| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Department of Molecular Pharmacology, St. Jude Childrens Research Hospital, Memphis, Tennessee 38105
| ABSTRACT |
|---|
|
|
|---|
2050-fold and eradicated their clonogenic potential. Also, after "purging," RNA for neuroblastoma cell markers (tyrosine hydroxylase, synaptophysin, and N-MYC) was undetectable by reverse transcription-PCR. In contrast, the purging protocol did not affect the number or type of colonies formed by CD34+ cells in an in vitro progenitor cell assay. No bystander effect on CD34+ cells was observed. The method described is being investigated for its potential clinical utility, particularly its efficacy for use with patients having relatively high tumor burdens, because no published methods have been shown to be efficacious when the tumor burden exceeds 1%. | INTRODUCTION |
|---|
|
|
|---|
Purging techniques target exploitable differences between tumor cells and hematopoietic cells to produce tumor cell-specific depletion. A variety of purging methods have been reported. Shpall et al. (9)
purged breast cancer cells from hematopoietic cells using immunomagnetic techniques. Kies et al. (10)
used a discontinuous bovine albumin gradient to select out hematopoietic progenitor cells in bone marrow samples contaminated with breast cancer cells. Stribbling et al. (11)
attached prodrug-activating enzymes to tumor-specific antibodies (antibody- directed enzyme prodrug therapy) to produce tumor cell-selective drug activation and toxicity. A recently published clinical study (12)
used a combination of sedimentation, filtration, and magnetic immunobeads for separation of tumor cells from hematopoietic cells before autologous stem cell rescue of NB patients. One of the eligibility criteria for this trial was a tumor burden at harvest of
1% NB cells.
Of the reported approaches, VDEPT using adenoviral vectors seems particularly promising (13, 14, 15)
. Clarke et al. (16)
first reported the selective transduction by Ad of NB cells and breast cancer cells compared with hematopoietic cells. Chen et al. (17)
determined that this tumor cell selectivity was likely explained by the presence or absence of the coxsackie Ad receptor needed for binding of Ad to the cell surface and expression of
Vß5 or
Vß3 integrins required for internalization of the virus into the cell. The premise that underlies VDEPT approaches to purging using adenoviral vectors is that Ades achieve tumor cell-specific delivery and expression of a cDNA that encodes a drug-activating enzyme, and subsequent exposure to the appropriate prodrug results in activation of the prodrug selectively in tumor cells expressing the transgene.
The best characterized VDEPT purging approaches use a replication-deficient Ad to deliver the cDNA encoding Hsvtk to sensitize tumor cells to ganciclovir (14, 15) . Using Ad, Hsvtk, and ganciclovir, Teoh et al. (14) eradicated multiple myeloma cells without affecting the viability of hematopoietic progenitor cells. In other studies (15) in which similar methods were used, however, two to six log reductions of tumor cells were demonstrated, but viable tumor cells remained. Likely, the clinical potential of VDEPT will be achieved by optimizing each component (virus, enzyme, and prodrug) to the specific tumor being targeted.
We are investigating a VDEPT approach designed to purge NB cells from hematopoietic stem cells using Ad, rCE, and CPT-11. Ad selectively transduces NB cells; overexpression of rCE sensitizes tumor cells to CPT-11 (18, 19, 20, 21) ; and NB tumors are relatively sensitive to SN-38, the active form of CPT-11 (22 , 23) . The following study describes in vitro experiments to develop this VDEPT approach to purging.
| MATERIALS AND METHODS |
|---|
|
|
|---|
CPT-11 stock solution (10 mM) in methanol was stored at -20°C, and dilutions were made with water immediately before use.
Human Peripheral Mononuclear and CD34+ Cell Preparations
Peripheral blood was collected from healthy volunteers, and the PBMNCs were harvested using Ficoll-Hypaque (Histopaque-1077) according to the directions of the manufacturer (Sigma Chemical Co. Diagnostics, St. Louis, MO). PBMNCs were used the same day they were collected. Granulocyte-stimulating factor-mobilized CD34+ peripheral blood cells were purchased frozen from Poietics of Clonetics (Walkersville, MD) and stored in liquid nitrogen. On the day of use, CD34+ cells were thawed quickly, pelleted by centrifugation, and washed once with 0.9% NaCl.
Viral Transduction Efficiency
An E1a-, E3-deleted, replication-deficient Ad containing the RSV promoter and the reporter gene ß-gal (AdRSV ß-gal) was obtained from Genetic Therapy, Inc., a Novartis company (Gaithersburg, MD). This Ad was used to assess the transduction efficiency of Ad for cell lines, primary NB, and hematopoietic cells. Cells were plated at a concentration of 40,000 cells/well on 2-well chamber slides (LAB-TEK, Naperville, IL) and exposed to virus in 2% or 10% serum at MOIs ranging from 1500 for 24 h. The cells were then incubated an additional 24 h to allow for protein expression and fixed in 2% paraformaldehyde/0.2% glutaraldehyde in PBS, washed in PBS, and incubated overnight with X-gal substrate (24)
. To determine the percentage of cells transduced, 200 cells from each chamber were counted, and the number of positively stained cells was noted. A cell was considered positive only if it appeared very dark blue. Each MOI determination was done in triplicate, and slides were read by two investigators independently. PBMNCs were also assayed for ß-gal activity as above with the following modification; after the 24-h incubation to allow for protein expression, the suspension of PBMNCs was fixed onto glass slides using a Shandon Cytospin 3 cytocentrifuge at 400 rpm for 8 min.
Assessment of Cytotoxicity to NB Cell Lines
To determine the effect of virus, CPT-11, or the combination on NB cell lines, clonogenic assays were performed. Cells (3000/well) were plated in 6-well plates (Costar, Cambridge, MA), allowed to attach, and then exposed to virus, drug, or both. The toxicity of viral MOIs of 1100 for 24 h and various concentrations of CPT-11 for 4 h were assessed. The combined toxicity of Ad and CPT-11 was evaluated by exposing the cells to virus for 24 h and then adding CPT-11 for 4 h, 48 h after virus had been removed. After a time equivalent to five doublings of the untreated control cells, the cells were stained with crystal violet, and colonies of >10 cells were imaged using the Alpha Imager 200 documentation system (Alpha Innotech Corporation, San Leandro, CA) and counted using Labworks computer software by UVP Technologies. Results are expressed as the percentage of survival compared with that of untreated control colonies. Dishes were also checked microscopically to verify results when no colonies were detected by the automated counter.
Assessment of Cytotoxicity to Human Progenitor Cells
To evaluate the effect of Ad, CPT-11, or both on hematopoietic cells, methylcellulose-based assays (25
, 26)
were performed on PBMNCs and on granulocyte-stimulating factor-mobilized peripheral CD34+ cells.
PBMNCs.
After Ficoll-Hypaque separation, the mononuclear cell layer of peripheral blood was obtained, and the number of nucleated cells was counted using a hemocytometer. PBMNCs (1 x 106) were aliquoted into 35-mm cell suspension dishes (Sarstedt, Newton, NC) and exposed to various MOIs of Ad for 24 h, to CPT-11 for 4 h, or to both. After exposure to virus with or without CPT-11, adherent cells were dislodged, and cell suspensions were transferred to microcentrifuge tubes and centrifuged at 2000 rpm for 5 min. Supernatants were discarded, and the cells were resuspended in 500 µl of 2% Iscoves modified Dulbeccos medium. The 500 µl of cell suspension was then added to 5 ml of Methocult GF H4434 containing 50 ng/ml recombinant human SCF, 10 ng/ml IL-3, and 3 units/ml erythropoietin (Stem Cell Technologies, Vancouver, British Columbia, Canada) and vortexed. Aliquots (1.2 ml) were distributed by syringe with a blunt-end needle into 35-mm gridded dishes (NUNC, Naperville, IL). Dishes were incubated at 37°C in high humidity, and colonies were counted microscopically between day 10 and day 14. Results are reported as the total number of colony forming units for neutrophils and monocytes, colony-forming units for late erythroid progenitors, and colony-forming units for granulocytes, erythrocytes, macrophages, and megakaryocytes, compared with untreated controls.
CD34+ Cells.
CD34+ cells were processed as the PBMNCs were except that cells were plated at 1200 cells/dish. It should be noted that when the above concentrations of SCF, IL-3, and erythropoietin are used to culture CD34+ cells in vitro, the cell number may increase by
1.2-fold to
1.9-fold in 24 days. Therefore, the percentage or number of colonies surviving exposure to Ad or CPT-11 reflects any increase in cell number occurring during that time, combined with the effect of Ad and/or drug treatment on the cells originally plated.
Quantitation of CE Activity
CE activity was determined as described previously (18)
. One unit of activity is defined as µmol of o-nitrophenol produced from o-nitrophenyl acetate/mg protein/min.
Purging of NB Cell Lines from PBMNCs or CD34+ Cells
AdRSVrCE Virus.
A replication-deficient E1a-, E3-deleted Ad containing the cDNA encoding an intracellular form of rCE was used for purging experiments. Expression of the CE was regulated by the RSV promoter. This virus and the intracellular enzyme that it encodes have been characterized in detail in a separate study (see previous article; 27).
Purging Procedure.
PBMNCs or CD34+ cells (1.8 x 107) were mixed with NB-1691, SJNB-1, or SK-N-SH cells (0.2 x 107) and divided into two 175-cm2 flasks. To one flask, AdRSVrCE was added at an MOI of 50. The other flask was maintained as an untreated control. After 24 h, the cells in each flask were pelleted by centrifugation, the medium was decanted, and the cells were resuspended in medium containing human growth factors (300 ng/ml SCF, 10 ng/ml IL-3, and 50 ng/ml IL-6). After an additional 48 h, 5 µM CPT-11 was added to the flask of cells that had been exposed to virus. Medium was again replaced in both flasks 4 h later. Aliquots were taken from the "purged" and "unpurged" flasks and plated for clonogenic or progenitor cell assays. For clonogenic assays, a sufficient number of cells was plated such that
3000 colonies were detected in flasks containing unpurged samples. For progenitor cell assays, six replicate wells were plated for purged and unpurged cell suspensions.
Detection by RT-PCR of Cells Expressing NB Cell Markers After Purging
Adherent and nonadherent cells were harvested from flasks containing 500,000 cells, and RNA was extracted using an RNAqueous nucleic acid extraction kit (Ambion, Inc., Austin, TX). Total cellular RNA (2 µg) was reverse transcribed using Ready-to-Go You-Prime First-Strand beads (Amersham Pharmacia Biotech, Inc., Piscataway, NJ) according to the directions of the manufacturer. PCR analysis was done for three NB markers, TH (28)
, SYN, and N-MYC. Primers to detect BA were used to verify the integrity of the RNA and as a positive control for the RT-PCR reactions. Primers used for detection of the above RNAs were: TH5', GTGTCAGAGCTGGACAAGTG; TH3', GATATTGTCTTCCCGGTAGCCGCTGA; SYN5', GCACCACCAAGGTCTTCTTAG; SYN3', TGACCATAGTCAGGCTGGTAG; NMYC5', GGGACTGTTTCTGCTTCCGAAAC; NMYC3', ACTCGAGGTCTGGGTTCTTGC; BA5', ATCTGGCACCACACCTTCTACAATGAGCTGCG; and BA3', CGTCATACTCCTGCTTGCTGATCCACATCGGC.
