dreau, C. Austin, M. Foster, A. J. Ghio, A. R. Whorton, G. W. Stowell, et al. Disulfiram inhibits activating transcription factor/cyclic AMP-responsive element binding protein and human melanoma growth in a metal-dependent manner in vitro, in mice and in a patient with metastatic disease Mol. Cancer Ther., September 1, 2004; 3(9): 1049 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Munshi, J. F. Kurland, T. Nishikawa, P. J. Chiao, M. Andreeff, and R. E. Meyn Inhibition of constitutively activated nuclear factor-{kappa}B radiosensitizes human melanoma cells Mol. Cancer Ther., August 1, 2004; 3(8): 985 - 992. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. I. Amiri, L. W. Horton, B. J. LaFleur, J. A. Sosman, and A. Richmond Augmenting Chemosensitivity of Malignant Melanoma Tumors via Proteasome Inhibition: Implication for Bortezomib (VELCADE, PS-341) as a Therapeutic Agent for Malignant Melanoma Cancer Res., July 15, 2004; 64(14): 4912 - 4918. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. P. Veiby and M. A. Read Chemoresistance: Impact of Nuclear Factor (NF)-{kappa}B Inhibition by Small Interfering RNA: Commentary re J. Guo et al., Enhanced Chemosensitivity to Irinotecan by RNA Interference-Mediated Down-Regulation of the NF-{kappa}B p65 Subunit. Clin Cancer Res 2004;10:3333-3341 Clin. Cancer Res., May 15, 2004; 10(10): 3262 - 3264. [Full Text] [PDF] |
||||
![]() |
R. D. Sue, J. A. Belperio, M. D. Burdick, L. A. Murray, Y. Y. Xue, M. C. Dy, J. J. Kwon, M. P. Keane, and R. M. Strieter CXCR2 Is Critical to Hyperoxia-Induced Lung Injury J. Immunol., March 15, 2004; 172(6): 3860 - 3868. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takada and B. B. Aggarwal Betulinic Acid Suppresses Carcinogen-Induced NF-{kappa}B Activation Through Inhibition of I{kappa}B{alpha} Kinase and p65 Phosphorylation: Abrogation of Cyclooxygenase-2 and Matrix Metalloprotease-9 J. Immunol., September 15, 2003; 171(6): 3278 - 3286. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Bayon, M. A. Ortiz, F. J. Lopez-Hernandez, F. Gao, M. Karin, M. Pfahl, and F. J. Piedrafita Inhibition of I{kappa}B Kinase by a New Class of Retinoid-Related Anticancer Agents That Induce Apoptosis Mol. Cell. Biol., February 1, 2003; 23(3): 1061 - 1074. [Abstract] [Full Text] |
||||
![]() |
P. Dhawan and A. Richmond Role of CXCL1 in tumorigenesis of melanoma J. Leukoc. Biol., July 1, 2002; 72(1): 9 - 18. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ariga, J.-i. Namekawa, N. Matsumoto, J.-i. Inoue, and K. Umezawa Inhibition of Tumor Necrosis Factor-alpha -induced Nuclear Translocation and Activation of NF-kappa B by Dehydroxymethylepoxyquinomicin J. Biol. Chem., June 28, 2002; 277(27): 24625 - 24630. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Birbach, P. Gold, B. R. Binder, E. Hofer, R. de Martin, and J. A. Schmid Signaling Molecules of the NF-kappa B Pathway Shuttle Constitutively between Cytoplasm and Nucleus J. Biol. Chem., March 22, 2002; 277(13): 10842 - 10851. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dhawan and A. Richmond A Novel NF-kappa B-inducing Kinase-MAPK Signaling Pathway Up-regulates NF-kappa B Activity in Melanoma Cells J. Biol. Chem., March 1, 2002; 277(10): 7920 - 7928. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Arlt, J. Vorndamm, S. Muerkoster, H. Yu, W. E. Schmidt, U. R. Folsch, and H. Schafer Autocrine Production of Interleukin 1{beta} Confers Constitutive Nuclear Factor {kappa}B Activity and Chemoresistance in Pancreatic Carcinoma Cell Lines Cancer Res., February 1, 2002; 62(3): 910 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, G.-H. Fan, B. E. Wadzinski, H. Sakurai, and A. Richmond Protein Phosphatase 2A Interacts with and Directly Dephosphorylates RelA J. Biol. Chem., December 14, 2001; 276(51): 47828 - 47833. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Brar, T. P. Kennedy, A. B. Sturrock, T. P. Huecksteadt, M. T. Quinn, A. R. Whorton, and J. R. Hoidal An NAD(P)H oxidase regulates growth and transcription in melanoma cells Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1212 - C1224. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |