Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention  Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuoka, S.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuoka, S.
Right arrow Articles by Takahashi, T.
[Cancer Research 61, 5362-5365, July 15, 2001]
© 2001 American Association for Cancer Research


Advances in Brief

Reduced Expression and Impaired Kinase Activity of a Chk2 Mutant Identified in Human Lung Cancer1

Shuhei Matsuoka2, Taku Nakagawa, Akira Masuda, Nobuhiro Haruki, Stephen J. Elledge and Takashi Takahashi

Howard Hughes Medical Institute, Verna and Marrs McLean Department of Biochemistry and Molecular Biology, Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas 77030 [S. M., S. J. E.], and Division of Molecular Oncology, Aichi Cancer Center Research Institute, Nagoya 464-8681, Japan [T. N., A. M., N. H., T. T.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The checkpoint kinase Chk2 is phosphorylated and activated in response to DNA damage such as ionizing radiation. Recently, we found a somatic mutation of CHK2 with clear loss of the wild-type allele in human lung cancer. Here we show that the mutant Chk2 exhibits modestly reduced in vitro kinase activity compared with wild type, whereas it is normally phosphorylated and activated after ionizing radiation. Interestingly, this mutant Chk2 protein was found to be less stable than wild type and could be expressed in various cell types only at a significantly reduced (20%) level of wild type. These findings confirm that the DNA damage checkpoint pathway involving CHK2 is indeed inactivated in this fatal adult cancer and also suggest that reduced expression of Chk2 may also be an important inactivating mechanism, contributing to the development of lung cancer.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The DNA damage checkpoint pathway maintains genomic integrity in part by coordinating cell cycle progression and DNA repair after DNA damage (1) . Mutations in genes in the checkpoint pathway, such as p53 and ATM,3 result in genomic instability and cancer predisposition. The checkpoint kinase Chk2, the mammalian homologue of budding yeast Rad53 and fission yeast Cds1, is rapidly phosphorylated and activated in response to DNA damage caused by IR or UV irradiation or replication blocks by hydroxyurea (2, 3, 4, 5, 6) . Activation of Chk2 is regulated by phosphorylation of the NH2-terminal SCD on Chk2 (7) , and Thr68 in the SCD is directly phosphorylated by ATM in response to IR (7, 8, 9, 10) . Chk2 phosphorylates Cdc25C on Ser216 in vitro, which interferes with the ability of Cdc25C to activate Cdc2 (2, 3, 4, 5, 6) . Maintenance of G2 arrest and reduced Cdc2 kinase activity in response to IR is defective in Chk2-/- mouse embryonic stem cells (11) . These results suggested that ATM controls G2 arrest after IR in part by activating Chk2. Chk2 also phosphorylates Ser20 on p53, leading to increased stability of p53 in response to IR (11, 12, 13) . Thus, Chk2 is suggested to control G1 arrest in part by stabilizing p53. Furthermore, the identification of heterozygous germ-line mutations in CHK2 in a subset of patients with Li-Fraumeni syndrome (14 , 15) supports this model.

Lung cancer is the leading cause of cancer deaths in many economically well-developed countries including the United States and Japan. Among the genetic lesions identified in lung cancer, the p53 gene, which plays an essential role in the G1 checkpoint, is the most frequently altered, suggesting an important role of this gene in the pathogenesis of lung cancer (16) . Although the G2 checkpoint genes are potential targets for genetic alterations in human cancers including lung cancer, very little information had been available about such defects. We recently found an in vivo somatic mutation of CHK2 in human lung cancer, suggesting its potential involvement (17) . In this study, we report detailed characterization of the mutant Chk2, which resulted in the identification of its significantly reduced protein expression and modestly impaired kinase activity in contrast with its normal phosphorylation and activation in response to IR.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Plasmid Construction.
pBSSKIICHK2-WT was constructed by ligating EcoRI-XbaI-digested pBSSKII and a normal CHK2 cDNA obtained by reverse transcription-PCR with primers FW: CGGAATTCCATGTCTCGGGAGTCGGATGT and RW: GCTCTACAGTGTTCAAACCACGGAGTTC. A fragment containing the mutation D311V, a substitution of Val for Asp311 was obtained by reverse transcription-PCR with primers F3 and R7 using total RNA from a tumor sample as a template (17) . The PCR product was digested with NarI and PPuMI and then exchanged with the NarI-PPuMI fragment of pBSSKIICHK2-WT, resulting in the construct pBSSKIICHK2-D311V. pGST-CHK2-D311V was made by replacing the NcoI-BamHI fragment from pBSSKIICHK2-D311V with the wild-type fragment of pGST-CHK2 (7) . pcDNA3-HA-CHK2-WT and pcDNA3-HA-CHK2-D311V were constructed by cloning EcoRI-XbaI fragment from pBSSKIICHK2-WT and pBSSKII-CHK2-D311V into pcDNA3-HA, respectively. pRet-HA-CHK2-WT and pRet-HA-CHK2-D311V, retrovirus vectors encoding HA-tagged wild-type Chk2 and Chk2-D311V, respectively, were constructed in pBabe-puro (7) .

In Vitro Kinase Assay.
GST-Chk2-WT and GST-Chk2-D311V were expressed in the Escherichia coli strain BL21 (Stratagene) and purified with glutathione-Sepharose (Pharmacia). The kinase assay using GST-Cdc25C (200–256) as a substrate was carried out as described (2) .

Protein Expression.
HA-Chk2-WT or HA-Chk2-D311V was expressed in COS cells by transfection of pcDNA3-HA-CHK2-WT or pcDNA3-HA-CHK2-D311V with a plasmid DNA expressing ß-Gal (pCMVßgal, a generous gift of T. Kiyono, Aichi Cancer Center Research Institute). HA-tagged wild type or D311V Chk2 was expressed in Chk2-/- MEF cells by retrovirus infection as reported previously (7) . To generate Chk2-/- MEF cells stably expressing FLAG-tagged wild-type Chk2, Chk2-/- MEF cells were infected with retrovirus encoding FLAG-Chk2-WT (7) , and 2 days after infection, cells were selected for 2 µg/ml of puromycin resistance.

Western Blot Analysis.
Antibodies used in this study are anti-Chk2 (2) , anti-HA (Santa-Cruz), anti-ß-Gal (5 prime-3 prime), anti-FLAG (Sigma Chemical Co.), anti-Actin (Santa-Cruz), and anti-phospho-Thr68 (kindly provided by B. Zhou, SmithKline Beecham Pharmaceuticals; Ref. 8 ). Immunoprecipitation and Western blotting were carried out as described (2 , 7) .

Northern Blot Analysis.
Total RNA was prepared, fractionated, and transferred onto a GeneScreen membrane (NEN Life Science Products). 32P-labeled CHK2 and ß-GAL cDNA probes were prepared by random priming, and hybridization and washing were carried out according to the standard procedures.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We first examined the in vitro kinase activity of the Chk2 mutant, because this mutant has an amino acid substitution of Val for Asp311 (D311V) in the kinase domain (17) . Wild-type and mutant Chk2 were expressed as GST-fusion protein in E. coli, and purified GST-Chk2 proteins were incubated with [{gamma}-32P]ATP and GST-Cdc25C (200–256) as a substrate. As shown in Fig. 1Citation , GST-Chk2-D311V had low kinase activity compared with wild-type GST-Chk2. Direct measurements of radioactivity in GST-Cdc25C (200–256) revealed that kinase activity of GST-Chk2-D311V was 60–70% of the level observed for wild type. It was noted that the autophosphorylation ability of the D311V mutant appeared to be less affected than its ability to phosphorylate Cdc25C.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1. Reduced kinase activity of GST-Chk2-D311V. Increasing amounts of purified GST-Chk2 or GST-Chk2-D311V were incubated with GST-Cdc25C (200–256) and [{gamma}-32P]ATP. Proteins were resolved by SDS-PAGE and visualized by autoradiography (32P) and Coomassie Brilliant Blue staining (Coomassie).

 
Next, we expressed wild-type and mutant Chk2 in COS cells by transient transfection. A plasmid expressing HA-tagged Chk2 wild type or the D311V mutant under the control of cytomegalovirus promoter was cotransfected into COS cells together with a plasmid-encoding ß-Gal. Fig. 2ACitation shows that Chk2-D311V is expressed in cells at significantly lower levels than wild-type Chk2 in contrast with similar levels of expression of ß-Gal. Similar results were also obtained when expressed in 293T cells (data not shown). Quantitative analysis indicated that the protein level of the D311V mutant was only 20% of wild type. Northern blot analysis of RNA prepared from these cells showed that both wild type and D311V were transcribed at similar levels (Fig. 2B)Citation . Furthermore, cycloheximide treatment of these cells revealed that the half-life of the mutant protein was ~6 h, whereas wild-type protein was stable over 24 h with only 10–15% reduction in protein level (Fig. 2C)Citation . These results suggest that the reduced expression of D311V is caused by instability of the mutant protein.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Reduced protein level of Chk2-D311V expressed in COS cells. A, pcDNA3-HA-CHK2-WT (WT), pcDNA3-HA-CHK2-D311V (D311V), or empty vector (Vector) was cotransfected into COS cells with plasmid DNA expressing ß-Gal. Protein extracts were prepared 48 h after transfection, fractionated by SDS-PAGE, and immunoblotted with anti-Chk2 antibody (anti-Chk2), anti-HA antibody (anti-HA), or anti-ß-Gal antibody (anti-ß-gal). B, total RNA was prepared from cells in (A), fractionated by agarose gel electrophoresis, and then transferred on a GeneScreen membrane. The membrane was probed with 32P-labeled CHK2 and ß-GAL cDNA. C, COS cells transfected with plasmid DNA expressing HA-Chk2-WT (WT) or HA-Chk2-D311V (D311V) were incubated with 100 µg/ml of cycloheximide (CHX) for the indicated time. Protein extracts were fractionated by SDS-PAGE and immunoblotted with anti-HA antibody.

 
Phosphorylation and activation of Chk2-D311V were further examined in Chk2-/- MEF cells with and without exposure to DNA damage, because we showed previously that human Chk2 expressed in Chk2-/- MEF cells can correctly respond to IR (7) . When wild type and D311V were expressed in Chk2-/- MEF cells, a significantly reduced protein level of Chk2-D311V was again observed in MEF cells (Fig. 3A)Citation , indicating that reduced expression of the mutant protein did not depend on the cell types used (COS, 293T, or MEF) and the method of expression (transfection or retrovirus infection). Mobility shift of the D311V mutant after DNA damage occurred to the extent very similar to that of wild-type Chk2 (Fig. 3B)Citation . Because we showed that mobility shift of Chk2 is parallel to its activation after DNA damage (2 , 7) , these results indicate that Chk2-D311V is likely to be activated in response to IR like wild-type Chk2. It was also noted that Thr68 in the SCD was phosphorylated on both wild type and Chk2-D311V in response to IR (Fig. 3C)Citation . Note that five times more cell extract was used to immunoprecipitate Chk2-D311V in this experiment to compensate for its reduced expression. These results indicated that, although Chk2-D311V exhibited significantly reduced protein expression, Chk2-D311V retains its ability to respond to IR like wild-type Chk2.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. Phosphorylation of Thr68 on wild-type and D311V Chk2 after DNA damage. A, protein from Chk2-/- MEF cells infected with retroviruses encoding empty vector (Vector), wild-type human Chk2 (WT), or Chk2-D311V (D311V) was fractionated by SDS-PAGE and immunoblotted with anti-Chk2 and anti-Actin antibodies. B, Chk2-/- MEF cells infected with retroviruses encoding empty vector (Vector), wild-type human Chk2 (WT), or the Chk2-D311V (D311V) were untreated (-) or treated (+) with 20 Gy IR and harvested after 1 h. Protein from these cells was fractionated by SDS-PAGE and immunoblotted with anti-Chk2 antibody. C, Chk2 was immunoprecipitated with anti-Chk2 antibodies from cells in (B), fractionated by SDS-PAGE, and then immunoblotted with anti-phospho-Thr68 (anti-P-T68) and anti-Chk2 (anti-Chk2) antibodies. Because of low amount of Chk2-D311V protein in cell extracts, five times more cell extract than that for wild type were used to immunoprecipitate Chk2-D311V.

 
Finally, to know whether the D311V mutant could interfere with expression of wild-type Chk2 in a dominant negative fashion, Chk2-D311V was coexpressed with wild-type Chk2. Coexpression of D311V mutant did not change the protein level of wild-type Chk2 (Fig. 4)Citation , suggesting that Chk2-D311V does not act as a dominant negative mutant.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Chk2-D311V does not act as a dominant negative mutant. Chk2-/- MEF cells stably expressing FLAG-tagged wild-type Chk2 were infected with retroviruses encoding empty vector (Vector), HA-tagged wild-type Chk2 (WT), or HA-Chk2-D311V (D311V). Protein from these cells was fractionated by SDS-PAGE and immunoblotted with anti-HA, anti-FLAG, and anti-Actin antibodies.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
It has been shown that inactivation of the p53 gene, which disrupts the G1 checkpoint, plays a major role in the pathogenesis of human lung cancer (16) , whereas the impairment of another important checkpoint, i.e., the G2 checkpoint, has long been expected to be present, contributing to the acquisition of genetic instability in lung cancer cells. Indeed, we found previously that the CHK2 gene is somatically mutated in lung cancer in vivo with clear loss of wild-type allele (17) . In the present study, this CHK2 missense mutation (D311V) within the kinase domain was studied in detail. Although this mutated Asp311 residue is not in the conserved kinase sub-domains I-XI (18) , it is well conserved among species, suggesting that Asp311 is functionally important and that the substitution may affect Chk2 kinase activity. Indeed, the mutant Chk2 exhibited impaired kinase activity in an in vitro kinase assay with GST-Cdc25C as a substrate, although the degree of impairment was modest. We note that kinase assay using Chk2-D311V immunoprecipitated from the MEF cells also showed slight impairment (data not shown); however, it was not as reproducible as that observed with GST-Chk2-D311V, perhaps because of low expression level of the D311V mutant in the MEF cells. Interestingly, the expression experiments revealed the most apparent alteration in that the D311V mutant protein was less stable than wild type and could be expressed at 20% of the level of wild-type Chk2 when the same level of mRNA was expressed. Because the D311V mutation was present in the lung cancer patient in association with clear loss of the corresponding wild-type allele (17) , its expression level may have been <10% of normal levels. Although the mutant Chk2 retained considerable kinase activity, it is thus conceivable that reduced protein expression by the mutation may have severely affected Chk2 function in the checkpoint pathway, thereby contributing lung cancer development in this case. Unfortunately, the primary tumor specimen of this patient was not available for protein analysis.

To date, three genuine CHK2 mutations have been identified thus far in Li-Fraumeni syndrome as well as in a colon cancer cell line (14 , 15 , 19) . Apparent lack of in vitro kinase activity was recently shown in one premature truncation mutant (del1100C) within the kinase domain, whereas one mutation within fork head-associated domain was shown to have reduced kinase activity in vitro and defects in both phosphorylation of Thr68 in the SCD and activation in response to IR (19) . The other fork head-associated domain mutant, a substitution of Thr for Ile at amino acid 157, behaved as wild-type Chk2 in all of the assays used (19) . The present study shows clear distinctions between the lung cancer Chk2 mutant, D311V, and the mutants reported previously, in that D311V showed significantly reduced protein expression with considerable retention of kinase activity and normal response of phosphorylation on Thr68 and activation to IR, suggesting that reduced expression of Chk2 may also be an important mechanism. Although the present findings that the CHK2 mutant identified in human lung cancer did have defects suggest its potential role in lung cancer development, our previous genetic screen showed that CHK2 mutation is relatively infrequent. It will therefore be interesting to study whether epigenetic alterations might also be involved, leading to down-regulation of Chk2 at the mRNA and/or protein levels in human lung cancers. Further studies are also warranted to search for additional as yet unidentified DNA damage checkpoint genes involved. In this connection, studies in yeast on DNA damage checkpoints will shed light on better understanding of the molecular pathogenesis of lung cancer.


    ACKNOWLEDGMENTS
 
We thank B. Zhou for anti-phospoho-Thr68 antibody, T. Kiyono for pCMVßgal, A. Osborn for helpful comments on the manuscript, K. Matsuoka for encouragement and helping figure preparation, and C. Cherry for secretarial support.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grant GM44664 and Welch Foundation Grant Q1187 (to S. J. E.) and by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports and Culture, Japan (to T. T.). Back

2 To whom requests for reprints should be addressed, at Department of Biochemistry and Molecular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. E-mail: matsuoka{at}bcm.tmc.edu Back

3 The abbreviations use are: ATM, ataxia-telangiectasia mutated; ß-Gal, ß-galactosidase; IR, ionizing radiation; SCD, Ser-Gln/Thr-Gln cluster domain; GST, glutathione S-transferase; HA, hemagglutinin; MEF, mouse embryonic fibroblast. Back

Received 1/30/01. Accepted 5/23/01.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Elledge S. J. Cell cycle checkpoints: preventing an identity crisis. Science (Wash. DC), 274: 1664-1672, 1996.[Abstract/Free Full Text]
  2. Matsuoka S., Huang M., Elledge S. J. Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science (Wash. DC), 282: 1893-1897, 1998.[Abstract/Free Full Text]
  3. Blasina A., Van de Weyer I., Laus M. C., Luyten W. H. M. L., Parker A. E., McGowan C. H. A human homologue of the checkpoint kinase Cds1 directly inhibits Cdc25 phosphatase. Curr. Biol., 9: 1-10, 1999.[Medline]
  4. Brown A. L., Lee C. H., Schwarz J. K., Mitiku N., Piwnica-Worms H., Chung J. H. A human Cds1-related kinase that functions downstream of ATM protein in the cellular response to DNA damage. Proc. Natl. Acad. Sci. USA, 96: 3745-3750, 1999.[Abstract/Free Full Text]
  5. Chaturvedi P., Eng W. K., Zhu Y., Mattern M. R., Mishra R., Hurle M. R., Zhang X., Annan R. S., Lu Q., Faucette L. F., Scott G. F., Li X., Carr S. A., Johnson R. K., Winkler J. D., Zhou B. B. Mammalian Chk2 is a downstream effector of the ATM-dependent DNA damage checkpoint pathway. Oncogene, 18: 4047-4054, 1999.[Medline]
  6. Tominaga K., Morisaki H., Kaneko Y., Fujimoto A., Tanaka T., Ohtsubo M., Hirai M., Okayama H., Ikeda K., Nakanishi M. Role of human Cds1 (Chk2) kinase in DNA damage checkpoint and its regulation by p53. J. Biol. Chem., 274: 31463-31467, 1999.[Abstract/Free Full Text]
  7. Matsuoka S., Rotman G., Ogawa A., Shiloh Y., Tamai K., Elledge S. J. Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in vitro. Proc. Natl. Acad. Sci. USA, 97: 10389-10394, 2000.[Abstract/Free Full Text]
  8. Zhou B. B., Chaturvedi P., Spring K., Scott S. P., Johanson R. A., Mishra R., Mattern M. R., Winkler J. D., Khanna K. K. Caffeine abolishes the mammalian G2/M DNA damage checkpoint by inhibiting ataxia-telangiectasia-mutated kinase activity. J. Biol. Chem., 275: 10342-10348, 2000.[Abstract/Free Full Text]
  9. Melchionna R., Chen X. B., Blasina A., McGowan C. H. Threonine 68 is required for radiation-induced phosphorylation and activation of cds1. Nature Cell Biology, 2: 762-765, 2000.[Medline]
  10. Ahn J. Y., Schwarz J. K., Piwnica-Worms H., Canman C. E. Threonine 68 phosphorylation by ataxia telangiectasia mutated is required for efficient activation of Chk2 in response to ionizing radiation. Cancer Res., 60: 5934-5936, 2000.[Abstract/Free Full Text]
  11. Hirao A., Kong Y. Y., Matsuoka S., Wakeham A., Ruland J., Yoshida H., Liu D., Elledge S. J., Mak T. W. DNA damage-induced activation of p53 by the checkpoint kinase Chk2. Science (Wash. DC), 287: 1824-1827, 2000.[Abstract/Free Full Text]
  12. Chehab N. H., Malikzay A., Appel M., Halazonetis T. D. Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing p53. Genes Dev., 14: 278-288, 2000.[Abstract/Free Full Text]
  13. Shieh S. Y., Ahn J., Tamai K., Taya Y., Prives C. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev., 4: 289-300, 2000.
  14. Bell D. W., Varley J. M., Szydlo T. E., Kang D. H., Wahrer D. C., Shannon K. E., Lubratovich M., Verselis S. J., Isselbacher K. J., Fraumeni J. F., Birch J. M., Li F. P., Garber J. E., Haber D. A. Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome. Science (Wash. DC), 286: 2528-2531, 1999.[Abstract/Free Full Text]
  15. Sodha N., Williams R., Mangion J., Bullock S. L., Yuille M. R., Eeles R. A. Screening hCHK2 for mutations. Science (Wash. DC), 289: 359 2000.
  16. Takahashi T., Nau M., Chiba I., Birrer M., Rosenberg R., Vinocour M., Levitt M., Pass H., Gazdar A., Minna J. p53: a frequent target for genetic abnormalities in lung cancer. Science (Wash. DC), 246: 491-494, 1989.[Abstract/Free Full Text]
  17. Haruki N., Saito H., Tatematsu Y., Konishi H., Harano T., Masuda A., Osada H., Fujii Y., Takahashi T. Histological type-selective, tumor-predominant expression of a novel CHK1 isoform and infrequent in vivo somatic CHK2 mutation in small cell lung cancer. Cancer Res., 60: 4689-4692, 2000.[Abstract/Free Full Text]
  18. Hanks S. K., Quinn A. Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Methods Enzymol., 200: 38-62, 1991.[Medline]
  19. Xianglin W., Webster S. R., Chen J. Characterization of tumor-associated Chk2 mutants. J. Biol. Chem., 276: 2971-2974, 2000.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur Respir JHome page
R. M. Mroz, R. P. F. Schins, H. Li, L. A. Jimenez, E. M. Drost, A. Holownia, W. MacNee, and K. Donaldson
Nanoparticle-driven DNA damage mimics irradiation-related carcinogenesis pathways
Eur. Respir. J., February 1, 2008; 31(2): 241 - 251.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. M. Kass, J. Ahn, T. Tanaka, W. A. Freed-Pastor, S. Keezer, and C. Prives
Stability of Checkpoint Kinase 2 Is Regulated via Phosphorylation at Serine 456
J. Biol. Chem., October 12, 2007; 282(41): 30311 - 30321.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. K. Gupta, X. Guo, S. S. Durkin, K. F. Fryrear, M. D. Ward, and O. J. Semmes
Human T-cell Leukemia Virus Type 1 Tax Oncoprotein Prevents DNA Damage-induced Chromatin Egress of Hyperphosphorylated Chk2
J. Biol. Chem., October 5, 2007; 282(40): 29431 - 29440.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. Cordon-Preciado, S. Ufano, and A. Bueno
Limiting amounts of budding yeast Rad53 S-phase checkpoint activity results in increased resistance to DNA alkylation damage
Nucleic Acids Res., November 6, 2006; 34(20): 5852 - 5862.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. M. Pregueiro, Q. Liu, C. L. Baker, J. C. Dunlap, and J. J. Loros
The Neurospora Checkpoint Kinase 2: A Regulatory Link Between the Circadian and Cell Cycles
Science, August 4, 2006; 313(5787): 644 - 649.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. A. Freiberg, E. M. Hammond, M. J. Dorie, S. M. Welford, and A. J. Giaccia
DNA Damage during Reoxygenation Elicits a Chk2-Dependent Checkpoint Response.
Mol. Cell. Biol., March 1, 2006; 26(5): 1598 - 1609.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ahn, M. Urist, and C. Prives
Questioning the Role of Checkpoint Kinase 2 in the p53 DNA Damage Response
J. Biol. Chem., May 30, 2003; 278(23): 20480 - 20489.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Tsvetkov, X. Xu, J. Li, and D. F. Stern
Polo-like Kinase 1 and Chk2 Interact and Co-localize to Centrosomes and the Midbody
J. Biol. Chem., February 28, 2003; 278(10): 8468 - 8475.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Tort, S. Hernandez, S. Bea, A. Martinez, M. Esteller, J. G. Herman, X. Puig, E. Camacho, M. Sanchez, I. Nayach, et al.
CHK2-decreased protein expression and infrequent genetic alterations mainly occur in aggressive types of non-Hodgkin lymphomas
Blood, December 15, 2002; 100(13): 4602 - 4608.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ahn and C. Prives
Checkpoint Kinase 2 (Chk2) Monomers or Dimers Phosphorylate Cdc25C after DNA Damage Regardless of Threonine 68 Phosphorylation
J. Biol. Chem., December 6, 2002; 277(50): 48418 - 48426.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Konishi, T. Nakagawa, T. Harano, K. Mizuno, H. Saito, A. Masuda, H. Matsuda, H. Osada, and T. Takahashi
Identification of Frequent G2 Checkpoint Impairment and a Homozygous Deletion of 14-3-3{epsilon} at 17p13.3 in Small Cell Lung Cancers
Cancer Res., January 1, 2002; 62(1): 271 - 276.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuoka, S.
Right arrow Articles by Takahashi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuoka, S.
Right arrow Articles by Takahashi, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online