Annealing temperatures were: TH primers, 62°C; SYN primers, 60°C, NMYC primers, 60°C; and BA primers, 60°C. Takara Taq DNA polymerase (Panvera Corp., Madison, WI) was used to amplify cDNAs as detailed in the product brochure and with the following amplification scheme. An initial denaturation at 94°C for 5 min was followed by 1 min at 94°C, 1 min at the appropriate annealing temperature, and 1.5 min at 72°C. The last three steps of the program were repeated for 20 cycles, at which time additional DNA polymerase and deoxynucleotide triphosphates were added to 8 µl of the initial reaction mixture, and 20 more amplification cycles were carried out. RT-PCR products were separated by agarose gel electrophoresis, and Southern analysis was performed using 33P-labeled oligodeoxynucleotides (29) . Sequences of the probes were: GTTCGACCCTGACCTGGACT for TH; GAGCTGAGAGACCCTGTGACCTCGGGA for SYN; and CTCTGGGTTTTCCCAGAAAAGCCAG for N-MYC.
The N-MYC primers detected mRNA encoding both the Mr 57,000 and Mr 54,000 isoforms of this protein. Each set of primers spanned an intron to eliminate signals that might be contributed by low levels of genomic DNA in the RNA preparations. Probe sequences did not overlap primer sequences.
| RESULTS |
|---|
|
|
|---|
Efficiency of Adenoviral Transduction of NB Cell Lines, Primary NB Cells, and Human WBCs
We used a replication-deficient Ad encoding bacterial ß-gal (AdRSV ß-gal) to assess the transduction efficiency of Ad for tumor or tumor-derived cells, PBMNCs, and CD34+ cells. In the experiment shown in Fig. 1
, NB-1691 cells and primary tumor cells were exposed to an MOI of 0 (i.e., no virus) or 50 of AdRSVßgal and then incubated with X-gal. Transduction efficiency was dose-dependent (data not shown), and an MOI of 50 was sufficient to transduce 100% of both NB-1691 cells and primary NB cells. Data in Table 1
show that an MOI of 50 is also sufficient to transduce 100% of cells of four additional human NB cell lines. In contrast, PBMNCs were not transduced even at a viral MOI of 500.
|
|
|
|
1050%. We conclude that the use of an adenoviral MOI of 50 in purging protocols will likely contribute to tumor cell toxicity, independent of transgene expression or chemotherapeutic intervention.
|
20-fold to CPT-11 to eradicate NB cells without adversely affecting the viability of the CD34+ progenitor cells.
|
|
Data from the clonogenic assays, Fig. 5
(top, SJNB-1 cells; middle, SK-N-SH cells; and bottom, NB-1691 cells), show that exposure to AdRSVrCE and 15 µM CPT-11 eliminated the clonogenic potential of each of the three NB cell lines.
|
RT-PCR for NB Cell Markers in Purged Samples.
Cell suspensions (107 cells) containing mixtures of 90% fresh PBMNCs and 10% NB-1691 cells were "purged" by the above protocol, and 24 h after exposure to CPT-11, nonadherent and adherent cells were harvested. RNA was extracted from the cell mixtures, and RT-PCR/Southern analyses were done to assess persistence of N-MYC, SYN, and TH RNA expression after purging. Fig. 6
shows that mRNA for N-MYC, SYN, and TH is readily detectable in mixtures of 90% PBMNCs/10% NB-1691 cells that have not been exposed to AdRSVrCE and CPT-11 but is undetectable in RNA extracted from mixtures of cells exposed to virus and drug. The sensitivity of detection by this method is
1 NB-1691 cell in 107 PBMNCs. Full characterization of the method is reported in a separate manuscript.4
These results suggest that even in mixed cell populations, the described purging protocol is toxic to cell lines derived from primary NB tumors.
|
|
| DISCUSSION |
|---|
|
|
|---|
VDEPT methods targeting other solid tumors that contaminate marrow have been reported (14, 15, 16, 17) . Similar to results with NB cells reported in this study, breast cancer cell lines (15) , a cervical carcinoma cell line (30) , and primary breast cancer tumor samples (15) were also found to be >96100% transduced at MOIs of 50100 after a 224 h exposure to virus. Also, previous work (14, 15, 16, 17) has shown that Ad transduces hematopoietic cells inefficiently, allowing for preferential delivery of cDNAs to tumor cells and, ultimately, selective tumor cell kill. On the basis of a comparison of our results of adenoviral toxicity for PBMNCs compared with CD34+ cells, it appears that a subset of hematopoietic cells is susceptible to adenoviral transduction, but that CD34+ cells are not part of this subset.
