| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 [M. K., M. E. G., S. B., T. F.], and First Department of Surgery, Faculty of Medicine, Kagoshima University, Kagoshima 890-8520, Japan [T. A.]
| ABSTRACT |
|---|
|
|
|---|
v integrin on cell surfaces is required for efficient
adenovirus infection. Treatment of cells with the histone deacetylase
inhibitor FR901228 (depsipeptide) increased CAR and
v
integrin RNA levels in six cancer cell lines. Sodium butyrate and
trichostatin A, other histone deacetylase inhibitors, caused similar
increases. Cells treated with FR901228 prior to infection had a
410-fold increase in transgene expression from a
ß-galactosidase-expressing adenoviral vector. These studies
suggest that FR901228 increases the efficiency of adenoviral transgene
expression and may be useful in cancer gene therapy. | Introduction |
|---|
|
|
|---|
v integrin component of integrins
vß3 or
vß5 on the cell
surface to infect cells efficiently (1, 2, 3)
. CAR mediates
attachment of adenovirus to cells, and
v
integrin mediates internalization of virus into cells. Several studies
have correlated CAR levels and adenovirus attachment, infection, or
transgene expression (4
, 5)
, whereas others have indicated
a correlation of
v integrin expression with
adenoviral infection (6)
. Different strategies have been
used to alter adenovirus so that infection occurs through
non-CAR-mediated mechanisms. Although some of these strategies were
developed to target adenovirus to particular cell types, many were done
to circumvent low CAR levels (7)
. An alternative approach
is to up-regulate CAR and/or
v integrin levels
(8)
. This study describes a method for increasing both CAR
and
v integrin levels using the histone
deacetylase inhibitor FR901228, a drug currently in Phase II clinical
trials (9
, 10)
. | Materials and Methods |
|---|
|
|
|---|
Cell Lines.
Six human cancer cell lines were used: a follicular thyroid carcinoma
FTC 236; an anaplastic thyroid carcinoma SW-1736; a colon carcinoma
SW620; a renal cell carcinoma A498; a breast carcinoma MCF 7; and a
hepatic cell carcinoma HepG2.
Adenovirus.
The Ad5.CMV-LacZ is an E1 and E3
gene-deleted, replication-defective type 5 adenovirus obtained
from Qbiogene (Carlsbad, CA). Virus was grown in 293A cells according
to protocols from the manufacturer. The AdCMVßgal virus was purified,
and the titer was determined by the TCID50 assay
as described by the manufacturer.
PCR Amplification of CAR and
v Integrin.
RT-PCR for CAR and
v integrin was performed
using total RNA extracted with the RNeasy Mini kit (Qiagen, Valencia,
CA). Single-stranded oligo(dT)-primed cDNA was generated from 1 µg of
RNA in a 20-µl reaction using Moloney murine leukemia virus reverse
transcriptase (Life Technologies, Inc., Rockville, MD). Oligonucleotide
primers, used for analysis of human CAR (1)
and
v integrin (11)
expression, were:
CAR 5' (sense),
419GCCTTCAGGTGCGAGATGTTAC440
and CAR 3' (antisense),
1031TCTAAGTCGAATGGGTGCGA1050;
v integrin 5' (sense),
1567TAAAGGCAGATGGCAAAGGAGT1588
and
v integrin 3'
(antisense),
2036CAGTGGAATGGAAACGATGAGC2057.
The amplification reaction was carried out with 1 µl of the cDNA product for 30 cycles, and each cycle consisted of 94°C for 20 s, 64°C for 30 s, and 72°C for 1 min, followed by a final 10-min elongation at 72°C. Comparability of RNA quantities was assured using ß-actin as an internal standard. Oligonucleotide primers for human ß-actin amplification were (GenBank Accession Number XM_004814): ß-actin 5' (sense), 207TGGGCATGGGTCAGAAGGAT226 and ß-actin 3' (antisense), 488GAGGCGTACAGGGATAGCAC507.
AdCMVßgal Transduction.
Control cells or cells (104) treated with 1 ng/ml
FR901228 for 72 h were plated on round coverglass in 24-well
plates. Cells were transduced with a multiplicity of infection of 100
of AdCMVßgal in medium without serum for 1 h; serum was added,
and the cells were grown for 48 h. Adenovirus transgene expression
was determined using the ß-Gal Staining kit (Invitrogen, Carlsbad,
CA), and ß-galactosidase-positive cells were counted from three
non-overlapping fields.
