Cancer Research 09 AM Call for Abstracts SU2C
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ikezoe, T.
Right arrow Articles by Koeffle, H. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ikezoe, T.
Right arrow Articles by Koeffle, H. P.
[Cancer Research 61, 5307-5310, July 1, 2001]
© 2001 American Association for Cancer Research

Tumor Biology

Mutational Analysis of the Peroxisome Proliferator-activated Receptor {gamma} Gene in Human Malignancies1

Takayuki Ikezoe2, Carl W. Miller, Seiji Kawano, Anthony Heaney, Elizabeth A. Williamson, Junichi Hisatake, Eric Green, Wolf Hofmann, Hirokuni Taguchi and H. Phillip Koeffle

Division of Hematology/Oncology [T. I., C. W. M., S. K., E. A. W., J. H., E. G., W. H., H. P. K.] and Department of Medicine [A. H.], Cedars-Sinai Research Institute, University of California-Los Angeles School of Medicine, Los Angeles, California 90048, and Department of Medicine, Kochi Medical School, Kochi 783-8505, Japan [H. T.]


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) plays an important role in adipocyte differentiation and is expressed in many human malignancies, including those from prostate, breast, as well as colon. It regulates differentiation and/or cell growth of these cells. However, expression of this nuclear hormone receptor in other types of cancer, especially in hematological malignancies, remains to be fully elucidated. The PPAR{gamma} gene has been mapped to chromosome band 3p25, where chromosomal abnormalities are observed in a variety of human malignancies. Furthermore, a recent study revealed that the PPAR{gamma} gene is functionally mutated in sporadic colon cancer cells. Therefore, PPAR{gamma} could be an important tumor suppressor gene. This prompted us to investigate the expression and mutational status of the PPAR{gamma} gene in cancers of a variety of tissues. A total of 159 samples were interrogated for their expression of PPAR{gamma} as measured by reverse transcription-polymerase chain reaction and/or Western blot analysis. In each of the samples, expression of PPAR{gamma} was detectable. In addition, a total of 397 clinical samples and cell lines including colon, prostate, breast and lung cancers, and leukemias were analyzed for mutations of the PPAR{gamma} gene by either reverse transcription-polymerase chain reaction-single-strand conformation polymorphism or polymerase chain reaction-single-strand conformation polymorphism analysis. No abnormalities were detectable in any of the human malignancies. On the other hand, shifted bands were easily detectable when using positive controls, which harbored the same sequence alterations reported previously in colon cancer cells. Taken together, PPAR{gamma} is expressed in a variety of cancers, and mutation of the PPAR{gamma} gene is a very rare event in human malignancies.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
PPAR{gamma},3 a member of the nuclear receptor superfamily, is highly expressed in adipose tissue and is intimately involved in mediating differentiation of adipocytes and regulating fat metabolism (1, 2, 3) . The PPAR{gamma} heteromerizes with retinoid X receptor, activated by binding to ligand, and transactivates target genes. Previous studies showed that PPAR{gamma} is also expressed in malignant tissue including prostate, breast, and colon. Activation of PPAR{gamma} with a class of synthetic ligands, thiazolidinediones, inhibited proliferation and/or induced differentiation of these transformed cells (4, 5, 6, 7) . The expression of PPAR{gamma} and its role in other types of cancer, especially in hematological malignancies, remains to be fully elucidated.

The PPAR{gamma} gene has been mapped to chromosomal band 3p25 (8) , a region where chromosomal abnormalities have been identified in a variety of human malignancies, including lung cancer (9) , neuroblastoma (10) , malignant lymphoma and acute leukemia (11) , and follicular thyroid cancer (12) . These findings suggest that a putative tumor suppressor gene exists on chromosome band 3p25. Furthermore, the PPAR{gamma} is fused to PAX8 in follicular thyroid cancer (12) . PPAR{gamma} could be a candidate tumor suppressor gene. Indeed, a recent study discovered that 4 out of 55 sporadic colon cancers had functional mutations of the PPAR{gamma} gene (13) . These included one nonsense and two missense mutations in exon 5 within the ligand binding domain and one frameshift mutation in exon 3, which codes for the DNA binding domain (14) . This prompted us to expand the investigation of the structural integrity of the PPAR{gamma} gene and its expression in a variety of human cancers.


   MATERIALS AND METHODS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
RT-PCR.
RNA isolation and cDNA preparation were performed as described previously (14) . Primers for PCR are summarized on Table 1Citation . Primers used for PPAR{gamma} were 5'-TCCAACTCCCTCATGGCAATTG-3' (exon 2) and 5'-ATGAGACATCCCCACTGCAAG-3' (exon 3), which yielded a 202 bp product. cDNA was amplified through 35 cycles of: 94° C, 30 s; 60° C, 30 s; and 72° C, 30 s. The quality of cDNA was confirmed by paralled PCR amplification of GAPDH gene. Primers for GAPDH were 5'-CCATGGAGAAGGCTGGGG-3' and 5'-CAAAGTTGTCATGGATGACC-3', and the PCR conditions were 35 cycles of: 94° C, 30 s; 58° C, 30 s; and 72° C, 30 s. PCR products were electrophoresed and transferred to a nylon membrane as described previously (14) . Membranes were probed with the 32P-labeled internal primers 5'-GGAGATAAAGCTTCTGGATTT-3' for PPAR{gamma} and 5'-AAAGGGTCATCATCTCTGCCC-3' for GAPDH, respectively, and visualized by autoradiography.


View this table:
[in this window]
[in a new window]

  		Table 1 Primer sequences used for PCR-SSCP and RT-PCR-SSCP analyses

 
RT-PCR-SSCP and PCR-SSCP.
RT-PCR-SSCP and PCR-SSCP were performed as described previously (14) . In this study, each primer set was designed to cover the biologically important sites of DNA binding (exon 3) and ligand binding (exon 5) of PPAR{gamma} (Table 4)Citation . After 35 cycles of PCR, these products were denatured and electrophoresed on 6% polyacrylamide gel with 10% glycerol at room temperature. The gels were dried and exposed to X-ray film at -80° C.


View this table:
[in this window]
[in a new window]

  		Table 4 Expression of PPAR{gamma} gene in Non-hematopoietic cancer cell lines

 
Positive Controls for PCR-SSCP.
Sarraf et al. (13) reported two missense (codon 313, CAG to CGG and codon 315, CGC to CAC) and one nonsense mutation (codon 347, AAA to TAA) in exon 5 of PPAR{gamma} gene (GenBank accession no. U79012) in colon cancer samples. These three different mutations were constructed by a PCR-based method. In brief, 35 cycles of PCR were performed using genomic DNA extracted from peripheral blood mononuclear cells isolated from normal, healthy volunteers after informed consent. To generate the codon 313 or codon 315 mutation, the primer sets of 5F1 and 313 R (TTGGCATACTCTGTGATCTCCTGCACAGCCTCCACGGAGCGAAACCGGCAGCCCTGAAAAG, the bold letters indicate primer 5R1 on Table 1Citation and the underline indicates nucleotide substitution) or primer sets of 5F1 and 315 R (TTGGCATACTCTGTGATCTCCTGCACAGCCTCCACGGAGTGAAACTGGCAGCCCTGAAAAG, the bold letters indicate primer 5R1 on Table 1Citation and the underline indicates nucleotide substitution) were used, respectively (Fig. 2)Citation . PCR products were electrophoresed on 2% agarose gels, purified with the gel purification kit (Qiagen Inc., Valencia, CA), and used as a template for PCR-SSCP with primer sets of 5F1 and 5R1. To construct the codon 347 mutation, primer sets of 5F2 and 347 R (CCATATTAGAGGAGAGTTAC) and primer sets of 347 F (GTAACTCTCCTCTAATATGG) and 5R2 were used. Each PCR product was mixed together and used as template for PCR with primer sets of 5F2 and 5R2. Subsequently, the PCR product was electrophoresed, purified, and used as template for PCR-SSCP with primer sets of 5F2 and 5R2 as mentioned above. All mutations (codon 313, CAG to CGG; codon 315, CGC to CAC; and codon 347; AAA to TAA) were confirmed by direct sequencing as described previously (14) (data not shown).



View larger version (96K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. Representative results of PCR-SSCP analysis for exon 5 (ligand binding domain) of PPAR{gamma} in colon cancer clinical samples. A, results of PCR-SSCP with primer sets of 5F1 and 5R1. Positive controls (Lane 4, codon 313 mutation; Lane 5, codon 315 mutation) showed the shifted bands (Fig. 3A). None of colon cancer clinical samples (Lanes 1, 2, 6–10) showed shifted bands. B, results of PCR-SSCP with primer sets of 5F2 and 5R2. Positive control (Lane 1, codon 347 mutation) showed the shifted bands. None of colon cancer clinical samples (Lanes 2–10) showed shifted bands. Arrows, shifted bands.

 
Samples and Cell Lines.
A total of 339 clinical samples were obtained after informed consent from the patients. These included 58 cases of colon cancer, 37 breast cancers, 35 lung cancers, 7 prostate cancers, 20 osteosarcomas, 6 glioblastomas, 45 AMLs, 51 B-ALLs, 1 preB-ALL, 10 common B cell ALLs, 30 ATLs, 11 B-NHLs, and 28 cases of myelodysplastic syndrome (Tables 2Citation and 5Citation ). All solid cancer samples were fresh specimens, which were obtained at the time of their surgical removal. The pathology was verified by microscopic examination, and often the cancerous tissue was microdissected by a pathologist. Cell lines used in this study are summarized in Tables 3Citation and 4Citation , including 14 lung, 10 colon, one duodenal, five breast and five prostate cancers, two glioblastomas, nine AMLs, three CML-BC, five T-ALLs, two ATLs, five preB-ALLs, one B-ALL, seven B-NHLs, and two myeloma cell lines.


View this table:
[in this window]
[in a new window]

  		Table 2 Clinical samples examined for PPAR{gamma} mutations

 

View this table:
[in this window]
[in a new window]

  		Table 5 Expression of PPAR{gamma} gene in clinical cancer samplesa

 

View this table:
[in this window]
[in a new window]

  		Table 3 Expression of PPAR{gamma} gene in hematopoietic cell lines

 
Western Blot Analysis.
Lysates were made by standard method. Western blotting, immunodetection, and stripping membranes were performed using standard methods (30-µg protein/lane) as recommended by the supplier of the Enhanced Chemiluminescence Detection System (Amersham Corp., Arlington Heights, IL). Antibodies were used at a dilution of 1:2000 (anti-PPAR{gamma}; Calbiochem, La Jolla, CA) and 1:1000 (ß-actin; Oncogene Science, Uniondale, NY). The second antibodies were used at a dilution of 1:1500.

Isolation of Hematopoietic Cells.
Peripheral blood mononuclear cells were washed twice with PBS containing 2% FCS and stained with anti-CD 19 and anti-CD 3 monoclonal antibodies (Calitag, Burlingame, CA) for 15 minutes at 4° C. Cells were washed twice with PBS and sorted on a FACStar Plus (Becton Dickinson, Mountain View, CA). Using anti-CD 34 monoclonal antibody (Calitag), hematopoietic stem cells were isolated from human bone marrow cells from normal healthy volunteers after their informed consent using the same method as described above. Recovered samples were used for extraction of RNA and protein.


   RESULTS
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of PPAR{gamma}.
A total of 71 cancer cell lines and 88 clinical cancer samples were analyzed for RNA and/or protein expression of PPAR{gamma}. All of the cell lines and clinical samples including those from hematological malignancies expressed PPAR{gamma} as detected by RT-PCR and/or Western blot (Fig. 1ACitation , Tables 3Citation 4Citation 5Citation ). Their expression levels varied widely between samples, especially in the hematopoietic cell lines. For example, the expression of PPAR{gamma} by the early myeloblastic cell line, KG-1, was much less than that expressed by the more mature myelomonocytic cell lines, U937, THP-1, and ML-1. To verify whether normal hematopoietic cells expressed PPAR{gamma}, we isolated CD 19-positive B cells, CD 3-positive T cells, and CD 34-positive hematopoietic stem cells from normal healthy volunteers. Each of these populations expressed PPAR{gamma} (Fig. 1B)Citation .



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. Representative results of PPAR{gamma} and GAPDH gene expression. Autoradiography of RT-PCR products (202 bp) of the PPAR{gamma} gene is shown in the top panels and GAPDH (200 bp) in the bottom panels. A, expression of PPAR{gamma} in hematological cell lines. Lane 1, HL-60, AML; Lane 2, K562, CML-BC; Lane 3, U937, AML; Lane 4, THP-1, AML; Lane 5, Kasumi-1, AML; Lane 6, Kasumi-3, AML, Lane 7, KG-1, AML; Lane 8, KCL22, CML-BC; Lane 9, SKNO1, AML; Lane 10, ML-1, AML; Lane 11, NB4, AML; Lane 12, TALL2, T-ALL. B, expression of PPAR{gamma} in normal hematopoietic cells. Lane 1, CD34-positive hematopoietic stem cells; Lane 2, CD3-positive T cells; Lane 3, CD19-positive B cells.

 
Mutational Analysis of PPAR{gamma}.
A total of 326 clinical cancer samples and 71 cancer cell lines were analyzed for mutation of exon 3 (DNA-binding domain) and exon 5 (ligand-binding domain) of the PPAR{gamma} gene by either RT-PCR-SSCP or PCR-SSCP analysis. These regions were chosen because they were reported to be the areas mutated in colon cancers (13) . No shifted bands were detectable in any of the samples including 58 colon cancer clinical samples (Fig. 2)Citation . In contrast, shifted bands were easily detectable when using positive controls (Fig. 2)Citation .


   DISCUSSION
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The PPAR{gamma} belongs to a nuclear hormone receptor family that forms a heterodimeric DNA-binding complex with retinoid X receptor and is involved in cellular differentiation and proliferation (1) . Previous studies revealed that PPAR{gamma} was linked to adipocyte differentiation and control of lipid uptake (1) . Moreover, recent data suggest that PPAR{gamma} is also linked to differentiation and/or cessation of growth of many types of cancer. This includes colon (4) , breast (5 , 6) , and prostate cancers (7) ; liposarcoma (15) ; and acute monocytic leukemia (16) . In addition, we and others have found that thiazolidinediones inhibited the development of preneoplastic lesions in a murine mammary gland culture system (17 , 18) .

The above findings suggest that PPAR{gamma} might play an important role in the regulation of genes associated with cellular growth and/or differentiation of transformed cells. Thus, disruption of gene regulation via PPAR{gamma} might contribute to tumorgenesis of several types of cancer. Indeed, a recent study revealed that the PPAR{gamma} gene is functionally mutated in 4 out of 55 sporadic colon cancer cells (13) . To determine the frequency of PPAR{gamma} gene mutations in human malignancies, we examined a total of 326 clinical cancer samples and 71 cancer cell lines by either RT-PCR-SSCP or PCR-SSCP analysis. Contrary to our expectation, no shifted bands were detectable in any of these samples. We believe that our false-negative rate is low because our SSCP was easily sensitive enough to detect known single amino acid substitutions at codon 313 (CAG to CGG), codon 315 (CGC to CAC), and codon 347 (AAA to TAA) in exon 5 of the PPAR{gamma} gene (13) (Fig. 2)Citation . Surprisingly, we could not find any mutations in the PPAR{gamma} gene in 58 clinical samples and 10 cell lines from colon cancer (Fig. 2)Citation . Also, studies of PPAR{gamma}-deletional mice emphasized the importance of PPAR{gamma} for normal placental, cardiac, and adipose tissue formation (19 , 20) , and PPAR{gamma} heterozygous-deletional mice did not have a higher incidence of cancer. Furthermore, Lefebvre et al. (21) and Saez et al. (22) reported that administration of a PPAR{gamma} ligand (troglitazone or rosiglitazone) to C57BL/6J-APCMin mice in which the APC gene was disrupted resulted in an increased number of intestinal tumors. Taken together, these findings indicate that PPAR{gamma} in most situations does not behave as a tumor suppressor gene.

Recently, Kroll et al. (12) showed that five out of eight follicular carcinomas of the thyroid harbored the chromosomal translocation t(2;3)(q13;p25) resulting in expression of the chimeric fusion protein of PAX8, a thyroid transcription factor, and PPAR{gamma}. In addition, they showed that this fusion transcript inhibited the thiazolidinedione-induced transcriptional activation by PPAR{gamma} in a dominant negative manner. However, the contribution of the PAX8-PPAR{gamma} fusion product to the thyroid carcinogenesis remains to be elucidated.

Cancer cells can lack expression of a tumor suppressor gene by a variety of mechanisms including hypermethylation of the CpG islands in the region of the gene (23) . We examined for expression of PPAR{gamma} in a large number of cancers and found expression in each sample. Taken together, we conclude that PPAR{gamma} is expressed in a wide variety of cancers, and mutation of PPAR{gamma} is very rare. Further studies are necessary to elucidate the role of PPAR{gamma} in both tumorgenesis and to explore the use of ligands for this nuclear hormone receptor for adjuvant therapy and chemoprevention of selected cancers.


   ACKNOWLEDGMENTS
 
We thank Jonathan W. Said, Akiko Sakashita, Utz Krug, and Kunihiro Tsukasaki for providing clinical samples and cell lines. We also thank Kim Burgin for excellent secretarial help.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by NIH and Department of Defense grants, the Parker Hughes Trust, Aaron Eschman, C. and H. Koeffler, the Ko-So Foundation and Horn Funds, and the Lymphoma Foundation of America. H. P. Koeffler is a member of University of California-Los Angeles Jonsson Comprehensive Cancer Center and holds an endowed Mark Goodson Chair of Oncology Research at Cedars-Sinai Medical Center. Back

2 To whom requests for reprints should be addressed, at Division of Hematology/Oncology, Cedars-Sinai Research Institute University of California-Los Angeles School of Medicine, 8700 Beverly Boulevard, Los Angeles, CA 90048. Phone: (310) 423-4609; Fax: (310) 423-0443. Back

3 The abbreviations used are: PPAR{gamma}, peroxisome proliferator-activated receptor {gamma}; AML, acute myelogenous leukemia; B-ALL, B-cell acute lymphoblastic leukemia; ATL, adult T-cell leukemia; CML-BC, blast crisis of chronic myelocytic leukemia(s); T-ALL, T-cell ALL; preB-ALL, precursor B-cell ALL; B-NHL, B-cell non-Hodgkin’s lymphoma; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR-SSCP, reverse transcription-polymerase chain reaction-single strand conformation polymorphism. Back

Received 12/15/00. Accepted 5/ 1/01.


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lowell B. B. PPAR{gamma}: An essential regulator of adipogenesis and modulator of fat cell function. Cell, 99: 239-242, 1999.[Medline]
  2. Mangelsdorf D. J., Thummel C., Beato M., Herrlich P., Schutz G., Umesono K., Blumberg B. The nuclear receptor superfamily: the second decade. Cell, 83: 835-839, 1995.[Medline]
  3. Auboeuf D., Rieusset J., Fajas L., Vallier P., Frering V., Riou J. P., Staels B., Auerx J., Laville M., Vidal H. Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans: no alteration in adipose tissue of obese and NIDDM patients. Diabetes, 46: 1319-1327, 1997.[Abstract]
  4. Sarraf P., Mueller E., Jones D., King F. J., Deangelo D. J., Partridge J. B., Holden S. A., Chen L. B., Singer S., Fletcher C., Spiegeleman B. M. Differentiation and reversal of malignant changes in colon cancer through PPAR{gamma}. Nat. Med., 4: 1046-1052, 1998.[Medline]
  5. Elstner E., Müller C., Koshizuka K., Williamson E. A., Park D., Asou H., Shintaku P., Said J. W., Heber D., Koeffler H. P. Ligands for peroxisome proliferator-activated receptor {gamma} and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and BNX mice. Proc. Natl. Acad. Sci. USA., 95: 8806-8811, 1998.[Abstract/Free Full Text]
  6. Mueller E., Sarraf P., Tontonoz P., Evans R. M., Martin K. J., Zhang M., Fletcher C., Singer S., Spiegelman B. M. Terminal differentiation of human breast cancer through PPAR gamma. Mol. Cell, 1: 465-470, 1998.[Medline]
  7. Kubota K., Koshizuka K., Williamson E. A., Asou H., Said J. W., Holden S., Miyoshi I., Koeffler H. P. Ligand for peroxisome proliferator-activated receptor {gamma} (Troglitazone) has potent antitumor effect against human prostate cancer both in vitro and in vivo. Cancer Res., 58: 3344-3352, 1998.[Abstract/Free Full Text]
  8. Green M. E., Blumberg B., McBride O. W., Yi H. F., Kronquist K., Kwan K., Hsieh L., Greene G., Nimer S. D. Isolation of the human peroxisome proliferator activated receptor gamma: expression in hematopoietic cells and chromosomal mapping. Gene Expr., 4: 281-299, 1995.[Medline]
  9. Geradts J., Fong K. M., Zimmerman P. V., Maynard R., Minna J. D. Correlation of abnormal RB, p16ink4a, and p53 expression with 3p loss of heterozygosity, other genetic abnormalities, and clinical features in 103 primary non-small cell lung cancers. Clin. Cancer Res., 5: 791-800, 1999.[Abstract/Free Full Text]
  10. Ejeskar K., Aburatani H., Abrahamsson J., Kogner P., Martinsson T. Loss of heterozygosity 3p markers in neuroblastoma tumours implicate a tumour-suppressor locus distal to the FHIT gene. Br. J. Cancer, 77: 1787-1791, 1998.[Medline]
  11. Cigudosa J. C., Parsa N. Z., Louie D. C., Filippa D. A., Jhanwar S. C., Johansson B., Mitelman F., Chaganti R. S. K. Cytogenetic analysis of 363 consecutively ascertained diffuse large B-cell lymphomas. Genes Chromosomes Cancer, 25: 123-133, 1999.[Medline]
  12. Kroll T. G., Sarraf P., Pecciarini L., Chen C. J., Mueller E., Spiegelman B. M., Fletcher J. A. PAX8-PPARgamma1 fusion oncogene in human thyroid carcinoma. Science (Wash. DC), 289: 1357-1360, 2000.[Abstract/Free Full Text]
  13. Sarraf P., Mueller E., Smith W. M., Wright H. M., Kum J. B., Aaltonen L. A., Chapelle A., Spiegelman B. M., Eng C. Loss-of-function mutations in PPAR{gamma} associated with human colon cancer. Mol. Cell, 3: 799-804, 1999.[Medline]
  14. Kawano S., Miller C. W., Gombart A. F., Bartram C. R., Matsuo Y., Asou H., Sakashita A., Said J., Tatsumi E., Koeffler H. P. Loss of p73 gene expression in leukemias/lymphomas due to hypermethylation. Blood, 94: 1113-1120, 1999.[Abstract/Free Full Text]
  15. Tontonoz P., Singer S., Forman B., Sarraf P., Fletcher J., Fletcher C. D., Brun R. P., Mueller E., Altiok S., Oppenheim H., Evans R. M., Spiegelman B. M. Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor gamma and the retinoid X receptor. Proc. Natl. Acad. Sci. USA., 94: 237-241, 1997.[Abstract/Free Full Text]
  16. Zhu L., Gong B., Bisgaier C. L., Aviram M., Newton R. S. Induction of PPAR{gamma}1 expression in human THP-1 monocytic leukemia cells by 9-cis-retinoic acid is associated with cellular growth suppression. Biochem. Biophys. Res. Commun., 251: 842-848, 1998.[Medline]
  17. Mehta R. G., Williamson E. A., Patel M. K., Koeffler H. P. A ligand of peroxisome proliferator-activated receptor {gamma}, retinoids, and prevention of preneoplastic mammary lesions. J. Natl. Cancer Inst., 92: 418-423, 2000.[Abstract/Free Full Text]
  18. Suh N., Wang Y., Williams C. R., Risingsong R., Gilmer T., Willson T. M., Sporn M. B. A new ligand for the peroxisome proliferator-activated receptor-gamma (PPAR-gamma), GW7845, inhibits rat mammary carcinogenesis. Cancer Res., 59: 5671-5673, 1999.[Abstract/Free Full Text]
  19. Barak Y., Nelson M. C., Ong E. S., Jones Y. Z., Ruiz-Lozano P., Chien K. R., Koder A., Evans R. M. PPAR{gamma} is required for placental, cardiac, and adipose tissue development. Mol. Cell, 4: 585-595, 1999.[Medline]
  20. Rosen E. D., Sarraf P., Troy A. E., Bradwin G., Moore K., Milstone D. S., Spiegelman B. M., Mortensen R. M. PPAR{gamma} is required for the differentiation of adipose tissue in vivo and in vitro. Mol. Cell, 4: 611-617, 1999.[Medline]
  21. Lefebvre A. M., Chen I., Desreumaux P., Najib J., Fruchart J. C., Geboes K., Briggs M., Heyman R., Auwerx J. Activation of the peroxisome proliferator-activated receptor {gamma} promotes the development of colon tumors in C57BL/6J-APCMin/+ mice. Nat. Med., 4: 1053-1057, 1998.[Medline]
  22. Saez E., Tontonoz P., Nelson M. C., Alvarez J. G., Ming U. T., Baird S. M., Thomazy V. A., Evans R. M. Activation of the nuclear receptor PPAR gamma enhance colon polyp formation. Nat. Med., 9: 1058-1061, 1998.
  23. Jones P. A. DNA methylation errors and cancer. Cancer Res., 56: 2463-2467, 1996.[Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Pharmacol.Home page
S. Papineni, S. Chintharlapalli, and S. Safe
Methyl 2-Cyano-3,11-dioxo-18{beta}-olean-1,12-dien-30-oate Is a Peroxisome Proliferator-Activated Receptor-{gamma} Agonist That Induces Receptor-Independent Apoptosis in LNCaP Prostate Cancer Cells
Mol. Pharmacol., February 1, 2008; 73(2): 553 - 565.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
M. York, M. Abdelrahim, S. Chintharlapalli, S. D. Lucero, and S. Safe
1,1-Bis(3'-Indolyl)-1-(p-Substitutedphenyl)methanes Induce Apoptosis and Inhibit Renal Cell Carcinoma Growth
Clin. Cancer Res., November 15, 2007; 13(22): 6743 - 6752.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
S. Chintharlapalli, S. Papineni, S. Liu, I. Jutooru, G. Chadalapaka, S.-d. Cho, R. S. Murthy, Y. You, and S. Safe
2-Cyano-lup-1-en-3-oxo-20-oic acid, a cyano derivative of betulinic acid, activates peroxisome proliferator-activated receptor {gamma} in colon and pancreatic cancer cells
Carcinogenesis, November 1, 2007; 28(11): 2337 - 2346.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
W. Su, C. R. Bush, B. M. Necela, S. R. Calcagno, N. R. Murray, A. P. Fields, and E. A. Thompson
Differential expression, distribution, and function of PPAR-{gamma} in the proximal and distal colon
Physiol Genomics, August 20, 2007; 30(3): 342 - 353.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. R. Bush, J. M. Havens, B. M. Necela, W. Su, L. Chen, M. Yanagisawa, P. Z. Anastasiadis, R. Guerra, B. A. Luxon, and E. A. Thompson
Functional Genomic Analysis Reveals Cross-talk between Peroxisome Proliferator-activated Receptor {gamma} and Calcium Signaling in Human Colorectal Cancer Cells
J. Biol. Chem., August 10, 2007; 282(32): 23387 - 23401.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
S. Chintharlapalli, S. Papineni, and S. Safe
1,1-Bis(3'-Indolyl)-1-(p-substitutedphenyl)methanes Inhibit Growth, Induce Apoptosis, and Decrease the Androgen Receptor in LNCaP Prostate Cancer Cells through Peroxisome Proliferator-Activated Receptor {gamma}-Independent Pathways
Mol. Pharmacol., February 1, 2007; 71(2): 558 - 569.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
L. D. Yee, N. Williams, P. Wen, D. C. Young, J. Lester, M. V. Johnson, W. B. Farrar, M. J. Walker, S. P. Povoski, S. Suster, et al.
Pilot Study of Rosiglitazone Therapy in Women with Breast Cancer: Effects of Short-term Therapy on Tumor Tissue and Serum Markers
Clin. Cancer Res., January 1, 2007; 13(1): 246 - 252.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
P. Lei, M. Abdelrahim, and S. Safe
1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methanes inhibit ovarian cancer cell growth through peroxisome proliferator-activated receptor-dependent and independent pathways.
Mol. Cancer Ther., September 1, 2006; 5(9): 2324 - 2336.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
K. Ota, K. Ito, T. Suzuki, S. Saito, M. Tamura, S.-i. Hayashi, K. Okamura, H. Sasano, and N. Yaegashi
Peroxisome Proliferator-Activated Receptor {gamma} and Growth Inhibition by Its Ligands in Uterine Endometrial Carcinoma.
Clin. Cancer Res., July 15, 2006; 12(14): 4200 - 4208.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
S. Chintharlapalli, S. Papineni, and S. Safe
1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methanes inhibit colon cancer cell and tumor growth through PPAR{gamma}-dependent and PPAR{gamma}-independent pathways
Mol. Cancer Ther., May 1, 2006; 5(5): 1362 - 1370.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
W. Kassouf, S. Chintharlapalli, M. Abdelrahim, G. Nelkin, S. Safe, and A. M. Kamat
Inhibition of Bladder Tumor Growth by 1,1-Bis(3'-Indolyl)-1-(p-Substitutedphenyl)Methanes: A New Class of Peroxisome Proliferator-Activated Receptor {gamma} Agonists
Cancer Res., January 1, 2006; 66(1): 412 - 418.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Sabatino, A. Casamassimi, G. Peluso, M. V. Barone, D. Capaccio, C. Migliore, P. Bonelli, A. Pedicini, A. Febbraro, A. Ciccodicola, et al.
A Novel Peroxisome Proliferator-activated Receptor {gamma} Isoform with Dominant Negative Activity Generated by Alternative Splicing
J. Biol. Chem., July 15, 2005; 280(28): 26517 - 26525.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
S. Chintharlapalli, S. Papineni, M. Konopleva, M. Andreef, I. Samudio, and S. Safe
2-Cyano-3,12-dioxoolean-1,9-dien-28-oic Acid and Related Compounds Inhibit Growth of Colon Cancer Cells through Peroxisome Proliferator-Activated Receptor {gamma}-Dependent and -Independent Pathways
Mol. Pharmacol., July 1, 2005; 68(1): 119 - 128.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Ikezoe, S. Gery, D. Yin, J. O'Kelly, L. Binderup, N. Lemp, H. Taguchi, and H. P. Koeffler
CCAAT/Enhancer-Binding Protein {delta}: A Molecular Target of 1,25-Dihydroxyvitamin D3 in Androgen-Responsive Prostate Cancer LNCaP Cells
Cancer Res., June 1, 2005; 65(11): 4762 - 4768.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
M. A. Murtaugh, K.-n. Ma, B. J. Caan, C. Sweeney, R. Wolff, W. S. Samowitz, J. D. Potter, and M. L. Slattery
Interactions of Peroxisome Proliferator-Activated Receptor {gamma} and Diet in Etiology of Colorectal Cancer
Cancer Epidemiol. Biomarkers Prev., May 1, 2005; 14(5): 1224 - 1229.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Yin, R. G. Russell, L. E. Dettin, R. Bai, Z.-L. Wei, A. P. Kozikowski, L. Kopleovich, and R. I. Glazer
Peroxisome Proliferator-Activated Receptor {delta} and {gamma} Agonists Differentially Alter Tumor Differentiation and Progression during Mammary Carcinogenesis
Cancer Res., May 1, 2005; 65(9): 3950 - 3957.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Han, A. J. Demetris, Y. Liu, J. H. Shelhamer, and T. Wu
Transforming Growth Factor-{beta} (TGF-{beta}) Activates Cytosolic Phospholipase A2{alpha} (cPLA2{alpha})-mediated Prostaglandin E2 (PGE)2/EP1 and Peroxisome Proliferator-activated Receptor-{gamma} (PPAR-{gamma})/Smad Signaling Pathways in Human Liver Cancer Cells: A NOVEL MECHANISM FOR SUBVERSION OF TGF-{beta}-INDUCED MITOINHIBITION
J. Biol. Chem., October 22, 2004; 279(43): 44344 - 44354.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Ikezoe, Y. Hisatake, T. Takeuchi, Y. Ohtsuki, Y. Yang, J. W. Said, H. Taguchi, and H. P. Koeffler
HIV-1 Protease Inhibitor, Ritonavir: A Potent Inhibitor of CYP3A4, Enhanced the Anticancer Effects of Docetaxel in Androgen-Independent Prostate Cancer Cells In vitro and In vivo
Cancer Res., October 15, 2004; 64(20): 7426 - 7431.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Chintharlapalli, R. Smith III, I. Samudio, W. Zhang, and S. Safe
1,1-Bis(3'-indolyl)-1-(p-substitutedphenyl)methanes Induce Peroxisome Proliferator-Activated Receptor {gamma}-Mediated Growth Inhibition, Transactivation, and Differentiation Markers in Colon Cancer Cells
Cancer Res., September 1, 2004; 64(17): 5994 - 6001.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
F. Bogazzi, F. Ultimieri, F. Raggi, D. Russo, R. Vanacore, C. Guida, S. Brogioni, C. Cosci, M. Gasperi, L. Bartalena, et al.
Growth Hormone Inhibits Apoptosis in Human Colonic Cancer Cell Lines: Antagonistic Effects of Peroxisome Proliferator Activated Receptor-{gamma} Ligands
Endocrinology, July 1, 2004; 145(7): 3353 - 3362.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
T. Ikezoe, T. Saito, K. Bandobashi, Y. Yang, H. P. Koeffler, and H. Taguchi
HIV-1 protease inhibitor induces growth arrest and apoptosis of human multiple myeloma cells via inactivation of signal transducer and activator of transcription 3 and extracellular signal-regulated kinase 1/2
Mol. Cancer Ther., April 1, 2004; 3(4): 473 - 479.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
E. Saez, J. Rosenfeld, A. Livolsi, P. Olson, E. Lombardo, M. Nelson, E. Banayo, R. D. Cardiff, J. C. Izpisua-Belmonte, and R. M. Evans
PPAR{gamma} signaling exacerbates mammary gland tumor development
Genes & Dev., March 1, 2004; 18(5): 528 - 540.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
C. Qin, D. Morrow, J. Stewart, K. Spencer, W. Porter, R. Smith III, T. Phillips, M. Abdelrahim, I. Samudio, and S. Safe
A new class of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists that inhibit growth of breast cancer cells: 1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methanes
Mol. Cancer Ther., March 1, 2004; 3(3): 247 - 260.
[Abstract] [Full Text]

