Cancer Research Annual Meeting 2010  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van der Velden, P. A.
Right arrow Articles by Jager, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van der Velden, P. A.
Right arrow Articles by Jager, M. J.
[Cancer Research 61, 5303-5306, July 1, 2001]
© 2001 American Association for Cancer Research


Tumor Biology

Promoter Hypermethylation

A Common Cause of Reduced p16INK4a Expression in Uveal Melanoma

Pieter A. van der Velden1, Jessica A. W. Metzelaar-Blok1, Wilma Bergman, H. Monique, H. Hurks, Rune R. Frants, Nelleke A. Gruis2 and Martine J. Jager

Section Human Genetics, Center for Human and Clinical Genetics [P. A. v. d. V., R. R. F., N. A. G.], and Departments of Dermatology [P. A. v. d. V., W. B., N. A. G.], and Ophthalmology [J. A. W. M-B., H. M. H. H., M. J. J.], Leiden University Medical Center, 2333 AL Leiden, the Netherlands


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumors often display unrestricted cell cycling attributable to a dysfunctional G1-S checkpoint. One of the mechanisms leading to such a defect is the inactivation of the cyclin-dependent kinase inhibitor p16INK4a. Although inactivation of p16INK4a is observed in a wide range of tumors, including cutaneous melanoma, genetic alteration of p16INK4a is reportedly uncommon in uveal melanoma. Here we show that the p16INK4a promoter is hypermethylated in 6 of 12 uveal melanoma cell lines and in 7 of 22 primary uveal melanomas analyzed. Five of seven patients with a methylated primary tumor died of metastatic disease compared with 2 of 15 patients with a nonmethylated primary tumor. We also show that all uveal melanoma cell lines with a hypermethylated p16INK4a promoter have lost p16INK4a expression but have maintained the expression of p14ARF. Treatment of uveal melanoma cell lines with 5-aza-2'-deoxycytidine results in demethylation of p16INK4a and in reexpression of p16INK4a mRNA, which is maintained upon withdrawal of the 5-aza-2'-deoxycytidine. In conclusion, p16INK4a promoter methylation appears to be a common event in uveal melanoma and is accompanied by the loss of p16INK4a expression.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Progression of cells through the G1 phase of the cell cycle is stimulated by the association of D-type cyclins with CDKs3 that phosphorylate Rb (1) . Upon Rb phosphorylation, E2F is activated and promotes S-phase-specific gene expression. p16INK4a has been identified as an inhibitor of the cyclin D/CDK complex (2) . The inhibitory activity of p16INK4a is restricted to the cyclin D-CDK4 and cyclin D-CDK6 kinases and results in cell cycle control at the G1-S restriction point. Exons 2 and 3 of p16INK4a are used by two genes in alternative reading frames. Because of their unique first exons, exon 1{alpha} and exon , two transcripts with distinct protein-coding potentials are expressed (3, 4, 5) . The transcript derived from exon 1{alpha} encodes p16INK4a, whereas the transcript derived from exon encodes p14ARF (6) . It has been established that p14ARF plays a role in cell cycle control as well, and that it is the actual link between the p16INK4a/Rb pathway and the p53/Rb pathway (Fig. 2A)Citation . Upon induction by E2F, p14ARF sequesters MDM2 and thereby prevents degradation and nuclear export of p53 (7 , 8) .



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, schematic representation of cell cycle control at the Rb restriction point and genomic organization of p14ARF, p15INK4b, and p16INK4a at chromosome 9p21 with the primers that are used in the competitive RT-PCR. Combination of X (X2R140), A (AS-1), and U1 (P15–5'UTF) in a RT-PCR results in simultaneous amplification of p16INK4a and p15INK4b cDNA. The combination of X, B1 (BS-1), and U1 results in amplification of p14ARF and p15INK4b messengers. B, in 12 uveal melanoma cell lines, we determined the expression of p16INK4a, p15INK4b and p14ARF. The top panel reveals relative expression levels of p16INK4a /p15INK4b; the bottom panel shows the relative expression of p15INK4b/p14ARF. Arrow, a deletion in exon 2 of p14ARF/p16INK4a.

 
p16INK4a is commonly inactivated in a wide range of malignancies (9) , but p16INK4a germ-line mutations are uniquely associated with familial cutaneous melanoma (10, 11, 12, 13) . The occurrence of uveal melanoma as a secondary tumor within some melanoma families indicates that both forms of melanoma share predisposing factors (14 , 15) . Despite shared risk factors, these tumors present differences in incidence, age at onset, and mortality. Whereas uveal melanoma is a rare tumor with a high age at onset and a high mortality, cutaneous melanoma is much more common, occurs at a younger age, and is associated with a relatively low mortality (16, 17, 18, 19) . Whereas p16INK4a is the main target of inactivation in cutaneous melanoma, mutation screening and deletion mapping did not reveal such a role for p16INK4a in uveal melanoma (20) . An alternative mechanism for tumor suppressor gene inactivation is de novo methylation of CpG islands, which generally represses transcription. De novo methylation of the p16INK4a promoter region occurs in a wide range of malignancies (21, 22, 23) and releases the cell from a potent cell cycle inhibitor.

In this study, we show that in both primary uveal melanoma and uveal melanoma cell lines, p16INK4a is frequently inactivated by hypermethylation. Hypermethylation of p16INK4a is accompanied by a down-regulated expression of p16INK4a. Loss of p16INK4a expression attributable to CpG methylation could be reversed when the cell lines were treated with the demethylating agent 5-aza-2'-deoxycytidine. Interestingly, metastatic disease tended to be more common in uveal melanoma patients who had a tumor with a methylated p16INK4a promoter. As illustrated, aberrant methylation can be modulated and, hence, offers a target for treatment of uveal melanoma.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Treatment with 5-Aza-2'deoxycytidine.
Nine cell lines derived from primary uveal melanomas (92.1; OCM-1, -3, and -8; Mel-270, -285, and –290; MEL-202; and EOM-3) and three cell lines derived from uveal melanoma metastases (OMM-1, -1.3, and -1.5) were used in the experiments. Cell line Mel 270 and OMM-1.3 and -1.5 represent a progression model because they were derived from a primary uveal melanoma and two of its liver metastases. Cell line 92.1 was established in our own laboratory (24) . Cell lines EOM-3 and OMM-1 were kindly provided by Dr. Gae P. M. Luyten (Rotterdam University Hospital, Rotterdam, the Netherlands). Cell lines MEL-202, -270, and -285; and OMM-1.3 and -1.5 were a generous gift of Dr. Bruce Ksander (Schepens Eye Research Institute, Harvard Medical School, Boston, MA), and cell lines OCM-1, -3, and -8 were kindly provided by Dr. J. Kan-Mitchell (University of California, San Diego, La Jolla, CA). Cell lines OMM-1 and OCM-1 were cultured in DMEM (Life Technologies, Inc.) containing 25 mM HEPES buffer, 1 mM sodiumpyruvate, 1 g/l glucose, and supplemented with 10% heat-inactivated fetal bovine serum and 2% penicillin/streptomycin (Life Technologies, Inc.). The other cell lines were grown in RPMI 1640 (Life Technologies, Inc.) supplemented with 3 mM L-glutamine (Life Technologies, Inc.), 2% penicillin/streptomycin, and 10% FBS. Cell cultures were incubated at 37°C in a humidified 5% CO2 atmosphere. To inhibit methylation of daughter cells, the cell lines were grown in the presence of 1 µM 5-aza-2'-deoxycytidine for 72 h. Fresh medium was added every 24 h.

Tumor Specimens.
We used archival frozen tumor specimens of primary uveal melanomas from 22 patients (Table 1)Citation . Patients, of which the median age at presentation was 64 years (range, 44 to 87 years), had not received treatment before enucleation. From one patient, both the primary uveal melanoma (tumor 15) as well as the cell line (92.1) derived from that tumor were studied. Histopathological analysis of all cases was performed by the same ocular pathologist. DNA was isolated by the modified protocol of Isola et al. (25) and Vos et al. (26) .


View this table:
[in this window]
[in a new window]

 
Table 1 Clinical and histopathological data on 22 primary uveal melanoma

 
MSP.
The MSP method and primer sequences as described by Herman et al. (27) were used. First, genomic DNA is modified with sodium bisulfite. As a result of this modification, cytosine residues are deaminated and changed into uracil residues, but a methylated cytosine is protected and will remain unmodified. Hence, sequence differences are introduced that allow for amplification with methylated and unmethylated DNA-specific primers. Amplification with primers specific for methylated DNA is done, then digestion with the HinfI restriction enzyme. Recognition by this enzyme is dependent on both C->T conversion and methylation of a CpG. Starting at position 108 of p16INK4a exon 1, there is a GAGCC*G site. If the second C is methylated, bisulfite will only modify the first C and hence create a HinfI site: GANTC. By performing this restriction analysis, we can ascertain the specificity of the MSP and analyze additional CpGs apart from the CpGs that determine the primer specificity.

Competitive RT-PCR.
Total RNA from the cell lines was isolated as described by the manufacturer (Biotecx Laboratories, Houston, TX). RNA was primed with random primers and reverse transcribed into cDNA in a 20-µl reaction volume containing 200 units of MMV (SuperScript II) reverse transcriptase (Life Technologies, Inc., Breda, the Netherlands). The cDNA was subsequently used in a competitive PCR in which the transcript of the p16INK4a homologue, p15INK4b (28) , was used as the endogenous competitor. Primers used in the PCR reaction were: X2R140, 5'AGCACCACCAGCGTGTC 3'; BS.1,5'TACTGAGGAGCCAGCGTCTA 3'; AS.1, 5'CAACGAACCGAATAGTTACG 3'; and P15–5'UTF, 5' GGCCAACGGTGGATTATCCG 3'. The first primer is chosen in exon 2-conserved sequences and recognizes the gene product from p16INK4a /p14ARF and p15INK4b; the latter primers are gene-specific and recognize exon 1 sequences from p14ARF, p16INK4a, and p15INK4b, respectively. During competitive RT-PCR, two products are amplified that are separated by size and represent relative expression levels of p16INK4a /p15INK4b or p14ARF/p15INK4b, respectively. Such a quantification is allowed, because after RT-PCR, logarithmic dilutions of cloned p16INK4a with p15INK4b transcript revealed a linear standard curve (data not shown), proving equal amplification efficiencies for both templates and excluding the possibility that the different expression ratios are influenced by sample quality.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MSP to Determine p16INK4a Promoter Methylation.
p16INK4a gene mutations and deletions are frequent in many kinds of neoplasias, but neither seems common to uveal melanoma. Because inactivation of p16INK4a can also occur by promoter methylation, it was of interest to determine whether this applies to uveal melanoma. Genomic DNA of nine cell lines derived from primary uveal melanoma (OCM-1, -3, and -8; MEL-202; Mel-270, -285, and -290; EOM-3; and 92.1) and three cell lines from uveal melanoma metastases (OMM-1, -1.3, and -1.5) were analyzed by MSP after modification with sodium bisulfite. Three of nine primary uveal melanoma cell lines (92.1, Mel-270, and Mel-285) and all three metastases-derived cell lines (OMM-1, -1.3, and -1.5) revealed p16INK4a-methylated DNA-specific PCR products; whereas the unmethylated DNA-specific PCR was negative in these samples (Fig. 1)Citation . With HinfI digestion, we confirmed the p16INK4a promoter methylation. The three cell lines that were derived from one patient (OMM-1.3 and OMM-1.5 are from two different metastases, and Mel-270 is from the primary tumor) were all methylated, indicating that methylation status was conserved during metastasis and that promoter methylation constitutes a primary event.



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. MSP in 12 uveal melanoma cell lines. Top, amplification with the unmethylated DNA-specific PCR (U-p16); middle, methylated DNA-specific PCR (M-p16); bottom, HinfI digestion of M-p16. Partial digestion is seen in almost all reactions and is an indication of suboptimal bisulfite modification and/or digestion rather than partial methylation, because there is no correlation with U-p16 PCR signal.

 
Competitive RT-PCR to Compare p16INK4a mRNA and p14ARF mRNA Expression.
We detected p16INK4a promoter methylation in six of twelve uveal melanoma cell lines. To determine whether promoter methylation is accompanied by reduced p16INK4a mRNA expression, we analyzed p16INK4a gene transcription with competitive RT-PCR (Fig. 2A)Citation . Because p14ARF enhances the p53-mediated cell cycle control, and loss of control attributable to reduced p16INK4a expression can theoretically be compensated by an increase in its alternative transcript, we also measured p14ARF expression. Fig. 2BCitation shows expression levels of p15INK4b, p14ARF and p16INK4a in the uveal melanoma cell lines. All cell lines that contain a methylated p16INK4a do not express p16INK4a mRNA, whereas all methylation-negative cell lines do express p16INK4a mRNA. In contrast, methylation of the p16INK4a locus had no clear effect on p14ARF expression.

p16INK4a Expression in 5-Aza-2'-deoxycytidine-treated Uveal Melanoma Cell Lines.
To test whether there is a causal relationship between promoter methylation and p16INK4a expression, six methylation-positive cell lines were treated with 5-aza-2'-deoxycytidine. 5-Aza-2'-deoxycytidine treatment inhibits methylation of daughter strands during DNA synthesis. A gain of p16INK4a expression is expected if promoter methylation really causes the lack of p16INK4a expression. Competitive RT-PCR performed on treated and untreated cell lines with a methylated p16INK4a promoter showed p16INK4a expression in all treated cell lines but not in any of the untreated cell lines (Fig. 3)Citation . Subsequent MSP revealed a loss of methylation in the treated cells and supports the notion that promoter methylation caused the loss of p16INK4a expression (data not shown). Treatment of methylated cell lines always resulted in p16INK4a reexpression but showed strong variation in expression.



View larger version (68K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Competitive RT-PCR on methylated uveal melanoma cell lines that are treated with 5-aza-2'-deoxycytidine. p16INK4a expression is rescued in all treated cells, though expression levels may vary. Treatment results in a lowered p14ARF expression in 92.1, whereas in the other cell lines there is no obvious response.

 
After treatment of cell line Mel-270, this cell line expressed p16INK4a. We subsequently cultured the treated cells for 3 months in the absence of 5-aza-2'-deoxycytidine and repeatedly observed p16INK4a expression. These cells experienced growth arrest for ~75 days but then started to form colonies that contained fast-growing cells. When we tested the mRNA expression of these fast-growing cell clones, we could no longer detect p16INK4aexpression. Recurrent loss of p16INK4a expression clearly triggered unrestricted cycling and identifies p16INK4a again as a main target of inactivation.

p16INK4a Methylation in Primary Uveal Melanoma.
DNA from 22 snap-frozen primary uveal melanomas was modified with bisulfite and applied to MSP. Positive methylation signals were always accompanied by signals in the unmethylated DNA-specific PCR, indicating a mixture of tumor and normal tissue. Or even worse, the methylated DNA-specific signals might represent false-positive signals. But the gain of a HinfI restriction site revealed its value in the analysis and distinguished tumors with a truly methylated p16INK4a promoter from the methylation-negative tumors. Of a total of 22 primary tumors, 7 (32%) were positive for methylation. From one patient, we analyzed the primary tumor (tumor 15) as well as the cell line derived from this primary uveal melanoma (92.1) and found methylation in both (Fig. 4)Citation . This demonstrates that methylation in the cell line originates from the primary tumor, and that methylation in the cell line is not attributable to a tissue culture artifact.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. MSP in DNA from primary uveal melanomas and from the methylation-positive cell line 92.1. This cell line is derived from primary tumor 15 that is, together with tumor 14, proven to be methylated, as indicated by the digestion with HinfI. The tumor material results frequently in false positive MSP signals therefore HinfI digestion of M-p16 PCR products is regarded as proof of methylation.

 
Clinicopathological Correlations.
Of the 22 primary uveal melanomas tested, seven carried a methylated p16INK4a gene. Two bad prognostic factors, i.e., location of the uveal melanoma in the ciliary body (5 of 10) and the presence of epithelioid cells (4 of 5) in the tumor, occurred more frequently in p16INK4a methylated tumors but did not reach significance (Table 1)Citation . Correlation with survival indicated that 5 of 7 patients with a methylated p16INK4a died of metastatic disease compared with 2 of 15 patients without p16INK4a methylation. Kaplan-Meier survival analysis showed a tendency to better survival in cases of a nonmethylated p16INK4a, a result that did not reach significance (P = 0.15).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Uveal melanoma and cutaneous melanoma share a common ancestry; both uveal melanocytes and the skin melanocytes are derived from the neural crest. Genetic involvement of p16INK4a distinguishes the two tumors. In cutaneous melanoma, p16INK4a is the most important susceptibility gene, whereas p16INK4a involvement in uveal melanoma seems limited. Most commonly, loss of one p16INK4a allele in uveal melanoma is reported without mutational inactivation of the remaining wild-type allele (20 , 29) . Promoter methylation has also been reported, though in a low frequency (3%; Ref. 20 ). Our results, however, indicate that p16INK4a inactivation by way of promoter methylation occurs much more frequently in primary uveal melanoma (32%) and uveal melanoma cell lines (50%), indicating that the role of p16INK4a is more important than anticipated previously. In all methylation-positive cell lines, treatment with 5-aza-2'-deoxycytidine resulted in p16INK4a reexpression. We conclude that lack of expression is caused by hypermethylation of the p16INK4a promoter and that, subsequent to inhibition of methylation, p16INK4a expression can be rescued. Because demethylation of the p16INK4a promoter has such a dominant effect on the expression, we suppose that apart from promoter methylation, there is no other major genetic or epigenetic inhibitor of expression present in our cell lines to prevent p16INK4a expression. Cell culturing in the absence of 5-aza-2'-deoxycytidine resulted in a relapse of uncontrolled cell growth after 75 days, coinciding with loss of p16INK4a expression. This repeated loss illustrates that p16INK4a inactivation is a key feature of unrestricted cell growth in our cell lines.

Furthermore, we show that in uveal melanoma, p16INK4a is the only target in the 9p21 region where, besides p16INK4a, the genes that encode the CDK inhibitors p15INK4b and p14ARF are localized. p14ARF might even be slightly up-regulated in methylated cell lines, possibly revealing the cellular response to loss of p16INK4a.

Follow-up of the patients with methylated tumors indicate that p16INK4a is involved in the development of metastases, but additional studies with a larger group of patients and a longer follow-up will be necessary to substantiate this. Functional studies are required to determine the invasive pathways that are stimulated by loss of p16INK4a, and in this respect we can expand on the experiments performed on gliomas. Chintala et al. (30) demonstrated that the malignant behavior of glioma cells with regard to invasive capacity in Matrigels could be reversed by infecting cells with an adenovirus carrying the p16INK4a cDNA. Harada et al. (31) added that restoration of wild-type p16INK4a expression into p16INK4a-deleted glioma cells inhibited angiogenesis induced by tumor cells in vivo. Because increased vessel density or complicated vessel networks are important risk factors for metastases, p16INK4a may not only play a role in cell cycle control but also in angiogenesis. Additional studies are necessary to test this hypothesis. In conclusion, p16INK4a promoter methylation in uveal melanoma is a frequent event and seems to be a good marker to study metastases risk, and it offers a target for possible adjuvant treatment of uveal melanoma.


    ACKNOWLEDGMENTS
 
We appreciate the help of Dr. A. H. Zwinderman, Department of Medical Statistics, Leiden University Medical Center, Leiden, the Netherlands, for analysis of the patient data. We thank Dr. Gordon Peters and Prof. Dr. Rein Willemze for critical review of the manuscript, Dr. Didi de Wolff-Rouendaal for the histopathological analysis, Prof. Dr. Jan E. E. Keunen and Dr. J. Bleeker for providing patient material, and Wiljo J. F. de Leeuw for tumor DNA isolation.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 These authors contributed equally to this manuscript. Back

2 To whom requests for reprints should be addressed, at Center for Human and Clinical Genetics, Section Human Genetics, Wassenaarseweg 72, 2333 AL Leiden, the Netherlands. Phone: 31-71-5271917; Fax: 31-71-5271910; Email: gruis{at}lumc.nl Back

3 The abbreviations used are: CDK, cyclin-dependent kinase; Rb, retinoblastoma; MSP, methylation-specific PCR; RT-PCR, reverse transcription-PCR. Back

Received 11/30/00. Accepted 5/ 2/01.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sherr C. J. Mammalian G1 cyclins. Cell, 73: 1059-1065, 1993.[Medline]
  2. Serrano M., Hannon G. J., Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature (Lond.), 366: 704-707, 1993.[Medline]
  3. Stone S., Jiang P., Dayananth P., Tavtigian S. V., Katcher H., Parry D., Peters G., Kamb A. Complex structure and regulation of the P16 (MTS1) locus. Cancer Res., 55: 2988-2994, 1995.[Abstract/Free Full Text]
  4. Mao L., Merlo A., Bedi G., Shapiro G. I., Edwards C. D., Rollins B. J., Sidransky D. A novel p16INK4A transcript. Cancer Res., 55: 2995-2997, 1995.[Abstract/Free Full Text]
  5. Duro D., Bernard O., Della Valle V., Berger R., Larsen C. J. A new type of p16INK4/MTS1 gene transcript expressed in B-cell malignancies. Oncogene, 11: 21-29, 1995.[Medline]
  6. Quelle D. E., Zindy F., Ashmun R. A., Sherr C. J. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83: 993-1000, 1995.[Medline]
  7. Weber J. D., Taylor L. J., Roussel M. F., Sherr C. J., Bar-Sagi D. Nucleolar Arf sequesters Mdm2 and activates p53. Nat. Cell Biol., 1: 20-26, 1999.[Medline]
  8. Tao W., Levine A. J. P19(ARF) stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2. Proc. Natl. Acad. Sci. USA, 96: 6937-6941, 1999.[Abstract/Free Full Text]
  9. Sharpless N. E., DePinho R. A. The INK4A/ARF locus and its two gene products. Curr. Opin. Genet. Dev., 9: 22-30, 1999.[Medline]
  10. Harland M., Meloni R., Gruis N., Pinney E., Brookes S., Spurr N. K., Frischauf A. M., Bataille V., Peters G., Cuzick J., Selby P., Bishop D. T., Bishop J. N. Germline mutations of the CDKN2 gene in UK melanoma families. Hum. Mol. Genet., 6: 2061-2067, 1997.[Abstract/Free Full Text]
  11. Gruis N. A., van der Velden P. A., Sandkuijl L. A., Prins D. E., Weaver-Feldhaus J., Kamb A., Bergman W., Frants R. R. Homozygotes for CDKN2 (p16) germline mutation in Dutch familial melanoma kindreds. Nat. Genet., 10: 351-353, 1995.[Medline]
  12. Hussussian C. J., Struewing J. P., Goldstein A. M., Higgins P. A., Ally D. S., Sheahan M. D., Clark W. H., Jr., Tucker M. A., Dracopoli N. C. Germline p16 mutations in familial melanoma. Nat. Genet., 8: 15-21, 1994.[Medline]
  13. Monzon J., Liu L., Brill H., Goldstein A. M., Tucker M. A., From L., McLaughlin J., Hogg D., Lassam N. J. CDKN2A mutations in multiple primary melanomas. N. Engl. J. Med., 338: 879-887, 1998.[Abstract/Free Full Text]
  14. van Hees C. L., Jager M. J., Bleeker J. C., Kemme H., Bergman W. Occurrence of cutaneous and uveal melanoma in patients with uveal melanoma and their first degree relatives. Melanoma Res., 8: 175-180, 1998.[Medline]
  15. Toth-Molnar E., Hammer H., Olah J. Cutaneous dysplastic naevi in uveal melanoma patients: markers for prognosis?. Melanoma Res., 10: 36-39, 2000.[Medline]
  16. Egan K. M., Seddon J. M., Glynn R. J., Gragoudas E. S., Albert D. M. Epidemiologic aspects of uveal melanoma. Surv. Ophthalmol., 32: 239-251, 1988.[Medline]
  17. Diener-West M., Hawkins B. S., Markowitz J. A., Schachat A. P. A review of mortality from choroidal melanoma. II. A meta-analysis of 5-year mortality rates following enucleation, 1966 through 1988. Arch. Ophthalmol., 110: 245-250, 1992.[Abstract/Free Full Text]
  18. Lipsker D. M., Hedelin G., Heid E., Grosshans E. M., Cribier B. J. Striking increase of thin melanomas contrasts with stable incidence of thick melanomas. Arch. Dermatol., 135: 1451-1456, 1999.[Abstract/Free Full Text]
  19. Brochez L., Myny K., Bleyen L., De Backer G., Naeyaert J. M. The melanoma burden in Belgium; premature morbidity and mortality make melanoma a considerable health problem. Melanoma Res., 9: 614-618, 1999.[Medline]
  20. Merbs S. L., Sidransky D. Analysis of p16 (CDKN2/MTS-1/INK4A) alterations in primary sporadic uveal melanoma. Investig. Ophthalmol. Vis. Sci., 40: 779-783, 1999.[Abstract/Free Full Text]
  21. Baylin S. B., Herman J. G. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet., 16: 168-174, 2000.[Medline]
  22. Soengas M. S., Capodieci P., Polsky D., Mora J., Esteller M., Opitz-Araya X., McCombie R., Herman J. G., Gerald W. L., Lazebnik Y. A., Cordon-Cardo C., Lowe S. W. Inactivation of the apoptosis effector Apaf-1 in malignant melanoma. Nature (Lond.), 409: 207-211, 2001.[Medline]
  23. Jones P. A. Cancer. Death and methylation. Nature (Lond.), 409: 141-143144, 2001.[Medline]
  24. De Waard-Siebinga I., Blom D. J., Griffioen M., Schrier P. I., Hoogendoorn E., Beverstock G., Danen E. H., Jager M. J. Establishment and characterization of an uveal-melanoma cell line. Int. J. Cancer, 62: 155-161, 1995.[Medline]
  25. Isola J., DeVries S., Chu L., Ghazvini S., Waldman F. Analysis of changes in DNA sequence copy number by comparative genomic hybridization in archival paraffin-embedded tumor samples. Am. J. Pathol., 145: 1301-1308, 1994.[Abstract]
  26. Vos C. B., ter Haar N. T., Rosenberg C., Peterse J. L., Cleton-Jansen A. M., Cornelisse C. J., van de Vijver M. J. Genetic alterations on chromosome 16 and 17 are important features of ductal carcinoma in situ of the breast and are associated with histologic type. Br. J. Cancer, 81: 1410-1418, 1999.[Medline]
  27. Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826, 1996.[Abstract/Free Full Text]
  28. Kamb A., Gruis N. A., Weaver-Feldhaus J., Liu Q., Harshman K., Tavtigian S. V., Stockert E., Day R. S., III, Johnson B. E., Skolnick M. H. A cell cycle regulator potentially involved in genesis of many tumor types. Science, 264: 436-440, 1994.[Abstract/Free Full Text]
  29. Ohta M., Berd D., Shimizu M., Nagai H., Cotticelli M. G., Mastrangelo M., Shields J. A., Shields C. L., Croce C. M., Huebner K. Deletion mapping of chromosome region 9p21–p22 surrounding the CDKN2 locus in melanoma. Int. J. Cancer, 65: 762-767, 1996.[Medline]
  30. Chintala S. K., Fueyo J., Gomez-Manzano C., Venkaiah B., Bjerkvig R., Yung W. K., Sawaya R., Kyritsis A. P., Rao J. S. Adenovirus-mediated p16/CDKN2 gene transfer suppresses glioma invasion in vitro. Oncogene, 15: 2049-2057, 1997.[Medline]
  31. Harada H., Nakagawa K., Iwata S., Saito M., Kumon Y., Sakaki S., Sato K., Hamada K. Restoration of wild-type p16 down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in human gliomas. Cancer Res., 59: 3783-3789, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Br J OphthalmolHome page
P A van der Velden and W Maat
Methylation in uveal melanoma
Br J Ophthalmol, January 1, 2009; 93(1): 132 - 132.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
D. E. Freedberg, S. H. Rigas, J. Russak, W. Gai, M. Kaplow, I. Osman, F. Turner, J. A. Randerson-Moor, A. Houghton, K. Busam, et al.
Frequent p16-Independent Inactivation of p14ARF in Human Melanoma
J Natl Cancer Inst, June 4, 2008; 100(11): 784 - 795.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
W. Maat, S. H. W. Beiboer, M. J. Jager, G. P. M. Luyten, N. A. Gruis, and P. A. van der Velden
Epigenetic Regulation Identifies RASEF as a Tumor-Suppressor Gene in Uveal Melanoma
Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1291 - 1298.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
A P Moulin, G Clement, F T Bosman, L Zografos, and J Benhattar
Methylation of CpG island promoters in uveal melanoma
Br J Ophthalmol, February 1, 2008; 92(2): 281 - 285.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
E. Merhavi, Y. Cohen, B. C. R. Avraham, S. Frenkel, I. Chowers, J. Pe'er, and N. Goldenberg-Cohen
Promoter Methylation Status of Multiple Genes in Uveal Melanoma
Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4403 - 4406.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. A. Gollob and C. J. Sciambi
Decitabine Up-regulates S100A2 Expression and Synergizes with IFN-{gamma} to Kill Uveal Melanoma Cells
Clin. Cancer Res., September 1, 2007; 13(17): 5219 - 5225.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
N. Widodo, C. C. Deocaris, K. Kaur, K. Hasan, T. Yaguchi, K. Yamasaki, T. Sugihara, T. Ishii, R. Wadhwa, and S. C. Kaul
Stress Chaperones, Mortalin, and Pex19p Mediate 5-Aza-2' Deoxycytidine-Induced Senescence of Cancer Cells by DNA Methylation-Independent Pathway
J. Gerontol. A Biol. Sci. Med. Sci., March 1, 2007; 62(3): 246 - 255.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
W. Maat, P. A. van der Velden, C. Out-Luiting, M. Plug, A. Dirks-Mulder, M. J. Jager, and N. A. Gruis
Epigenetic Inactivation of RASSF1a in Uveal Melanoma
Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 486 - 490.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
J. W. Harbour
Eye Cancer: Unique Insights into Oncogenesis The Cogan Lecture
Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1737 - 1745.
[Full Text] [PDF]


Home page
CarcinogenesisHome page
W. M. Gallagher, O. E. Bergin, M. Rafferty, Z. D. Kelly, I.-M. Nolan, E. J.P. Fox, A. C. Culhane, L. McArdle, M. F. Fraga, L. Hughes, et al.
Multiple markers for melanoma progression regulated by DNA methylation: insights from transcriptomic studies
Carcinogenesis, November 1, 2005; 26(11): 1856 - 1867.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. E. Loercher, E. M.H. Tank, R. B. Delston, and J. W. Harbour
MITF links differentiation with cell cycle arrest in melanocytes by transcriptional activation of INK4A
J. Cell Biol., January 3, 2005; 168(1): 35 - 40.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Hoek, D. L. Rimm, K. R. Williams, H. Zhao, S. Ariyan, A. Lin, H. M. Kluger, A. J. Berger, E. Cheng, E. S. Trombetta, et al.
Expression Profiling Reveals Novel Pathways in the Transformation of Melanocytes to Melanomas
Cancer Res., August 1, 2004; 64(15): 5270 - 5282.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Cruz III, B. P. Rubin, D. Wilson, A. Town, A. Schroeder, A. Haley, T. Bainbridge, M. C. Heinrich, and C. L. Corless
Absence of BRAF and NRAS Mutations in Uveal Melanoma
Cancer Res., September 15, 2003; 63(18): 5761 - 5766.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. D. Klisovic, S. E. Katz, D. Effron, M. I. Klisovic, J. Wickham, M. R. Parthun, M. Guimond, and G. Marcucci
Depsipeptide (FR901228) Inhibits Proliferation and Induces Apoptosis in Primary and Metastatic Human Uveal Melanoma Cell Lines
Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2390 - 2398.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Hearle, B. E. Damato, J. Humphreys, J. Wixey, H. Green, J. Stone, D. F. Easton, and R. S. Houlston
Contribution of Germline Mutations in BRCA2, P16INK4A, P14ARF and P15 to Uveal Melanoma
Invest. Ophthalmol. Vis. Sci., February 1, 2003; 44(2): 458 - 462.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. C. Edmunds, D. P. Kelsell, J. L. Hungerford, and I. A. Cree
Mutational Analysis of Selected Genes in the TGF{beta}, Wnt, pRb, and p53 Pathways in Primary Uveal Melanoma
Invest. Ophthalmol. Vis. Sci., September 1, 2002; 43(9): 2845 - 2851.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
O. Straume, J. Smeds, R. Kumar, K. Hemminki, and L. A. Akslen
Significant Impact of Promoter Hypermethylation and the 540 C>T Polymorphism of CDKN2A in Cutaneous Melanoma of the Vertical Growth Phase
Am. J. Pathol., July 1, 2002; 161(1): 229 - 237.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van der Velden, P. A.
Right arrow Articles by Jager, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van der Velden, P. A.
Right arrow Articles by Jager, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online