Protein Collection and Western Blot Analysis.
The procedures for nuclear protein isolation and Western blot analysis
have been described previously (12)
. Ten µg of protein
were separated on an 11% SDS-PAGE gel and transferred to Immobilon-P
transfer membrane (Millipore, Bedford, MA). The membrane was incubated
for 30 min with either a rabbit polyclonal antibody against acetylated
histone H3 or a rabbit polyclonal antibody against histone H3 (Upstate
Biotechnology, Lake Placid, NY) diluted 1:2000 in 5% milk. After
washing, antirabbit immunoglobulin horseradish peroxidase-linked
secondary antibody (Amersham Pharmacia Biotech, Piscataway, NJ) was
added and incubated for 30 min. After washing, the membrane was
developed in ECL Western blotting detection reagents (Amersham
Pharmacia Biotech, Piscataway, NJ).
| Results |
|---|
|
|
|---|
|
v integrin was also increased by exposure to
FR901228.
|
v integrin expression, we sought to
determine whether this increase would result in enhanced transgene
expression after adenovirus infection. To do this, the experiments
shown in Fig. 3
|
v integrin RNA levels and resulted in marked
enhancement of transgene expression after adenovirus infection. Because
FR901228 is a known inhibitor of histone deacetylase, we sought to
determine whether inhibition of histone deacetylation might be the
mechanism responsible for this phenomenon. Fig. 4A
v integrin
RNA expression in Fig. 4B
v integrin occurred as a
result of inhibition of histone deacetylase.
|
| Discussion |
|---|
|
|
|---|
v integrin and is associated with enhanced
adenoviral transgene expression after infection.
FR901228 is a histone deacetylase inhibitor (10)
. Our
studies indicate that incubation with as little as 1 ng/ml FR901228
increases histone H3 acetylation. Our studies with sodium butyrate
(16)
and trichostatin A (17)
, two other
histone deacetylase inhibitors, suggest the mechanism by which FR901228
induces CAR and
v integrin expression is by
inhibition of histone deacetylase. A recent report with bladder cancer
cell lines indicates that sodium butyrate can increase the level of CAR
in cell lines with low levels of expression (18)
. It
should be noted that inhibition of histone deacetylase does not cause
transcriptional activation of all genes but only a small percentage of
genes (19)
.
The levels of CAR expression in human tumors are low (20)
.
The results presented in this study suggest that the use of FR901228
could result in an increase in CAR and
v
integrin expression in cancer cells, making them more susceptible to
adenovirus gene therapy. Ongoing clinical trials using FR901228 have
documented serum levels as high as 500 ng/ml. Although FR901228 is
highly protein bound, the free drug concentration exceeds 50
ng/ml.3
Thus, the effective drug concentration used in these in
vitro studies is well within the range currently administered to
patients. Furthermore, it should be possible to administer FR901228
ex vivo. Thus, the use of FR901228 may enhance the efficacy
of a variety of gene therapy strategies.
In summary, we have demonstrated that nontoxic doses of FR901228, a
histone deacetylase inhibitor, can result in marked increases in
expression of CAR and
v integrin in cancer
cells. This increase mediates enhanced transgene expression after
adenovirus infection. These studies suggest a simple, clinically
practical method for increasing the sensitivity of tumor cells to
adenoviral gene therapy vectors.
| FOOTNOTES |
|---|
1 To whom requests for reprints should addressed,
at Center for Cancer Research, National Cancer Institute, Building 10,
Room 12C103, MSC 1910, 9000 Rockville Pike, Bethesda, MD 20892. Phone:
(301) 496-2631; Fax: (301) 402-1608; E-mail: tfojo{at}helix.nih.gov ![]()
2 The abbreviations used are: CAR, coxsackie and
adenovirus receptor; CMV, cytomegalovirus; ßgal, ß-galactosidase;
RT-PCR, reverse transcription-PCR. ![]()
3 M. Kang, W. D. Figg, and S. E. Bates,
unpublished observations. ![]()
Received 5/10/01. Accepted 7/18/01.
| REFERENCES |
|---|
|
|
|---|
vß3 and
vß5 promote adenovirus internalization but not virus attachment.. Cell, 73: 309-319, 1993.[Medline]
vß3 and
vß5 on human monocytes and T lymphocytes facilitates adenovirus-mediated gene delivery.. J. Virol., 69: 2257-2263, 1995.[Abstract]
This article has been cited by other articles:
![]() |
Y. Sasaki, H. Negishi, M. Idogawa, H. Suzuki, H. Mita, M. Toyota, Y. Shinomura, K. Imai, and T. Tokino Histone deacetylase inhibitor FK228 enhances adenovirus-mediated p53 family gene therapy in cancer models Mol. Cancer Ther., April 1, 2008; 7(4): 779 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Goldsmith, A. Aguila, K. Steadman, A. Martinez, S. M. Steinberg, M. C. Alley, W. R. Waud, S. E. Bates, and T. Fojo The histone deacetylase inhibitor FK228 given prior to adenovirus infection can boost infection in melanoma xenograft model systems Mol. Cancer Ther., February 1, 2007; 6(2): 496 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Keriel, C. Rene, C. Galer, J. Zabner, and E. J. Kremer Canine Adenovirus Vectors for Lung-Directed Gene Transfer: Efficacy, Immune Response, and Duration of Transgene Expression Using Helper-Dependent Vectors J. Virol., February 1, 2006; 80(3): 1487 - 1496. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Lacher, M. I. Tiirikainen, E. F. Saunier, C. Christian, M. Anders, M. Oft, A. Balmain, R. J. Akhurst, and W. M. Korn Transforming Growth Factor-{beta} Receptor Inhibition Enhances Adenoviral Infectability of Carcinoma Cells via Up-Regulation of Coxsackie and Adenovirus Receptor in Conjunction with Reversal of Epithelial-Mesenchymal Transition Cancer Res., February 1, 2006; 66(3): 1648 - 1657. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Reddy, W. S. Tsai, M. F. Ziauddin, J. Zuo, G. W. Cole Jr, J. B. Maxhimer, B. Fang, D. S. Schrump, and D. M. Nguyen Cisplatin enhances apoptosis induced by a tumor-selective adenovirus expressing tumor necrosis factor-related apoptosis-inducing ligand J. Thorac. Cardiovasc. Surg., December 1, 2004; 128(6): 883 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Gu, A. Ogose, H. Kawashima, M. Ito, T. Ito, A. Matsuba, H. Kitahara, T. Hotta, K. Tokunaga, H. Hatano, et al. High-Level Expression of the Coxsackievirus and Adenovirus Receptor Messenger RNA in Osteosarcoma, Ewing's Sarcoma, and Benign Neurogenic Tumors among Musculoskeletal Tumors Clin. Cancer Res., June 1, 2004; 10(11): 3831 - 3838. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-C. Pong, Y.-J. Lai, H. Chen, T. Okegawa, E. Frenkel, A. Sagalowsky, and J.-T. Hsieh Epigenetic Regulation of Coxsackie and Adenovirus Receptor (CAR) Gene Promoter in Urogenital Cancer Cells Cancer Res., December 15, 2003; 63(24): 8680 - 8686. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Goldsmith, M. Kitazono, P. Fok, T. Aikou, S. Bates, and T. Fojo The Histone Deacetylase Inhibitor FK228 Preferentially Enhances Adenovirus Transgene Expression in Malignant Cells Clin. Cancer Res., November 1, 2003; 9(14): 5394 - 5401. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Qin, S. Chen, T. Yu, B. Escuadro, S. Sharma, and R. K. Batra Coxsackievirus Adenovirus Receptor Expression Predicts the Efficiency of Adenoviral Gene Transfer into Non-Small Cell Lung Cancer Xenografts Clin. Cancer Res., October 15, 2003; 9(13): 4992 - 4999. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Anders, C. Christian, M. McMahon, F. McCormick, and W. M. Korn Inhibition of the Raf/MEK/ERK Pathway Up-Regulates Expression of the Coxsackievirus and Adenovirus Receptor in Cancer Cells Cancer Res., May 1, 2003; 63(9): 2088 - 2095. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hemminki, A. Kanerva, B. Liu, M. Wang, R. D. Alvarez, G. P. Siegal, and D. T. Curiel Modulation of Coxsackie-Adenovirus Receptor Expression for Increased Adenoviral Transgene Expression Cancer Res., February 15, 2003; 63(4): 847 - 853. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kitazono, V. K. Rao, R. Robey, T. Aikou, S. Bates, T. Fojo, and M. E. Goldsmith Histone deacetylase inhibitor FR901228 enhances adenovirus infection of hematopoietic cells Blood, March 15, 2002; 99(6): 2248 - 2251. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |