Cancer Research Meeting Calendar  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meck, M. M.
Right arrow Articles by Danks, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meck, M. M.
Right arrow Articles by Danks, M. K.
[Cancer Research 61, 5083-5089, July 1, 2001]
© 2001 American Association for Cancer Research


Experimental Therapeutics

A Virus-directed Enzyme Prodrug Therapy Approach to Purging Neuroblastoma Cells from Hematopoietic Cells Using Adenovirus Encoding Rabbit Carboxylesterase and CPT-111

Mandy M. Meck, Monika Wierdl, Lars M. Wagner, Rebecca A. Burger, Sylvie M. Guichard, Erik. J. Krull, Linda C. Harris, Philip M. Potter and Mary K. Danks2

Department of Molecular Pharmacology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor cells that contaminate hematopoietic cell preparations contribute to the relapse of neuroblastoma patients who receive autologous stem cell rescue as a component of therapy. Therefore, effective purging methods are needed. This study details in vitro experiments to develop a viral-directed enzyme prodrug purging method that specifically targets neuroblastoma cells. The approach uses an adenovirus to deliver the cDNA encoding a rabbit liver carboxylesterase that efficiently activates the prodrug irinotecan,7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin (CPT-11). The data show that an adenoviral multiplicity of infection of 50 transduces 100% of cultured neuroblastoma cells and primary tumor cells, irrespective of the level of tumor cell line contamination. Exposure of neuroblastoma cell lines or of mixtures of these cell lines with CD34+ cells at a ratio of 10:90 to replication-deficient AdRSVrCE for 24 h and subsequent exposure of cells to 1–5 µM CPT-11 for 4 h increased the toxicity of CPT-11 to three neuroblastoma cell lines (SJNB-1, NB-1691, and SK-N-SH) from ~20–50-fold and eradicated their clonogenic potential. Also, after "purging," RNA for neuroblastoma cell markers (tyrosine hydroxylase, synaptophysin, and N-MYC) was undetectable by reverse transcription-PCR. In contrast, the purging protocol did not affect the number or type of colonies formed by CD34+ cells in an in vitro progenitor cell assay. No bystander effect on CD34+ cells was observed. The method described is being investigated for its potential clinical utility, particularly its efficacy for use with patients having relatively high tumor burdens, because no published methods have been shown to be efficacious when the tumor burden exceeds 1%.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Despite improved cure rates for other pediatric cancers, long-term survival for high-risk metastatic NB3 remains poor (1 , 2) . Dose-intensive chemotherapy regimens have increased the likelihood of attaining partial and complete responses (3) , but many of these patients will relapse and ultimately succumb to their disease. New approaches such as 13-cis-retinoic acid (4) , anti-GD2 antibody (5) , and metaiodobenzylguanidine delivery of radioisotopes (6) look promising but have been used thus far only as adjuncts to high dose chemotherapy and hematopoietic stem cell rescue. Myeloablative chemotherapy followed by autologous stem cell rescue is routinely used for high-risk patients (7) , but gene-marking studies (8) have shown that contaminating tumor cells contribute to relapse after transplant for NB. Therefore, effective methods are needed for purging NB cells from bone marrow or peripheral stem cells before reinfusion.

Purging techniques target exploitable differences between tumor cells and hematopoietic cells to produce tumor cell-specific depletion. A variety of purging methods have been reported. Shpall et al. (9) purged breast cancer cells from hematopoietic cells using immunomagnetic techniques. Kies et al. (10) used a discontinuous bovine albumin gradient to select out hematopoietic progenitor cells in bone marrow samples contaminated with breast cancer cells. Stribbling et al. (11) attached prodrug-activating enzymes to tumor-specific antibodies (antibody- directed enzyme prodrug therapy) to produce tumor cell-selective drug activation and toxicity. A recently published clinical study (12) used a combination of sedimentation, filtration, and magnetic immunobeads for separation of tumor cells from hematopoietic cells before autologous stem cell rescue of NB patients. One of the eligibility criteria for this trial was a tumor burden at harvest of <=1% NB cells.

Of the reported approaches, VDEPT using adenoviral vectors seems particularly promising (13, 14, 15) . Clarke et al. (16) first reported the selective transduction by Ad of NB cells and breast cancer cells compared with hematopoietic cells. Chen et al. (17) determined that this tumor cell selectivity was likely explained by the presence or absence of the coxsackie Ad receptor needed for binding of Ad to the cell surface and expression of {alpha}Vß5 or {alpha}Vß3 integrins required for internalization of the virus into the cell. The premise that underlies VDEPT approaches to purging using adenoviral vectors is that Ades achieve tumor cell-specific delivery and expression of a cDNA that encodes a drug-activating enzyme, and subsequent exposure to the appropriate prodrug results in activation of the prodrug selectively in tumor cells expressing the transgene.

The best characterized VDEPT purging approaches use a replication-deficient Ad to deliver the cDNA encoding Hsvtk to sensitize tumor cells to ganciclovir (14, 15) . Using Ad, Hsvtk, and ganciclovir, Teoh et al. (14) eradicated multiple myeloma cells without affecting the viability of hematopoietic progenitor cells. In other studies (15) in which similar methods were used, however, two to six log reductions of tumor cells were demonstrated, but viable tumor cells remained. Likely, the clinical potential of VDEPT will be achieved by optimizing each component (virus, enzyme, and prodrug) to the specific tumor being targeted.

We are investigating a VDEPT approach designed to purge NB cells from hematopoietic stem cells using Ad, rCE, and CPT-11. Ad selectively transduces NB cells; overexpression of rCE sensitizes tumor cells to CPT-11 (18, 19, 20, 21) ; and NB tumors are relatively sensitive to SN-38, the active form of CPT-11 (22 , 23) . The following study describes in vitro experiments to develop this VDEPT approach to purging.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Drugs
The NB cell lines SK-N-SH, SK-N-AS, and IMR32 were obtained from American Type Culture Collection (Rockville, MD). The NB cell line SJNB-1 was established at St. Jude Children’s Research Hospital, in accordance with the guidelines of the Institutional Review Board. NB-1691 and NB-1643 cell lines were obtained from the Pediatric Oncology Group. Cell lines were grown in DMEM (SK-N-SH, SK-N-AS, and IMR32) or RPMI 1641 medium (NB-1691, NB-1643, and SJNB-1) supplemented with 10% fetal bovine serum and 2 mM L-glutamine.

CPT-11 stock solution (10 mM) in methanol was stored at -20°C, and dilutions were made with water immediately before use.

Human Peripheral Mononuclear and CD34+ Cell Preparations
Peripheral blood was collected from healthy volunteers, and the PBMNCs were harvested using Ficoll-Hypaque (Histopaque-1077) according to the directions of the manufacturer (Sigma Chemical Co. Diagnostics, St. Louis, MO). PBMNCs were used the same day they were collected. Granulocyte-stimulating factor-mobilized CD34+ peripheral blood cells were purchased frozen from Poietics of Clonetics (Walkersville, MD) and stored in liquid nitrogen. On the day of use, CD34+ cells were thawed quickly, pelleted by centrifugation, and washed once with 0.9% NaCl.

Viral Transduction Efficiency
An E1a-, E3-deleted, replication-deficient Ad containing the RSV promoter and the reporter gene ß-gal (AdRSV ß-gal) was obtained from Genetic Therapy, Inc., a Novartis company (Gaithersburg, MD). This Ad was used to assess the transduction efficiency of Ad for cell lines, primary NB, and hematopoietic cells. Cells were plated at a concentration of 40,000 cells/well on 2-well chamber slides (LAB-TEK, Naperville, IL) and exposed to virus in 2% or 10% serum at MOIs ranging from 1–500 for 24 h. The cells were then incubated an additional 24 h to allow for protein expression and fixed in 2% paraformaldehyde/0.2% glutaraldehyde in PBS, washed in PBS, and incubated overnight with X-gal substrate (24) . To determine the percentage of cells transduced, 200 cells from each chamber were counted, and the number of positively stained cells was noted. A cell was considered positive only if it appeared very dark blue. Each MOI determination was done in triplicate, and slides were read by two investigators independently. PBMNCs were also assayed for ß-gal activity as above with the following modification; after the 24-h incubation to allow for protein expression, the suspension of PBMNCs was fixed onto glass slides using a Shandon Cytospin 3 cytocentrifuge at 400 rpm for 8 min.

Assessment of Cytotoxicity to NB Cell Lines
To determine the effect of virus, CPT-11, or the combination on NB cell lines, clonogenic assays were performed. Cells (3000/well) were plated in 6-well plates (Costar, Cambridge, MA), allowed to attach, and then exposed to virus, drug, or both. The toxicity of viral MOIs of 1–100 for 24 h and various concentrations of CPT-11 for 4 h were assessed. The combined toxicity of Ad and CPT-11 was evaluated by exposing the cells to virus for 24 h and then adding CPT-11 for 4 h, 48 h after virus had been removed. After a time equivalent to five doublings of the untreated control cells, the cells were stained with crystal violet, and colonies of >10 cells were imaged using the Alpha Imager 200 documentation system (Alpha Innotech Corporation, San Leandro, CA) and counted using Labworks computer software by UVP Technologies. Results are expressed as the percentage of survival compared with that of untreated control colonies. Dishes were also checked microscopically to verify results when no colonies were detected by the automated counter.

Assessment of Cytotoxicity to Human Progenitor Cells
To evaluate the effect of Ad, CPT-11, or both on hematopoietic cells, methylcellulose-based assays (25 , 26) were performed on PBMNCs and on granulocyte-stimulating factor-mobilized peripheral CD34+ cells.

PBMNCs.
After Ficoll-Hypaque separation, the mononuclear cell layer of peripheral blood was obtained, and the number of nucleated cells was counted using a hemocytometer. PBMNCs (1 x 106) were aliquoted into 35-mm cell suspension dishes (Sarstedt, Newton, NC) and exposed to various MOIs of Ad for 24 h, to CPT-11 for 4 h, or to both. After exposure to virus with or without CPT-11, adherent cells were dislodged, and cell suspensions were transferred to microcentrifuge tubes and centrifuged at 2000 rpm for 5 min. Supernatants were discarded, and the cells were resuspended in 500 µl of 2% Iscove’s modified Dulbecco’s medium. The 500 µl of cell suspension was then added to 5 ml of Methocult GF H4434 containing 50 ng/ml recombinant human SCF, 10 ng/ml IL-3, and 3 units/ml erythropoietin (Stem Cell Technologies, Vancouver, British Columbia, Canada) and vortexed. Aliquots (1.2 ml) were distributed by syringe with a blunt-end needle into 35-mm gridded dishes (NUNC, Naperville, IL). Dishes were incubated at 37°C in high humidity, and colonies were counted microscopically between day 10 and day 14. Results are reported as the total number of colony forming units for neutrophils and monocytes, colony-forming units for late erythroid progenitors, and colony-forming units for granulocytes, erythrocytes, macrophages, and megakaryocytes, compared with untreated controls.

CD34+ Cells.
CD34+ cells were processed as the PBMNCs were except that cells were plated at 1200 cells/dish. It should be noted that when the above concentrations of SCF, IL-3, and erythropoietin are used to culture CD34+ cells in vitro, the cell number may increase by ~1.2-fold to ~1.9-fold in 2–4 days. Therefore, the percentage or number of colonies surviving exposure to Ad or CPT-11 reflects any increase in cell number occurring during that time, combined with the effect of Ad and/or drug treatment on the cells originally plated.

Quantitation of CE Activity
CE activity was determined as described previously (18) . One unit of activity is defined as µmol of o-nitrophenol produced from o-nitrophenyl acetate/mg protein/min.

Purging of NB Cell Lines from PBMNCs or CD34+ Cells
AdRSVrCE Virus.
A replication-deficient E1a-, E3-deleted Ad containing the cDNA encoding an intracellular form of rCE was used for purging experiments. Expression of the CE was regulated by the RSV promoter. This virus and the intracellular enzyme that it encodes have been characterized in detail in a separate study (see previous article; 27).

Purging Procedure.
PBMNCs or CD34+ cells (1.8 x 107) were mixed with NB-1691, SJNB-1, or SK-N-SH cells (0.2 x 107) and divided into two 175-cm2 flasks. To one flask, AdRSVrCE was added at an MOI of 50. The other flask was maintained as an untreated control. After 24 h, the cells in each flask were pelleted by centrifugation, the medium was decanted, and the cells were resuspended in medium containing human growth factors (300 ng/ml SCF, 10 ng/ml IL-3, and 50 ng/ml IL-6). After an additional 48 h, 5 µM CPT-11 was added to the flask of cells that had been exposed to virus. Medium was again replaced in both flasks 4 h later. Aliquots were taken from the "purged" and "unpurged" flasks and plated for clonogenic or progenitor cell assays. For clonogenic assays, a sufficient number of cells was plated such that ~3000 colonies were detected in flasks containing unpurged samples. For progenitor cell assays, six replicate wells were plated for purged and unpurged cell suspensions.

Detection by RT-PCR of Cells Expressing NB Cell Markers After Purging
Adherent and nonadherent cells were harvested from flasks containing 500,000 cells, and RNA was extracted using an RNAqueous nucleic acid extraction kit (Ambion, Inc., Austin, TX). Total cellular RNA (2 µg) was reverse transcribed using Ready-to-Go You-Prime First-Strand beads (Amersham Pharmacia Biotech, Inc., Piscataway, NJ) according to the directions of the manufacturer. PCR analysis was done for three NB markers, TH (28) , SYN, and N-MYC. Primers to detect BA were used to verify the integrity of the RNA and as a positive control for the RT-PCR reactions. Primers used for detection of the above RNAs were: TH5', GTGTCAGAGCTGGACAAGTG; TH3', GATATTGTCTTCCCGGTAGCCGCTGA; SYN5', GCACCACCAAGGTCTTCTTAG; SYN3', TGACCATAGTCAGGCTGGTAG; NMYC5', GGGACTGTTTCTGCTTCCGAAAC; NMYC3', ACTCGAGGTCTGGGTTCTTGC; BA5', ATCTGGCACCACACCTTCTACAATGAGCTGCG; and BA3', CGTCATACTCCTGCTTGCTGATCCACATCGGC.

Annealing temperatures were: TH primers, 62°C; SYN primers, 60°C, NMYC primers, 60°C; and BA primers, 60°C. Takara Taq DNA polymerase (Panvera Corp., Madison, WI) was used to amplify cDNAs as detailed in the product brochure and with the following amplification scheme. An initial denaturation at 94°C for 5 min was followed by 1 min at 94°C, 1 min at the appropriate annealing temperature, and 1.5 min at 72°C. The last three steps of the program were repeated for 20 cycles, at which time additional DNA polymerase and deoxynucleotide triphosphates were added to 8 µl of the initial reaction mixture, and 20 more amplification cycles were carried out. RT-PCR products were separated by agarose gel electrophoresis, and Southern analysis was performed using 33P-labeled oligodeoxynucleotides (29) . Sequences of the probes were: GTTCGACCCTGACCTGGACT for TH; GAGCTGAGAGACCCTGTGACCTCGGGA for SYN; and CTCTGGGTTTTCCCAGAAAAGCCAG for N-MYC.

The N-MYC primers detected mRNA encoding both the Mr 57,000 and Mr 54,000 isoforms of this protein. Each set of primers spanned an intron to eliminate signals that might be contributed by low levels of genomic DNA in the RNA preparations. Probe sequences did not overlap primer sequences.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The long-range goal of the experiments that follow is to eradicate the clonogenic potential of NB cells and maintain the ability of hematopoietic stem cells to repopulate bone marrow. In vitro experiments to assess the feasibility of accomplishing this goal using NB cell lines, an adenoviral vector that encodes an intracellular form of rabbit CE, and CPT-11 are presented.

Efficiency of Adenoviral Transduction of NB Cell Lines, Primary NB Cells, and Human WBCs
We used a replication-deficient Ad encoding bacterial ß-gal (AdRSV ß-gal) to assess the transduction efficiency of Ad for tumor or tumor-derived cells, PBMNCs, and CD34+ cells. In the experiment shown in Fig. 1Citation , NB-1691 cells and primary tumor cells were exposed to an MOI of 0 (i.e., no virus) or 50 of AdRSVßgal and then incubated with X-gal. Transduction efficiency was dose-dependent (data not shown), and an MOI of 50 was sufficient to transduce 100% of both NB-1691 cells and primary NB cells. Data in Table 1Citation show that an MOI of 50 is also sufficient to transduce 100% of cells of four additional human NB cell lines. In contrast, PBMNCs were not transduced even at a viral MOI of 500.



View larger version (70K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Transduction efficiency of AdRSVßgal in NB-1691 and primary NB cells. NB-1691 cells or primary NB cells were exposed to an adenoviral MOI of 0 or 50 for 24 h. Forty-eight h after removal of virus, cells were exposed to X-gal substrate overnight. The method is detailed in "Materials and Methods."

 

View this table:
[in this window]
[in a new window]

 
Table 1 Efficiency of adenoviral transduction of NB and WBCs

 
To determine whether a MOI of 50 would be sufficient to transduce 100% of tumor cells in mixed populations of cells, we exposed mixtures of NB-1691 cells and PBMNCs to an adenoviral MOI of 50 and quantitated the percentage of NB-1691 cells that expressed readily detectable levels of ß-gal. The MOI of 50 was based on the number of Ad particles/total number of NB-1691 cells + PBMNCs, irrespective of the percentage of tumor cells present in the mixture. Data in Table 2Citation show that for levels of "tumor cell contamination" ranging from 1–25%, a MOI of 50 efficiently transduced all of the NB-1691 NB cells in these mixtures. Therefore, we used a MOI of 50 for all of the subsequent purging experiments.


View this table:
[in this window]
[in a new window]

 
Table 2 Transduction efficiency of Ad for mixtures of NB-1691 NB cells with human PBMNCs

 
Adenoviral Toxicity of CD34+ and PBMNCs
We next examined the toxicity of Ad to hematopoietic cells using a progenitor cell assay. CD34+ or PBMNCs were exposed to adenoviral MOIs ranging from 0–100, and the colony-forming ability of the progenitor cells was assessed. Data in Fig. 2Citation show that exposure to Ad had no effect on the colony-forming potential of CD34+ cells, but that the viability of a subpopulation of PBMNCs decreased in a dose-dependent manner at MOIs >50.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. The effect of 0–100 MOI of AdRSVßgal on the ability of human CD34+ cells or PBMNCs to form colonies in methylcellulose. Results shown are the mean ± SE of six to eight values obtained in three separate experiments. Progenitor cell assays were done by standard methods as described in "Materials and Methods."

 
Adenoviral Toxicity to NB Cells
We also assessed the toxicity of Ad to NB cell lines. Cells were exposed to various MOIs of Ad and plated to evaluate clonogenic survival. A dose-dependent relationship was seen between viral MOI and clonogenic survival for the four cell lines evaluated (Fig. 3)Citation . Toxicity varied among the cell lines, but an MOI of 50 decreased the clonogenic survival of all of the cell lines by ~10–50%. We conclude that the use of an adenoviral MOI of 50 in purging protocols will likely contribute to tumor cell toxicity, independent of transgene expression or chemotherapeutic intervention.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. The effect of 0–100 MOI of AdRSVßgal on the clonogenic potential of four human NB cell lines. Clonogenic assays were done by standard methods. Results shown are mean ± SD of triplicate samples of one representative experiment of three replicate experiments.

 
Toxicity of CPT-11 on NB and CD34+ Cells
We next determined the concentration of CPT-11 required to reduce the clonogenic potential of NB cells essentially to zero for five NB cell lines (Table 3)Citation and the maximum concentration of CPT-11 that had little or no effect on the colony-forming potential of PBMNCs or CD34+ cells (IC0–10 concentration of drug required to kill 0–10% of cells; Fig. 4Citation and Table 3Citation ). Cells were exposed to a range of CPT-11 concentrations for 4 h, and clonogenic or progenitor cell assays were performed. Data in Table 3Citation show that for the NB cell lines, the concentration of CPT-11 at which no colonies could be detected microscopically or by automated colony counter ranged from 50 to 100 µM. Results from progenitor cell assays showed that a CPT-11 concentration of 10 µM decreased the colony-forming ability of CD34+ cells about 10%, but that 1–5 µM had little or no effect on colony-forming potential. Toxicity of CPT-11 to PBMNCs (Fig. 4)Citation was similar to CD34+ cells. Taken together, the above results suggest that it will be necessary to sensitize NB cells at least ~20-fold to CPT-11 to eradicate NB cells without adversely affecting the viability of the CD34+ progenitor cells.


View this table:
[in this window]
[in a new window]

 
Table 3 Relative sensitivity of NB cells and CD34+ cells to CPT-11

 


View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Toxicity of CPT-11 to PBMNCs and CD34+ cells. The indicated concentrations of CPT-11 were incubated with PBMNCs or CD34+ cells for 4 h, and colonies were counted by automated counter and by eye after control cells had doubled five times. Results shown are the mean ± SD of 8–10 values obtained in three replicate experiments.

 
Sensitizing Tumor Cells to CPT-11 Using Adenoviral Delivery of the cDNA Encoding Rabbit CE
Three NB cell lines (NB-1691, SJNB-1, and SK-N-SH) were then exposed to an adenoviral MOI of 50 for 24 h, to a range of concentrations of CPT-11 for 4 h, or to both. There was a 48-h virus-free period between exposure to Ad and exposure to drug. The amount of rCE activity detectable in lysates of aliquots of cells from each cell line at the time of exposure to CPT-11 was 4,239 ± 57, 13,235 ± 3,932, and 4,068 ± 367 for SJNB-1, SK-N-SH, and NB-1691 cells, respectively. Under similar conditions, 12.1 ± 2.1 units of CE activity are seen in PBMNCs.

Data from the clonogenic assays, Fig. 5Citation (top, SJNB-1 cells; middle, SK-N-SH cells; and bottom, NB-1691 cells), show that exposure to AdRSVrCE and 1–5 µM CPT-11 eliminated the clonogenic potential of each of the three NB cell lines.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Cytotoxicity of AdRSVrCE and/or CPT-11 to SJNB-1 (top), SK-N-SH (middle), and NB-1691 (bottom) cells. Cells were exposed to an adenoviral MOI of 50 for 24 h. Forty-eight h later, the cells were exposed to the indicated concentrations of CPT-11 for 4 h. Colonies of >10 cells were counted by automated counter and microscopically after control cells had doubled five times. Data shown are the mean ± SD of triplicate values from a representative experiment. The number of colonies in each of six control plates was ~350, 200, and 900 for SJNB-1, NB-1691, and SK-N-SH cells, respectively. Details of the procedures are in "Materials and Methods."

 
Purging NB Cells from PBMNCs or CD34+ Cells
Taken together, results suggest that exposure of NB cell lines to AdRSVrCE (MOI, 50) for 24 h, followed by a 48-h virus-free interval and subsequent exposure of cells to 1–5 µM of CPT-11 for 4 h, should be selectively toxic to the NB cells and maintain the colony-forming potential of hematopoietic progenitor cells. However, all of the above experiments were done with either 100% NB cell lines or 100% hematopoietic cells. Realistically, samples to be purged will contain <1–10% tumor cells in a background of WBCs. Two types of experiments with mixed cell populations were done to assess the efficacy as well as the toxicity of the protocol.

RT-PCR for NB Cell Markers in Purged Samples.
Cell suspensions (107 cells) containing mixtures of 90% fresh PBMNCs and 10% NB-1691 cells were "purged" by the above protocol, and 24 h after exposure to CPT-11, nonadherent and adherent cells were harvested. RNA was extracted from the cell mixtures, and RT-PCR/Southern analyses were done to assess persistence of N-MYC, SYN, and TH RNA expression after purging. Fig. 6Citation shows that mRNA for N-MYC, SYN, and TH is readily detectable in mixtures of 90% PBMNCs/10% NB-1691 cells that have not been exposed to AdRSVrCE and CPT-11 but is undetectable in RNA extracted from mixtures of cells exposed to virus and drug. The sensitivity of detection by this method is ~1 NB-1691 cell in 107 PBMNCs. Full characterization of the method is reported in a separate manuscript.4 These results suggest that even in mixed cell populations, the described purging protocol is toxic to cell lines derived from primary NB tumors.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. RT-PCR/Southern analyses of mixtures of 90% PBMNCs/10% NB-1691 NB cells. Twenty-four h after exposure of cells to AdRSVrCE and 5 µM CPT-11, RNA was extracted from adherent and nonadherent cells. RT-PCR (for BA) or RT-PCR/Southern analyses were done to evaluate levels of expression of TH, SYN, and N-MYC, as an indication of number of viable NB cells still present after purging. The ethidium bromide stained agarose gel is shown for actin. Southern blot results are shown for TH, SYN, and N-MYC. Details of the procedures are found in "Materials and Methods."

 
Clonogenic and Hematopoietic Progenitor Cell Assays.
We next exposed mixtures of 10% NB cell lines (NB-1691, SJNB-1, or SK-N-SH cells) + 90% CD34+ cells to virus and CPT-11 by the above protocol, and, immediately after exposure to CPT-11, aliquots of the cell suspensions were plated for clonogenic assays or hematopoietic progenitor cell assays. Data from these assays are tabulated in Table 4Citation and show that the purging protocol maintained the ability of the hematopoietic progenitor cells to form colonies in methylcellulose and eradicated the clonogenic potential of all of the three NB cell lines in these cell mixtures. No bystander effect on the CD34+ cells was observed. The data also show that each component of the protocol, i.e., virus alone and CPT-11 alone, contributed to the toxicity of the NB cells, but that neither reagent alone was sufficient to effect the death of 100% of viable tumor-derived cells. We conclude that the proposed purging method is likely effective and is selective for neuroblastoma cells and that induction of cell death is attributable to toxicity of the virus alone as well as CE overexpression and activation of CPT-11.


View this table:
[in this window]
[in a new window]

 
Table 4 Effect of AdRSVrCE and CPT-11 on the colony-forming ability of NB, CD34+, or mixtures of 10% NB/90% CD34+ cells "purged" with AdRSVrCE (MOI 50 for 24 h) and 1 µM or 5 µM CPT-11 (4-h exposure to drug 48 h after removal of virus)

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Numerous VDEPT approaches to purging tumor cells from hematopoietic cells have been reported (14, 15, 16, 17) , and several have used Ad as a selective delivery mechanism for this application. However, neither purging studies using the enzyme/prodrug combination rabbit CE/CPT-11 nor any VDEPT methods targeting NB have been reported previously. Other novel findings reported here include the observation that primary NB cells and NB cell lines are transduced by Ad at approximately equal MOIs. Furthermore, the method detailed here may be applicable even if a relatively high tumor burden is present, because the "purging" was effective with 100% NB-1691, SJNB-1, or SK-N-SH NB cells or with mixtures of 10% of these cell lines with 90% human CD34+ or PBMNCs. The efficacy of the described system is likely attributable to the combination of viral toxicity, overexpression of a rabbit CE, and tumor cell-specific activation of the prodrug CPT-11. The rationale for developing the above system is based in part on observations that in vivo NBs are relatively sensitive to CPT-11 (22 , 23) .

VDEPT methods targeting other solid tumors that contaminate marrow have been reported (14, 15, 16, 17) . Similar to results with NB cells reported in this study, breast cancer cell lines (15) , a cervical carcinoma cell line (30) , and primary breast cancer tumor samples (15) were also found to be >96–100% transduced at MOIs of 50–100 after a 2–24 h exposure to virus. Also, previous work (14, 15, 16, 17) has shown that Ad transduces hematopoietic cells inefficiently, allowing for preferential delivery of cDNAs to tumor cells and, ultimately, selective tumor cell kill. On the basis of a comparison of our results of adenoviral toxicity for PBMNCs compared with CD34+ cells, it appears that a subset of hematopoietic cells is susceptible to adenoviral transduction, but that CD34+ cells are not part of this subset.

Overall, the experiments presented here suggest that Ad, CE, and CPT-11 represent a potentially useful VDEPT approach. However, similar to Hsvtk and Escherichia coli cytosine deaminase, the transgene expressed in our study is not of human origin; therefore, it is possible that overexpression of rCE will produce an immune response. Although an immune component might potentially be beneficial, a significant immune response to this protein after reinfusion of purged cells is considered unlikely for two reasons. The first is that patients who receive autologous transplants are heavily pretreated and immune-compromised; the second is that the rCE used is an intracellular protein that is 81% identical to a human CE (31) .

Another consideration is that of a potential bystander effect. Unlike the activated form of ganciclovir, which requires gap junctions to diffuse from cell to cell (32) , SN- 38, the active form of CPT-11, diffuses freely through cell membranes (19) . It seems more likely that a bystander effect would be seen with SN-38 than with ganciclovir triphosphate. However, our data show no bystander effect (Table 4)Citation with the intracellular form of the CE used in this study. It is likely that the volume of medium in the tissue culture flasks (5–20 ml) dilutes any SN-38 that diffuses into the medium to ineffective concentrations. Therefore, it is not anticipated that a bystander effect on the CD34+ cells will be a major problem with the described method.

As indicated above, different approaches to purging have been investigated by several laboratories. In 1995, Clarke et al. (16) made the critical observation that Ad transduces hematopoietic cells inefficiently and suggested that adenoviral vectors encoding bcl-xs could be used to purge NB or breast cancer cells before autologous transplant. The report by Clarke et al. (16) also included a description of purging a mixture of 1% SHSY-5 NB cells and hematopoietic cells, but no data were shown regarding the efficacy and toxicity of these experiments. Subsequently, immunomagnetic separation has also been shown by Cheung et al. (33) , using the method of Reynolds et al. (34) , to be efficacious in reducing an original tumor burden of <=1% by three to five logs. Compared with the method of Clarke et al. (16) and that of Reynolds et al. (34) , the method detailed in the current study has the advantage of being efficacious when the percentage of tumor cells exceeds 1%. In the current study, experimental emphasis is placed on detection of remaining tumor cells rather than degree of depletion. RT-PCR data suggest that it may be possible to achieve essentially complete purging, irrespective of the log depletion required to achieve this goal.

In conclusion, an in vitro VDEPT approach to purging NB cells from hematopoietic cells using adenoviral delivery of the cDNA for rabbit CE and CPT-11 appears to be an effective method for eradicating NB cells, as assessed by clonogenic potential and by RT-PCR for markers of NB-derived cell lines, while maintaining the clonogenic potential of progenitor cells in populations of frozen/thawed CD34+ cells or of fresh PBMNCs. Preliminary experiments underway to assess marrow repopulation of nonobese diabetic severe combined immunodeficient mice also indicate that the described method does not affect the ability of nonobese diabetic severe combined immunodeficient repopulating cells to engraft sublethally irradiated mice.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by CA79763, CA23099, CA21765, CA76202, and by American Lebanese Syrian Associated Charities. Back

2 To whom requests for reprints should be addressed, at Department of Molecular Pharmacology, St. Jude Children’s Research Hospital, 332 N. Lauderdale, Memphis, TN 38105. Fax: (901) 521-1668; E-mail: mary.danks{at}stjude.org Back

4 S. M. Guichard and M. K. Danks, Detection of synaptophysin and tyrosine hydroxylase by RT-PCR predicts progression of disseminated neuroblastoma in peripheral blood and bone marrow in a preclinical model; application to human samples. Manuscript in preparation. Back

3 The abbreviations used are: NB, neuroblastoma; Ad, adenovirus; ß-gal, ß-galactosidase; CE, carboxylesterase; CPT-11, irinotecan,7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin; Hsvtk, Herpes simplex virus thymidine kinase; MOI, multiplicity of infection; PBMNC, peripheral blood mononuclear cell; rCE, rabbit liver CE; SCF, stem cell factor; SN-38, 7-ethyl-10-hydroxycamptothecin; SYN, synaptophysin; TH, tyrosine hydroxylase; VDEPT, virus directed enzyme prodrug therapy; X-gal, 5-bromo-4-chloro-3-indolyl-ß-D-galactoside; IL, interleukin; RT-PCR, reverse transcription-PCR; BA, ß-actin; RSV, Rous sarcoma virus. Back

Received 1/11/01. Accepted 5/ 2/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Pierce S. T. Long-term survival in refractory recurrent neuroblastoma. J. Pediatr. Hematol. Oncol., 18: 202-205, 1996.[Medline]
  2. Brodeur G. M., Maris J. M., Yamashiro D. J., Hogarty M. D., White P. S. Biology and genetics of human neuroblastomas. J. Pediatr. Hematol. Oncol., 19: 93-101, 1997.[Medline]
  3. Katzenstein H. M., Cohn S. L. Advances in the diagnosis and treatment of neuroblastoma. Curr. Opin. Oncol., 10: 43-51, 1998.[Medline]
  4. Matthay K. K., Villablanca J. G., Seeger R. C., Stram D. O., Harris R. E., Ramsay N. K., Swift P., Shimada H., Black C. T., Brodeur G. M., Gerbing T. B., Reynolds C. P. Treatment of high-risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis-retinoic acid. N. Engl. J. Med., 341: 1165-1173, 1999.[Abstract/Free Full Text]
  5. Cheung N-K. V., Kushner B. H., Cheung I. Y., Kramer K., Canete A., Gerald W., Bonilla M. A., Finn R., Yeh S. J., Larson S. M. Anti-GD2 antibody treatment of minimal residual stage 4 neuroblastoma diagnosed at more than 1 year of age. J. Clin. Oncol., 16: 3053-3060, 1998.[Abstract/Free Full Text]
  6. Tepmongkil S., Heyman S. 131I MIBG therapy in neuroblastoma: mechanisms, rationale, and current status. Med. Pediatr. Oncol., 32: 427-431, 1999.[Medline]
  7. Haase G. M., Perez C., Atkinson J. B. Current aspects of biology, risk assessment, and treatment of neuroblastoma. Semin. Surg. Oncol., 16: 91-104, 1999.[Medline]
  8. Rill D. R., Santana V. M., Roberts W. M., Nilson T., Bowman L. C., Krance R. A., Heslop H. E., Moen R. C., Ihle J. N., Brenner M. K. Direct demonstration that autologous bone marrow transplantation for solid tumors can return a multiplicity of tumorigenic cells. Blood, 84: 380-383, 1994.[Abstract/Free Full Text]
  9. Shpall E. J., LeMaistre C. F., Holland K., Ball E., Jones R. B., Saral R., Jacobs C., Heimfeld S., Berenson R., Champlin R. A prospective randomized trial of buffy coat versus CD34-selected autologous bone marrow support in high-risk breast cancer patients receiving high-dose chemotherapy. Blood, 90: 4313-4320, 1997.[Abstract/Free Full Text]
  10. Kies M. S., Gordon L. I., Rosen S. T., Kucuk O., Vriesendorp H. M. Autologous bone marrow transplantation in breast cancer: separation of clonogenic tumor cell colonies by gradient fractionation. Exp. Hematol., 16: 190-194, 1988.[Medline]
  11. Stribbling S. M., Martin J., Pedley R. B., Boden J. A., Sharma S. K., Springer C. J. Biodistribution of an antibody-enzyme conjugate for antibody-directed enzyme prodrug therapy in nude mice bearing a human colon adenocarcinoma xenograft. Cancer Chemother. Pharmacol., 40: 277-284, 1997.[Medline]
  12. Matthay K. K., Seeger R. C., Reynolds C. P., Stram D. O., O’Leary M. C., Harris R. E., Selch M., Atkinson J. B., Haase G. M., Ramsay N. K. Allogeneic versus autologous purged bone marrow transplantation for neuroblastoma: a report from the Children’s Cancer Group. J. Clin. Oncol., 12: 2382-2389, 1994.[Abstract/Free Full Text]
  13. Martin L. A., Vile R., Lemoine N. R., Sikora K., Pandha H. S. Genetic prodrug activation therapy. Lancet, 350: 1793-1794, 1997.[Medline]
  14. Teoh G., Chen L., Urashima M., Tai Y-T., Celi L. A., Chen D., Chauhan D., Ogata A., Finberg R. W., Webb I. J., Kufe D. W., Anderson K. C. Adenovirus vector-based purging of multiple myeloma cells. Blood, 92: 4591-4601, 1998.[Abstract/Free Full Text]
  15. Marini F. C., Snell V., Yu Q., Zhang W., Singletary E., Champlin R., Andreef M. Purging of contaminating breast cancer cells from hematopoietic stem cell grafts by adenoviral GAL-TEK gene therapy and magnetic antibody cell separation. Clin. Cancer Res., 5: 1557-1568, 1999.[Abstract/Free Full Text]
  16. Clarke M. F., Apel I. J., Benedict M. A., Eipers P. G., Sumantran V., Gonzalez-Garcia M., Doedens M., Fukunaga N., Davidson B., Dick J. E., Minn A. J., Boise L. H., Thompson C. B., Wicha M., Nunez G. A recombinant bcl-xs adenovirus selectively induces apoptosis in cancer cells but not in normal bone marrow cells. Proc. Natl. Acad. Sci. USA, 92: 11024-11028, 1995.[Abstract/Free Full Text]
  17. Chen L., Pulsipher M., Chen D., Sieff C., Elias A., Fine H. A., Kufe D. W. Selective transgene expression for detection and elimination of contaminating carcinoma cells in hematopoietic stem cell sources. J. Clin. Investig., 98: 2539-2548, 1996.[Medline]
  18. Danks M. K., Morton C. L., Pawlik C. A., Potter P. M. Overexpression of a rabbit liver carboxylesterase sensitizes human tumor cells to CPT-11. Cancer Res., 58: 20-22, 1998.[Abstract/Free Full Text]
  19. Danks M. K., Morton C. L., Krull E. J., Cheshire P. J., Richmond L. B., Naeve C. W., Pawlik C. A., Houghton P. J., Potter P. M. Comparison of activation of CPT-11 by rabbit and human carboxylesterases for use in enzyme/prodrug therapy. Clin. Cancer Res., 5: 917-924, 1999.[Abstract/Free Full Text]
  20. Pawlik C. A., Iyengar R. V., Krull E. J., Mason S. E., Harris L. C., Potter P. M., Danks M. D., Guichard S. M. Use of the ornithine decarboxylase promoter to achieve N-MYC-mediated overexpression of a rabbit carboxylesterase to sensitize neuroblastoma cells to CPT-11. Mol. Therapy, 1: 457-463, 2000.
  21. Potter P. M., Wolverton J. S., Morton C. L., Wierdl M., Danks M. K. Cellular localization domains of a rabbit and a human carboxylesterase: influence on CPT-11 metabolism by the rabbit enzyme. Cancer Res., 58: 3627-3632, 1998.[Abstract/Free Full Text]
  22. Thompson M., Zamboni W. C., Cheshire P. J., Lutz L., Luo X., Li Y., Houghton J. A., Stewart C. F., Houghton P. J. Efficacy of systemic administration of irinotecan against neuroblastoma xenografts. Clin. Cancer Res., 3: 423-431, 1997.[Abstract]
  23. Furman W. L., Stewart C. F., Poquette C. A., Pratt C. B., Santana V. M., Zamboni W. C., Bowman L. C., Ma M. K., Hoffer F. A., Meyer W. H., Pappo A. S., Walter A. W., Houghton P. J. Direct translation of a protracted irinotecan schedule from a xenograft model to a Phase I trial in children. J. Clin. Oncol., 17: 1815-1824, 1999.[Abstract/Free Full Text]
  24. Couffinhal T., Kearney M., Sullivan A., Silver M., Tsurumi Y., Isner J. V. Histochemical staining following LacZ gene transfer underestimates transfection efficiency. Hum. Gene Ther., 8: 929-934, 1997.[Medline]
  25. Eaves C. J. Assays of hemopoietic progenitor cells Beutler E. Lichtman M. A. Coller B. S. Kipps T. J. eds. . Williams Hematology, : L22-26, McGraw-Hill, Inc. New York, NY 1995.
  26. Halle P., Rouzier C., Kanold J., Boiret N., Rapatel C., Mareynat G., Tchirkov A., Berger M., Travade P., Bonhomme J., Demeocq F. Ex vivo expansion of CD34+/CD41+ late progenitors from enriched peripheral blood CD34+ cells. Ann. Hematol., 79: 13-19, 2000.[Medline]
  27. Wierdl, M., Morton, C. L., Weeks, J. K., Danks, M. K., Harris, L. C., and Potter, P. M. Sensitization of human tumor cells to CPT-11 via adenoviral-mediated delivery of a rabbit carboxylesterase. Cancer Res., in press, 2001.
  28. Burchill S. A., Bradbury F. M., Smith B., Lewis I. J., Selby P. Neuroblastoma cell detection by reverse transcriptase-polymerase chain reaction (RT-PCR) for tyrosine hydroxylase mRNA. Int. J. Cancer, 57: 671-675, 1994.[Medline]
  29. Sambrook J., Fritsch E. F., Maniatis T. . Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 1989.
  30. Wroblewski J. M., Lay L. T., VanZant G., Phillips G., Seth P., Curiel D., Meeker T. C. Selective elimination (purging) of contaminating malignant cells from hematopoietic stem cell autografts using recombinant adenovirus. Cancer Gene Ther., 3: 257-264, 1996.[Medline]
  31. Potter P. M., Pawlik C. A., Morton C. L., Danks M. K. Isolation and partial characterization of a carboxylesterase that converts CPT-11 to SN-38. Cancer Res., 58: 2646-2651, 1998.[Abstract/Free Full Text]
  32. Elshami A. A., Saavedra A., Zhang H., Kucharczuk J. C., Spray D. C., Fishman G. I., Amin K. M., Kaiser L. R., Albelda S. M. Gap junctions play a role in the "bystander effect" of the herpes simplex virus thymidine kinase/ganciclovir system in vitro. Gene Ther., 3: 85-92, 1996.[Medline]
  33. Cheung N-K. V., Heller G., Kushner B. H., Liu C., Cheung I. Y. Detection of metastatic neuroblastoma in bone marrow: when is routine marrow histology insensitive?. J. Clin. Oncol., 15: 2807-2817, 1997.[Abstract]
  34. Reynolds C. P., Seeger R. C., Vo D. D., Black A. T., Wells J., Ugelstad J. Model system for removing neuroblastoma cells from bone marrow using monoclonal antibodies and magnetic immunobeads. Cancer Res., 46: 5882-5886, 1986.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
K. J. Yoon, J. Qi, J. S. Remack, K. G. Virga, M. J. Hatfield, P. M. Potter, R. E. Lee, and M. K. Danks
Development of an etoposide prodrug for dual prodrug-enzyme antitumor therapy.
Mol. Cancer Ther., June 1, 2006; 5(6): 1577 - 1584.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Tyminski, S. LeRoy, K. Terada, D. M. Finkelstein, J. L. Hyatt, M. K. Danks, P. M. Potter, Y. Saeki, and E. A. Chiocca
Brain Tumor Oncolysis with Replication-Conditional Herpes Simplex Virus Type 1 Expressing the Prodrug-Activating Genes, CYP2B1 and Secreted Human Intestinal Carboxylesterase, in Combination with Cyclophosphamide and Irinotecan
Cancer Res., August 1, 2005; 65(15): 6850 - 6857.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
K. J. P. Yoon, J. L. Hyatt, C. L. Morton, R. E. Lee, P. M. Potter, and M. K. Danks
Characterization of inhibitors of specific carboxylesterases: Development of carboxylesterase inhibitors for translational application
Mol. Cancer Ther., August 1, 2004; 3(8): 903 - 909.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Wierdl, A. Wall, C. L. Morton, J. Sampath, M. K. Danks, J. D. Schuetz, and P. M. Potter
Carboxylesterase-Mediated Sensitization of Human Tumor Cells to CPT-11 Cannot Override ABCG2-Mediated Drug Resistance
Mol. Pharmacol., August 1, 2003; 64(2): 279 - 288.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. M. Thirukkumaran, J. M. Luider, D. A. Stewart, T. Cheng, S. M. Lupichuk, M. J. Nodwell, J. A. Russell, I. A. Auer, and D. G. Morris
Reovirus oncolysis as a novel purging strategy for autologous stem cell transplantation
Blood, July 1, 2003; 102(1): 377 - 387.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
Y. Xu and M. A. Villalona-Calero
Irinotecan: mechanisms of tumor resistance and novel strategies for modulating its activity
Ann. Onc., December 1, 2002; 13(12): 1841 - 1851.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. M. Wagner, S. M. Guichard, R. A. Burger, C. L. Morton, C. M. Straign, R. A. Ashmun, L. C. Harris, P. J. Houghton, P. M. Potter, and M. K. Danks
Efficacy and Toxicity of a Virus-directed Enzyme Prodrug Therapy Purging Method: Preclinical Assessment and Application to Bone Marrow Samples from Neuroblastoma Patients
Cancer Res., September 1, 2002; 62(17): 5001 - 5007.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Wierdl, C. L. Morton, J. K. Weeks, M. K. Danks, L. C. Harris, and P. M. Potter
Sensitization of Human Tumor Cells to CPT-11 via Adenoviral-mediated Delivery of a Rabbit Liver Carboxylesterase
Cancer Res., July 1, 2001; 61(13): 5078 - 5082.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meck, M. M.
Right arrow Articles by Danks, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meck, M. M.
Right arrow Articles by Danks, M. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online