| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Division of Gastroenterology [Y. S., O. G. O., A. A., A. K. R.], Cancer Center [W. E-D., A. K. R.], Department of Genetics [W. E-D., A. K. R.], Abramson Family Cancer Research Institute [Y. S., O. G. O., A. K. R.], Howard Hughes Medical Institute [T. C. B., W. E-D.], University of Pennsylvania, Philadelphia, Pennsylvania 19104-6144; Harvard School of Dental Medicine, Boston, Massachusetts 02115 [D. T. W.]; and University of Freiburg, Freiburg, 79106 Germany [O. G. O.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Recently, information has emerged about p53 homologues, such as p73 and
p63 (3, 4, 5)
, with the emphasis on p63 in this study. Cloned
through degenerate PCR, p63 is expressed in the squamous epithelium and
the thymus (6)
and other tissues as well (7)
.
P63 has different transcripts attributable to alternative splicing
(
,ß, 
), and the use of different promoters results in retention
of the
TA4
or 
N (4
, 8
, 9)
. Thus, these p63 isoforms are referred
to as TAp63,ß, and N,ß, . All p63 isoforms contain
DNA binding and hetero-oligomerization domains. However, the Np63
versions lack the NH2-terminal transactivation
domain but can still bind to DNA and, thus, may function as dominant
negative proteins.
The TAp63 and TAp63ß transactivate promoters at levels comparable
with WT p53, but TA-63 does not contain this property (reviewed in
Ref. 3
). In particular, TAp53 can activate in
vitro p53 responsive promoters such as p21, GADD45, Bax, and mdm2
(reviewed in Refs. 8
and 10
). TAp63 and
TAp63ß induce apoptosis in transient transfection experiments in
contrast to TA-p63 (3
, 4
, 6
, 11)
. TAp63 can be
induced after UV irradiation (12)
. By contrast, the N
isoforms block the functions of p53. This may be attributable to
competition for DNA binding sites to prevent p53 or TAp63 from binding
DNA. Alternatively, it is conceivable that p53 or TAp63 may be
sequestered by Np63 through the oligomerization domain or another
domain (13)
. Precedence for interactions between p53
family members has been established with the observation that mutant
p53 can down-regulate both p63 and p73 through a direct interaction
with the p53 core domain (14)
.
There is little evidence to suggest that p63 acts as a tumor suppressor gene. Mutations of p63 in human tumors are exceedingly rare (3 , 5 , 8 , 9 , 15) . Patients with germ-line mutations in the DNA binding domain of p63 result in developmental defects but not tumors (16) . Additional insights into the functions of p63 have been gained through the generation and characterization of mice in which p63 has been ablated in embryonic stem cells through homologous recombination. p63-null mice are viable at birth but die several h later and are not susceptible to spontaneous tumorigenesis (17 , 18) . Mutant newborn mice and late stage embryos have craniofacial abnormalities, limb truncations, and a complete absence of epidermis and related appendages (17 , 18) . Histological analysis has revealed the absence of a stratified epithelium in the epidermis with a lack of the characteristic structure of basal, suprabasal, and cornified layers as well as hair follicles. Instead of an epidermis, p63-/- late stage embryos retain isolated patches of epithelial cells along the exposed dermis. Furthermore, the normally stratified squamous epithelium of tongue, esophagus, and forestomach, with the same characteristic structure of basal, suprabasal, and differentiated cells, was replaced by an unusual array of cuboidal, goblet-like epithelium.
Given that p63 appears to be important for the development and possibly also differentiation of the stratified squamous epithelium, we postulated that p63 may have a critical role in the maintenance of the oral-esophageal squamous epithelium by compensating for the loss of p53 in p53-deficient mice.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Np63:
Np63 5'ATGTTGTACCTGGAAAACAA and 5'CACTCCCCCTCCTCTTTGA
Np63 5'ATGTTGTACCTGGAAAACAA and 5'CTATGGGTACACTGATCGGT.
The Np63 PCR product was 1761 bp, and the one for Np63 was
1182 bp. These fragments were amplified using the Elongaze enzyme mix
(Life Technologies, Inc.). After denaturing at
94oC for 60 s, PCR consisted of 35 cycles
of 94oC for 60 s,
55oC for 60 s, and
72oC for 60 s followed by
72oC for 5 min. PCR products were then analyzed
on a 1% agarose gel. Nested PCR was then performed using the above
Np63 and Np63 primers tagged with XhoI and the
ß-actin Kozak consensus motif at the 5' prime end and NotI
at the 3' end. Nested PCR products were then subcloned into a
pCIBA vector and purified by the alkaline lysis method. The p21
promoter-luciferase reporter gene constructs used were for WT p21
(WWP-Luc) and when the p53 DNA binding sites were mutated in the
context of the full-length p21 promoter (6-Luc).
Cell Culture and Transient Transfection.
Mouse oral epithelia from WT and p53-null mice were peeled off
underlying tissues after incubation with 1.5 units/ml Dispase
I (Boehringer Mannhem). Subsequently, the tissues were
trypsinized. The cell suspension from the latter was plated and
subcultivated in serum-free medium (Life Technologies, Inc.). The mouse
oral epithelial cells or keratinocytes from WT or normal (Mokn) and
p53-null mice (Mokp53-/-) were transiently
transfected at 80% confluence with 0.5–1 µg of plasmid mixtures
preincubated with 12 µl of Plus Reagent and 16 µl of LipofectAMINE
Reagent (Life Technologies, Inc.). Cells were transfected with either
WWP-Luc or 6-Luc and ß-Gal constructs as well as with the Np63
or Np63 constructs. The cells were incubated for 36 h at
37°C and then washed with PBS and harvested with Reporter lysis
buffer (Promega). Luciferase and ß-Galactosidase assays were
performed. All experiments were performed in triplicate, and at least
three independent experiments were done (results expressed as mean +/-
SD).
TaqMan RT-PCR Assay.
TaqMan RT-PCR assay was conducted according to the manufacturer‘s
instructions (PE Applied Biosystems). In brief, oligonucleotides
(probes) for TaqMan RT-PCR were labeled with FAM(6-carboxyfluorescein;
p21, bax) or VIC (GAPDH) and 3' prime quencher, TAMRA. The following
primer and probe sequences were used:
p21 primers: 5'-CGAGAACGGTGGAACTTTGAC-3' and 5'-TCCCAGACGAAGTTGCCCT-3'
p21 probe: 6FAM-TCGTCACGGAGACGCCGCTG-TAMRA
Bax primers: 5'-GGAGCAGCTTGGGAGCG-3' and 5'-AAAAGGCCCCTGTCTTCATGA-3'
Bax probe: 6FAM-CGGGCCCACCAGCTCTGAACA-TAMRA.
GAPDH primers and the Vic-labeled probe were obtained from PE Applied Biosystems. All primers and probes were designed with the use of Primer Express Version 1.0 (PE Applied Biosystems). Total RNA was isolated from tongue and esophageal epithelia of WT and p53-null mice using the TRIzol method. Total RNA (1 µg) was used for reverse transcription and amplification using TaqMan Reverse Transcription Reagents according to manufacturer’s protocol (PE Applied Biosystems). A master mix of TaqMan reagents was prepared, and 10 ng of each reverse transcription sample was used in the TaqMan PCR reaction. Each tube contained both a gene probe and primers and a GAPDH control probe and primer. Each sample was done in quadruplicate. Reactions in which reverse transcriptase was not added to the reverse transcription reaction were used to control for genomic contamination. The increase in fluorescence was proportional to the concentration of template in the PCR. The standard curve method was used to quantitate amounts of each gene relative to the GAPDH amount in each reaction according to the manufacturer’s protocol (PE Applied Biosystems). Reactions were carried out in 96-well plates using the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems).
Histology and Immunohistochemistry.
Age-matched (4–5 months), WT, and p53-deficient mice littermates from
the same BL/6 background strain were sacrificed. Oral-esophageal
tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and
tissue sections were stained with H&E in a manner similar to our
previous studies (19)
. Immunohistochemical staining was
performed in mouse tongue and esophageal tissue sections by the ABC
method using the Vectastain Elite ABC kit (Vector Laboratories) as
described previously (20)
. Sections (3–5 µm) were
mounted on adhesive-coated slides, deparaffinized, and rehydrated
through xylene and alcohol. After rinsing in tap water and PBS, slides
were placed in plastic Coplin jars containing 10 mM citrate
buffer. Jars were covered with loose-filling caps and heated in the
microwave oven for 20 min to unmask antigen. Endogenous peroxidase was
blocked with 3% H2O2 in
methanol for 5 min. Sections were blocked with either 5% rabbit serum
or protein blocking agent (Immunotech) for 15 min after being cooled.
Slides were then incubated with primary antibody (4A4 for full-length
p63 and Ab-1 for Np63 from PharMingen and Oncogene Science,
respectively) overnight at 4°C, washed in PBS, and incubated with the
corresponding biotinylated secondary antibody for 60 min at room
temperature. After PBS washes, sections were incubated with ABC Elite
reagent for 5 min at room temperature, and reaction products were
developed using diaminobenzidine tetrahydrochloride (Sigma Chemical
Co.) as chromogen and counterstained with hematoxylin.
Three x40 power fields were counted on each slide. The positively stained nuclei were counted and divided by the total number of nuclei per high power field, and a mean was calculated. Of note, cytoplasmic staining was rare. Two independent scorers were blinded to the slide source when doing the evaluation. Student’s t test was used for statistical analysis, and P < 0.05 was considered statistically significant. Additionally, staining intensity was designated from 1–3, where 1 is weak, 2 is moderate, and 3 is strong based upon similar qualitative approaches described previously (20) .
Western Blot Analysis.
The tongue or esophageal mucosa was immediately dissected away from the
muscularis propria after incubation in 1.5 units/ml Dispase
I (Boehringer Mannheim) overnight at 4°C. The epithelium was
pealed off with forceps, minced, and lysed in ELB buffer [50
mM HEPES (pH 7.4), 0.1% NP-40, and 250
mM NaCl] with protease inhibitors (5 µg/ml
aprotinin, 100 µg/ml phenylmethane sulfonyl fluoride, and 5 µg/ml
leupeptin) and phosphatase inhibitors (5 µg/ml sodium vanadate and 10
mM sodium fluoride) for 45 min on ice. The
lysates were centrifuged at 13,000 rpm at 4°C for 15 min, and
supernatants were collected. Total protein (10 µg) of each sample was
separated on a 10% SDS-polyacrylamide gel. After electrophoresis,
proteins were transferred to Immobilon membranes (Millipore) at 100 V
for 1 h at 4°C. Blocking was performed in 5% milk, 10
mM Tris pH 7.4, 150 mM
NaCl, and 0.2% Tween 20 overnight at 4°C. Primary antibody against
p63 (D20 for TAp63 and N16 for Np63; Santa Cruz Biotechnology, Santa
Cruz, CA) was used at a 1:2,000 dilution. Secondary antibody was
peroxidase conjugated sheep antigoat immunoglobulin (1:2,000 dilution;
Sigma Chemical Co.). The detection system was enhanced
chemiluminescence (Amersham). Equal loading of proteins was confirmed
by Ponceau S staining of the membranes and reprobing the membranes with
an actin antibody.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
N) versions of p63, respectively. The antibodies do not cross-react
with each other but do recognize the ,ß and isoforms for their
respective TAp63 or Np63 proteins. This analysis led to the
determination that both TAp63 and Np63 are expressed
in oral-esophageal epithelia of WT and p53-null mice (Table 1
; Figs. 1
and 2
). Additionally, there is increased expression
of both TAp63 and Np63 in the oral-esophageal epithelia of p53-null
mice when compared with their age-matched WT littermates, in a
statistically significant fashion (Table 1)
. There also appears to be
predominance of TAp63 in basal cells compared with Np63 in this
compartment (Figs. 1
and 2)
. Furthermore, the intensity of p63
staining, a qualitative parameter, appears to be enhanced in
p53-null mice compared with their WT counterparts (Figs. 1
and 2)
.
Np63 staining intensity was moderate to high in tongues and esophagi
of p53-null mice compared with weak in WT mice. TAp63 showed a moderate
to high staining intensity in the same tissues of p53-null mice
compared with a weak to moderate staining intensity in WT mice.
|
|
|
. It is possible that the molecular mass corresponding to p63
represents posttranslational modifications and/or recognition of
different isoforms as observed by others (7)
. Np63
expression was also increased in oral (4x) and esophageal (3x)
esophageal epithelial cells from p53-null mice compared with WT mice
(Fig. 3)
.
|
and 5)
. Additionally, the expression level of p21 as well as Bax mRNA in
p53-null esophagus was 2-fold higher when compared with that of WT
esophagus (Figs. 4
and 5)
.
|
|
Np63, and Np63 suppress
p21-mediated transactivation in WT or normal oral keratinocytes, in
contrast to WT p53 (Fig. 6)
. However, in p53-null oral
keratinocytes, WT p53 transactivates the p21 promoter, but Np63
no longer suppresses the p21 promoter (Fig. 6)
. Dominant-negative
p53 and Np63 retain their abilities to suppress the p21 promoter
in a p53-null background. These results suggest there may be functional
differences between Np63 and Np63 in transactivation of the
p21 promoter.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Recently, analysis of p73-null mice revealed unique roles for p73 in neurogenesis, sensory pathways, and homeostatic control (13 , 14) . p63 is relatively tissue restricted, and targeted disruption through homologous recombination in mice leads to a dramatic phenotype, part of which is consistent with a critical role in squamous epithelial cell development (17 , 18) . Functionally, p63 can bind to p53-DNA binding sites in vitro and can activate transcription of p53-responsive promoters.
Whereas p53 family members have distinctive roles, they also have
physiological and functional overlapping features. To elucidate how p63
and p53 may be complementary in oral-esophageal squamous epithelial
cells, we used a comparison of p53-null and WT mice. Both TAp63 and
Np63 are present in the oral-esophageal epithelia with increased
expression and staining intensity in p53-null mice compared with
age-matched WT littermates. Our data provide evidence for the
coexistence of TAp63 and Np63 in basal and suprabasal cells,
suggesting a dynamic interplay in their homeostatic control of
differentiation (21)
. It is possible that TAp63 serves as
a positive regulator of the switch from proliferating basal cells to
differentiating suprabasal cells through the transactivation of p21 and
bax. Indeed, p63 has been suggested to be a "marker" of stem or
progenitor cells in the basal cell compartment (22)
. By
contrast, Np63 may contribute to the equilibrium between
proliferation and differentiation by virtue of its potential
dominant-negative function in modulating promoters such as p21 and
bax. Interestingly, this may not be true for all Np63 isoforms in
that our data suggest differences between Np63 and Np63 in
modulating p21 promoter activity in oral keratinocytes derived from WT
and p53-null mice. Additionally, whereas we find that p21 and bax are
expressed in a p53-null background by the TaqMan assay, we can only
infer their transactivation in vivo by TAp63 which is either
not effectively opposed by Np63, or alternatively, Np63 acts to
counterbalance even greater TAp63-mediated transactivation of p21 and
bax than is detectable. In either context, the expression of p21 and
bax in the oral-esophageal epithelia in a p53-null background may help
to explain the lack of dysplasia or cancer in these tissues.
In summary, the p53-null mice provide an excellent model in which to study the role of p63 in oral-esophageal squamous epithelia given the importance of p63 in the development and differentiation of squamous epithelia.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by NIH Grant P01 DE12467 (to
A. K. R., D. W., Y. S., and O. G. O.), the Leonard and Madlyn
Abramson Family Cancer Research Institute at the University of
Pennsylvania Cancer Center (to A. K. R.), and Grant N01-CN-95112-72
(to A. K. R.). 
2 Y. S. and O. G. O. contributed equally to the
work.
3 To whom requests for reprints should be
addressed, at 600 CRB, Division of Gastroenterology, University of
Pennsylvania, 415 Curie Boulevard, Philadelphia, PA 19104-6144. Phone:
(215) 898-0154; Fax: (215) 572-5412; E-mail: anil2{at}mail.med.upenn.edu
4 The abbreviations used are: TA, acidic
NH2 terminus; N, truncated NH2 terminus;
RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; TAMRA, 6-carboxyl-N,N,N',N'-tetramethylrhodamine; ABC,
avidin-biotin peroxidase complex; WT, wild type.
Received 3/21/00. Accepted 6/21/01.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and Np63 in normal and neoplastic cells.. Carcinogenesis (Lond.), 21: 153-160, 2000.This article has been cited by other articles:
|
|
 |
|
  M. Takaoka, C. E. Smith, M. K. Mashiba, T. Okawa, C. D. Andl, W. S. El-Deiry, and H. Nakagawa EGF-mediated regulation of IGFBP-3 determines esophageal epithelial cellular response to IGF-I Am J Physiol Gastrointest Liver Physiol, February 1, 2006; 290(2): G404 - G416. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. K. Wong, M. Fricker, A. Wyttenbach, A. Villunger, E. M. Michalak, A. Strasser, and A. M. Tolkovsky Mutually Exclusive Subsets of BH3-Only Proteins Are Activated by the p53 and c-Jun N-Terminal Kinase/c-Jun Signaling Pathways during Cortical Neuron Apoptosis Induced by Arsenite Mol. Cell. Biol., October 1, 2005; 25(19): 8732 - 8747. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P.T. Higgins, L. Wang, N. Kambham, K. Montgomery, V. Mason, S. U. Vogelmann, K. V. Lemley, P. O. Brown, J. D. Brooks, and M. van de Rijn Gene Expression in the Normal Adult Human Kidney Assessed by Complementary DNA Microarray Mol. Biol. Cell, February 1, 2004; 15(2): 649 - 656. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