Overall, the experiments presented here suggest that Ad, CE, and CPT-11 represent a potentially useful VDEPT approach. However, similar to Hsvtk and Escherichia coli cytosine deaminase, the transgene expressed in our study is not of human origin; therefore, it is possible that overexpression of rCE will produce an immune response. Although an immune component might potentially be beneficial, a significant immune response to this protein after reinfusion of purged cells is considered unlikely for two reasons. The first is that patients who receive autologous transplants are heavily pretreated and immune-compromised; the second is that the rCE used is an intracellular protein that is 81% identical to a human CE (31) .
Another consideration is that of a potential bystander effect. Unlike the activated form of ganciclovir, which requires gap junctions to diffuse from cell to cell (32)
, SN- 38, the active form of CPT-11, diffuses freely through cell membranes (19)
. It seems more likely that a bystander effect would be seen with SN-38 than with ganciclovir triphosphate. However, our data show no bystander effect (Table 4)
with the intracellular form of the CE used in this study. It is likely that the volume of medium in the tissue culture flasks (520 ml) dilutes any SN-38 that diffuses into the medium to ineffective concentrations. Therefore, it is not anticipated that a bystander effect on the CD34+ cells will be a major problem with the described method.
As indicated above, different approaches to purging have been investigated by several laboratories. In 1995, Clarke et al. (16)
made the critical observation that Ad transduces hematopoietic cells inefficiently and suggested that adenoviral vectors encoding bcl-xs could be used to purge NB or breast cancer cells before autologous transplant. The report by Clarke et al. (16)
also included a description of purging a mixture of 1% SHSY-5 NB cells and hematopoietic cells, but no data were shown regarding the efficacy and toxicity of these experiments. Subsequently, immunomagnetic separation has also been shown by Cheung et al. (33)
, using the method of Reynolds et al. (34)
, to be efficacious in reducing an original tumor burden of
1% by three to five logs. Compared with the method of Clarke et al. (16)
and that of Reynolds et al. (34)
, the method detailed in the current study has the advantage of being efficacious when the percentage of tumor cells exceeds 1%. In the current study, experimental emphasis is placed on detection of remaining tumor cells rather than degree of depletion. RT-PCR data suggest that it may be possible to achieve essentially complete purging, irrespective of the log depletion required to achieve this goal.
In conclusion, an in vitro VDEPT approach to purging NB cells from hematopoietic cells using adenoviral delivery of the cDNA for rabbit CE and CPT-11 appears to be an effective method for eradicating NB cells, as assessed by clonogenic potential and by RT-PCR for markers of NB-derived cell lines, while maintaining the clonogenic potential of progenitor cells in populations of frozen/thawed CD34+ cells or of fresh PBMNCs. Preliminary experiments underway to assess marrow repopulation of nonobese diabetic severe combined immunodeficient mice also indicate that the described method does not affect the ability of nonobese diabetic severe combined immunodeficient repopulating cells to engraft sublethally irradiated mice.