Home page
 Clin. Cancer Res.Home page
T. Kumagai, T. Ikezoe, D. Gui, J. O'Kelly, X.-J. Tong, F. J. Cohen, J. W. Said, and H. P. Koeffler
RWJ-241947 (MCC-555), A Unique Peroxisome Proliferator-Activated Receptor-{gamma} Ligand with Antitumor Activity against Human Prostate Cancer in Vitro and in Beige/Nude/ X-Linked Immunodeficient Mice and Enhancement of Apoptosis in Myeloma Cells Induced by Arsenic Trioxide
Clin. Cancer Res., February 15, 2004; 10(4): 1508 - 1520.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
F. Bogazzi, F. Ultimieri, F. Raggi, D. Russo, P. Viacava, D. Cecchetti, A. Costa, S. Brogioni, C. Cosci, M. Gasperi, et al.
Changes in the Expression of the Peroxisome Proliferator-Activated Receptor {gamma} Gene in the Colonic Polyps and Colonic Mucosa of Acromegalic Patients
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3938 - 3942.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. A. Gupta, P. Sarraf, E. Mueller, J. A. Brockman, J. J. Prusakiewicz, C. Eng, T. M. Willson, and R. N. DuBois
Peroxisome Proliferator-activated Receptor {gamma}-mediated Differentiation: A MUTATION IN COLON CANCER CELLS REVEALS DIVERGENT AND CELL TYPE-SPECIFIC MECHANISMS
J. Biol. Chem., June 13, 2003; 278(25): 22669 - 22677.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. Qin, R. Burghardt, R. Smith, M. Wormke, J. Stewart, and S. Safe
Peroxisome Proliferator-activated Receptor {gamma} Agonists Induce Proteasome-dependent Degradation of Cyclin D1 and Estrogen Receptor {alpha} in MCF-7 Breast Cancer Cells
Cancer Res., March 1, 2003; 63(5): 958 - 964.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
H. P. Koeffler
Peroxisome Proliferator-activated Receptor {gamma} and Cancers
Clin. Cancer Res., January 1, 2003; 9(1): 1 - 9.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Auwerx
Nuclear Receptors: I. PPARgamma in the gastrointestinal tract: gain or pain?
Am J Physiol Gastrointest Liver Physiol, April 1, 2002; 282(4): G581 - G585.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services