| FOOTNOTES |
|---|
1 Supported by CA79763, CA23099, CA21765, CA76202, and by American Lebanese Syrian Associated Charities. ![]()
2 To whom requests for reprints should be addressed, at Department of Molecular Pharmacology, St. Jude Childrens Research Hospital, 332 N. Lauderdale, Memphis, TN 38105. Fax: (901) 521-1668; E-mail: mary.danks{at}stjude.org ![]()
4 S. M. Guichard and M. K. Danks, Detection of synaptophysin and tyrosine hydroxylase by RT-PCR predicts progression of disseminated neuroblastoma in peripheral blood and bone marrow in a preclinical model; application to human samples. Manuscript in preparation. ![]()
3 The abbreviations used are: NB, neuroblastoma; Ad, adenovirus; ß-gal, ß-galactosidase; CE, carboxylesterase; CPT-11, irinotecan,7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin; Hsvtk, Herpes simplex virus thymidine kinase; MOI, multiplicity of infection; PBMNC, peripheral blood mononuclear cell; rCE, rabbit liver CE; SCF, stem cell factor; SN-38, 7-ethyl-10-hydroxycamptothecin; SYN, synaptophysin; TH, tyrosine hydroxylase; VDEPT, virus directed enzyme prodrug therapy; X-gal, 5-bromo-4-chloro-3-indolyl-ß-D-galactoside; IL, interleukin; RT-PCR, reverse transcription-PCR; BA, ß-actin; RSV, Rous sarcoma virus. ![]()
Received 1/11/01. Accepted 5/ 2/01.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. J. Yoon, J. Qi, J. S. Remack, K. G. Virga, M. J. Hatfield, P. M. Potter, R. E. Lee, and M. K. Danks Development of an etoposide prodrug for dual prodrug-enzyme antitumor therapy. Mol. Cancer Ther., June 1, 2006; 5(6): 1577 - 1584. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tyminski, S. LeRoy, K. Terada, D. M. Finkelstein, J. L. Hyatt, M. K. Danks, P. M. Potter, Y. Saeki, and E. A. Chiocca Brain Tumor Oncolysis with Replication-Conditional Herpes Simplex Virus Type 1 Expressing the Prodrug-Activating Genes, CYP2B1 and Secreted Human Intestinal Carboxylesterase, in Combination with Cyclophosphamide and Irinotecan Cancer Res., August 1, 2005; 65(15): 6850 - 6857. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. P. Yoon, J. L. Hyatt, C. L. Morton, R. E. Lee, P. M. Potter, and M. K. Danks Characterization of inhibitors of specific carboxylesterases: Development of carboxylesterase inhibitors for translational application Mol. Cancer Ther., August 1, 2004; 3(8): 903 - 909. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wierdl, A. Wall, C. L. Morton, J. Sampath, M. K. Danks, J. D. Schuetz, and P. M. Potter Carboxylesterase-Mediated Sensitization of Human Tumor Cells to CPT-11 Cannot Override ABCG2-Mediated Drug Resistance Mol. Pharmacol., August 1, 2003; 64(2): 279 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Thirukkumaran, J. M. Luider, D. A. Stewart, T. Cheng, S. M. Lupichuk, M. J. Nodwell, J. A. Russell, I. A. Auer, and D. G. Morris Reovirus oncolysis as a novel purging strategy for autologous stem cell transplantation Blood, July 1, 2003; 102(1): 377 - 387. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu and M. A. Villalona-Calero Irinotecan: mechanisms of tumor resistance and novel strategies for modulating its activity Ann. Onc., December 1, 2002; 13(12): 1841 - 1851. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Wagner, S. M. Guichard, R. A. Burger, C. L. Morton, C. M. Straign, R. A. Ashmun, L. C. Harris, P. J. Houghton, P. M. Potter, and M. K. Danks Efficacy and Toxicity of a Virus-directed Enzyme Prodrug Therapy Purging Method: Preclinical Assessment and Application to Bone Marrow Samples from Neuroblastoma Patients Cancer Res., September 1, 2002; 62(17): 5001 - 5007. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wierdl, C. L. Morton, J. K. Weeks, M. K. Danks, L. C. Harris, and P. M. Potter Sensitization of Human Tumor Cells to CPT-11 via Adenoviral-mediated Delivery of a Rabbit Liver Carboxylesterase Cancer Res., July 1, 2001; 61(13): 5078 - 5082. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |