
[Cancer Research 61, 6480-6486, September 1, 2001]
© 2001 American Association for Cancer Research
Molecular Biology and Genetics |
MLL-ENL Causes a Reversible and myc-dependent Block of Myelomonocytic Cell Differentiation1
Silke Schreiner,
Marco Birke,
María-Paz García-Cuéllar,
Olaf Zilles,
Johann Greil and
Robert Karl Slany2
Department of Genetics, University Erlangen, 91058 Erlangen [S. S., M. B., M-P. G-C., O. Z., R. S.], and Childrens Hospital, University Tübingen, 72076 Tübingen [J. G.], Germany
 |
ABSTRACT
|
|---|
The translocation t(11;19) is a recurrent feature of a subgroup of acute
leukemiasoccurring in infants. This event fuses the genes MLL and
ENL and creates the leukemogenic oncoprotein MLL-ENL. We
studied the effect of retroviral MLL-ENL expression in primary mouse
hematopoietic cells and show here that MLL-ENL requires the oncoprotein
Myc to establish a reversible differentiation arrest of a
myelomonocytic precursor population. MLL-ENL-transduced cells
proliferated as immature myeloid cells in the presence of
interleukin 3. The addition of granulocyte colony-stimulating
factor reversed the maturation block set by MLL-ENL and induced the
development of mature granulocytes and macrophages accompanied by
growth arrest. Gene expression analysis indicated a down-regulation of
the proto-oncogene c-myc and of several
c-myc target genes during granulocyte colony-stimulating
factor-mediated differentiation. The role of c-myc in
the MLL-ENL transformation pathway was tested by modulating the
effective Myc protein concentrations in MLL-ENL transduced cells.
Cotransduction of dominant-negative Myc neutralized the MLL-ENL effect
and precluded transformation. In contrast, constitutive expression of
Myc cooperated with MLL-ENL and caused the transformation of a cell
population with an irreversible maturation arrest.
 |
INTRODUCTION
|
|---|
The common denominator of the majority of acute leukemias in the
early infant age is a chromosomal aberration at the locus 11q23 (for a
review see (1
, 2)
. The most frequently observed genetic
lesion is a reciprocal translocation that fuses 11q23 to more than 40
known different partner loci distributed over the whole genome
(3)
. Interestingly, translocations involving 11q23 are
also prevalent in secondary leukemias that arise after the treatment of
primary neoplastic diseases with chemotherapeutic agents that inhibit
topoisomerase II (4)
. Despite this shared genetic feature
and contrary to many other translocation-associated leukemia the
clinical manifestation of 11q23 translocation-bearing leukemias can be
lymphoid, myeloid, or even biphenotypic with markers of both lineages.
The latter fact lead to the speculation that the primary target of an
11q23 abnormality is a multipotential hematopoietic precursor cell that
gives rise to leukemias in which subsequent myeloid or lymphoid
progenitors are blocked in development.
On the molecular level, 11q23 aberrations affect the mixed lineage
leukemia gene (MLL, also called HRX or
ALL-1). MLL codes for a large 3968-amino-acid
protein with limited but significant homology to the
Drosophila epigenetic regulator trithorax (trx;
5, 6, 7, 8
). In the fruit fly, TRX is required to maintain, but
not to initiate, the expression pattern of the homeobox group genes
that control the body plan (9)
. TRX is believed to act by
establishing an open state of chromatin that enables transcription of
its target genes. Knockout studies in mice suggest a similar function
also for MLL (10, 11, 12)
. In vitro assays
studying the hematopoietic capability of either
MLL-/- embryonic stem cells or
MLL-/- fetal liver cells demonstrated an
essential role for MLL in hematopoiesis (13
, 14)
. All
cloned 11q23 translocations consistently combine the 5' portion of the
MLL gene in frame with the corresponding fusion partners.
The translation of the respective chimeric RNAs yields fusion proteins
with novel combinations of functional domains. MLL contributes two DNA
binding motifs that recognize DNA without strict sequence specificity:
the AT-hooks and the CXXC or methyltransferase domain. The role
of the respective fusion partners is less clear. There is no apparent
unifying feature among the 21 fusion partners cloned to date, except
that several of them are either directly or indirectly involved in
transcriptional activation. The three most frequent fusion partners
AF4, AF9, and ENL [t(4;11), t(9;11), t(11;19)] contain transactivator
domains (15
, 16)
and, consequently, it has been shown that
the fusion protein MLL-ENL is a pleiotropic transcriptional
transactivator when tested in transient reporter gene assays
(17)
.
Despite substantial sequence information about MLL and its fusion
partners, the molecular mechanisms of hematopoietic cell transformation
by MLL fusion proteins remain elusive. Two studies demonstrate the
fundamental capability of the translocation products MLL-ENL
[t(11;19)] and MLL-AF9 [t(9;11)] to act as leukemogenic
proto-oncogenes. Retroviral transduction of primary mouse hematopoietic
precursor cells with a virus expressing MLL-ENL immortalized
myelomonocytic precursors. These cells were able to elicit a myeloid
leukemia on reintroduction into mice. However, MLL-ENL-induced
leukemias were only observed after a prolonged latency period of
3
months (18)
. In a second study, a translocation t(9;11)
was reconstructed at the chromosomal level by a "knock-in"
strategy. Modified ES cells were used to generate chimeric mice and the
animals were followed in their hematopoietic development. Although an
expanded myeloid cell population derived from cells carrying the
knock-in allele was detectable shortly after birth, these mice finally
succumbed to mostly myeloid leukemias after a latency period of more
than 4 months (19
, 20)
. Surprisingly, a fusion of
MLL with the bacterial lacZ gene was able to
cause similar myeloid leukemias in this system. Notably, in the case of
MLL-lacZ expression, the elapsed latency period before the appearance
of overt leukemias was approximately twice as long as that observed
after expression of the authentic fusion protein MLL-AF9
(21)
. The use of a model with additional uncontrolled
genetic alterations accumulating during the life span of the animals
makes an investigation of the progression toward full leukemia
difficult. Therefore, the immediate consequence of MLL fusion protein
expression on cell physiology as well as the nature of potentially
cooperating oncogenes is unclear.
In this study, we used a retroviral transduction approach to
investigate the direct effects of MLL-ENL on the development of primary
hematopoietic cells. We show here that a block in myelomonocytic
development caused by MLL-ENL is dependent on the proto-oncogene
c-myc, and that it is readily reversible. Hematopoietic
progenitors transformed by MLL-ENL are growth factor dependent and
apoptosis competent, and a normal genetic program of cell
differentiation can be induced by
G-CSF.3
A suppression of Myc activity precludes transformation by
MLL-ENL, whereas an ectopic expression of Myc cooperates with
the fusion protein. The consequences of these findings for the etiology
of leukemias with MLL rearrangements are discussed.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture, Media, Growth Factors.
The ecotrophic packaging cell line Phoenix was obtained from Gary Nolan
(Stanford, CA). The maintenance of Phoenix cells is outlined on the
world wide
web.4
Mouse recombinant growth factors (Strathmann Biotech, Hannover,
Germany) were added at the following standard concentrations: IL-3,
IL-6, G-CSF, GM-CSF at 10 ng/ml medium; SCF at 100 ng/ml medium.
Drug selection was performed in 1 mg /ml G418 (Life Technologies, Inc.)
and/or 0.5 µg/ml puromycin (Calbiochem, CA). MethoCult (M3234) medium
was from Stem Cell Technologies (Vancouver, BC, Canada).
DNA Manipulation and Plasmid Generation.
Genomic DNA was purified according to standard methods
(22)
. For retroviral transductions, all cDNAs were
inserted into either the retroviral vector pMSCV-neo or
pMSCV-pac (23)
. The cDNAs of the human
c-myc gene and the dominant-negative c-myc mutant
lacking the amino acids 40178 of the Myc transactivation domain
(
Myc) were a gift from D. Eick (24
, 25)
.
RT-PCR, and cDNA Arrays.
Polyadenylated messenger RNA for RT-PCR was purified by oligo
d(T) chromatography on latex beads (Oligotex; Quiagen Inc) according to
the manufacturers instructions. Primers used for RT-PCR of
MLL-ENL, Myc, and
Myc were: MLL forward (gcaaacagaaaaaagtggctccccg)
and ENL reverse (accatccagtcgtgagtgaacccct); myc forward
(cctagtgctgcatgaggggacac) and myc reverse (gcaccagagtttcgaagctgttc);
and
Myc forward (ctcgatcctccctttatccagcc) and
Myc reverse
(cctcatcttcttgttcctcctcag). The cDNA array analysis was done with the
ATLAS mouse cDNA expression array (version 1) from Clontech. The
evaluation of the hybridization results was performed with the Clontech
Atlas Image analyzer software.
Virus Production and Retroviral Transduction of Mouse Primary
Hematopoietic Cells.
High titer retrovirus supernatants were produced by transient
transfection of the packaging cell line Phoenix-E by a standard
calcium-phosphate precipitation method (22)
. The viral
titers were in the range of 1 x 106 to >1 x 107 colony-forming units/ml depending on the size
of the insert in the retroviral vector. The retroviral transduction of
primary hematopoietic cells was done according to the method of Lavau
et al. (18)
. An overview of the procedure is
given in Fig. 5A
. BMCs, enriched in noncycling hematopoietic
precursors, were recovered from 5-FU-primed Balb/C mice. Previous to
infection, the BMCs were activated by a cytokine mixture (IL-3, IL-6,
and SCF). After infection by spinoculation, the infected cells were
returned to activation medium as above. After overnight activation,
duplicates of 1 x 104
infected
cells were plated under the appropriate drug selection in 0.5 ml each
MethoCult murine methylcellulose medium with the addition of SCF, IL-3,
IL-6, and GM-CSF. For double transductions, equal volumes of different
virus supernatants were mixed before infection, and the infected BMCs
were selected simultaneously with G418 and puromycin. Colonies in one
of the duplicate wells were stained by the addition of 50 µl of 1
mg/ml p-iodonitrotetrazolium violet in PBS (INT; Sigma
Chemical Co.). INT is converted by living cells to a brown-violet
insoluble tetrazolium salt. The colonies in the remaining well were
resuspended in medium, counted, and replated as above.

View larger version (68K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Characterization of MLL-ENL/Myc cells. A,
May-Grünwald-Giemsa staining of cytospin preparations of
MLL-ENL/Myc cells after cultivation in IL-3 (left panel)
or in G-CSF for 6 days (right panel); x63.
B, growth curve of MLL-ENL/Myc cells cultivated in 10
ng/ml IL-3 or 10 ng/ml G-CSF. Absolute cell numbers are given.
C, FACS analysis of cell surface marker expression on
cells grown either in IL-3 (black outline) or for 6 days
in G-CSF (shaded curve). The expression of GR-1
(left panel) and Mac-1 (= CD11b; right
panel) is shown. D, proliferation of MLL-ENL/Myc
and MLL-ENL cells in response to G-CSF as determined by the MTT
incorporation assay. E, Western blot analysis of the Myc
and Myc proteins expressed by the respective retroviruses in the
packaging cell line. Lane 1, Myc; Lane 2,
Myc; Lane 3, empty virus. The blot was probed with a
monoclonal -Myc antibody; kDa,
Mr in thousands. F, RT-PCR
analysis of the expression of MLL-ENL (left panel), Myc
(middle panel), and Myc (right panel).
RNA was isolated and reverse trancscribed from MLL-ENL/ Myc and
MLL-ENL/Myc cells. The expected sizes for the amplification products
were 380 bp for MLL-ENL, 400 bp for Myc, and 550 bp for the Myc RNA.
Some residual DNA in the RNA preparation gave rise to weak bands in the
control reactions without reverse transcriptase. The standards used are
a 1-kb and a 100-bp ladder. H2O,
negative control reaction without template; DNA,
positive control with MLL-ENL cDNA as template. Reverse transcriptase
was added as indicated (RT).
|
|
MTT Assays, and TUNEL Staining.
Cell proliferation was measured either by direct counting of trypan
blue-negative cells or by conversion of the tetrazolium dye MTT to a
dark violet formazan salt. Apoptosis-mediated DNA fragmentation was
measured by the addition of fluorescein-labeled didesoxy-uridine onto
free DNA ends by and subsequent FACS analysis (TUNEL assay). These
procedures were done according to the instructions of the manufacturer
(Roche, Penzberg, Germany).
 |
RESULTS
|
|---|
MLL-ENL-transduced Cells Are Blocked in Differentiation,
IL-3-dependent, and Apoptosis-sensitive.
To investigate the consequences of MLL-ENL expression in hematopoietic
cells primary murine BMCs, enriched in hematopoietic precursors by 5-FU
treatment, were transduced with MLL-ENL-expressing retroviruses (see
"Materials and Methods" and Fig. 4A
). As expected, this
lead to the outgrowth of a myelomonocytic cell population with a high
content of early myeloid precursor cells (Fig. 1A)
. The presence of unrearranged retroviruses was verified by
Southern blot analysis, and multiple integration events could be
detected (Fig. 1B)
. The presence of MLL-ENL RNA was
confirmed by RT-PCR (Fig. 1C)
. Three different,
independently transduced cell populations were generated for the
subsequent experiments (labeled md11 for murine cells transduced with
derivative 11). Because there was no significant difference in the
experimental results obtained with each of them, only one
representative example is shown. A similar MLL-ENL-transduced cell
population has been shown previously to elicit acute leukemias after
injection into syngeneic mice (18)
.

View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. The influence of Myc on MLL-ENL-induced transformation of
hematopoietic cells. A, schematic outline of the
experimental procedure. To test the impact of altered Myc levels on the
MLL-ENL-based transformation mechanism, primary BMCs, enriched in
hematopoietic precursors by 5-FU treatment, were cotransduced
simultaneously with two retroviral expression constructs. The MLL-ENL
cDNA insert was transduced in a vector backbone conferring puromycin
resistance. A second virus containing a neomycin selection marker was
cotransduced either empty (MLL-ENL), with a cDNA insert
coding for a dominant-negative version of Myc lacking the
transactivation domain ( Myc), or with authentic Myc
itself (Myc). As negative controls, two empty viruses
were used (Puro/Neo), or Myc alone was transduced together with an
empty "Puro" virus. B, colony formation of
puromycin- and neomycin-resistant cells after the first and third
plating rounds. The colonies shown were stained with the vital dye
p-iodonitrotetrazolium violet. C, absolute cell
numbers per well after the first and third round of replating.
D, proliferation of double-transduced cells in response
to increasing concentration of IL-3 measured by the MTT incorporation
test.
|
|

View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Characteristics of MLL-ENL-transduced (md11) cells.
A, May-Grünwald-Giemsa staining of a cytospin
preparation of md11 cells grown in IL-3; large panel,
x20; inset, x63. B, Southern blot
analysis. The presence of MLL-ENL virus in the genome of md11 cells was
verified by Southern blot. For comparison, the hybridization pattern of
the endogenous MLL gene was determined in mouse 32D
cells. Genomic DNA of md11cells (Lanes 1 and
3) or of 32D cells (Lanes 2 and
4) was digested with either BamHI
(left panel) or KpnI (right
panel), blotted, and hybridized with a probe corresponding to
the 5' end of the MLL-ENL cDNA. This probe labels one band per
integration event in the BamHI blot; two bands indicate
unrearranged virus in the KpnI blot. C,
RT-PCR analysis. The expression of MLL-ENL RNA in the md11 cells was
detected by RT-PCR with primers spanning the breakpoint of the chimeric
cDNA.
|
|
Given the factor-independent growth and the resistance against
apoptosis of "11q23"-leukemia-derived cell lines, we first wished
to test the growth properties of md11 cells. Confirming their early
myeloid nature, md11 cells required IL-3 as the sole growth factor for
proliferation and survival. The proliferative response was proportional
to the added IL-3 concentrations, and a one-half-maximal proliferation
stimulus was reached at a concentration of 0.5 ng/ml IL-3 (Fig. 2A)
. IL-3 deprivation lead to a rapid and efficient cell death
within 24 h. Cells kept without IL-3 showed the characteristic
signs of programmed cell death, including DNA fragmentation and
positive TUNEL staining (Fig. 2, B and C)
. The
cells could be kept continuously in culture for more than 6 months in
medium supplemented with saturating amounts of IL-3 without showing any
signs of senescence. Normal BMCs, transduced with a control retroviral
vector, did not proliferate with IL-3 as growth factor (not shown).

View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. IL-3 dependency and apoptosis of md11 cells.
A, growth of md11 cells in response to increasing
concentrations of IL-3 measured by the MTT incorporation test.
B, agarose gel electrophoresis of genomic DNA isolated
from md11 cells cultivated as indicated, either in the presence of 10
ng/ml IL-3 or 24 h after the withdrawal of IL-3. A 100-bp ladder,
with the lower band corresponding to 200 bp, was used as a size
standard. The figure shows an inverted image of the original ethidium
bromide-stained gel. C, TUNEL staining of md11 cells
cultivated with IL-3 or 24 h after IL-3 deprivation.
|
|
G-CSF Induces Terminal Differentiation of md11 Cells.
During examination of md11 cells cultivated in IL-3, it was noticed
that a small number of terminally differentiated granulocytes and
macrophages were present in the cell population. To test the
possibility that a potential maturation arrest caused by MLL-ENL might
be reversible, IL-3 was replaced by the myeloid differentiation factor
G-CSF. G-CSF "neutralized" the MLL-ENL-induced maturation arrest
and triggered the terminal differentiation of the culture within 8
days. May-Grünwald-Giemsa staining of cytospin preparations of
md11 cells, cultivated for 6 days in G-CSF, revealed the presence of a
high percentage of mature granulocytes. After 8 days, the cultures were
dominated by macrophage-like cells, and short-lived granulocytes were
mostly extinct (Fig. 3A)
. G-CSF also initiated a profound proliferation arrest
(Fig. 3B)
. The visible morphological features of
differentiation were accompanied by a strong up-regulation of
myeloid-specific cell surface markers as detected by FACS staining.
Confirming their primitive myeloid nature, md11 cells that were grown
in IL-3 displayed an intermediate surface level of GR-1 and Mac-1
(CD11b). Addition of G-CSF for 6 days elicited a marked shift of both
markers toward higher expression levels, which indicated the presence
of more mature cells of the myeloid lineage (Fig. 3C)
. A
statistical evaluation of the respective cultures according to
morphological criteria supported the view that the MLL-ENL-dependent
maturation block was not absolute but could be overcome by the addition
of the differentiation factor G-CSF (Fig. 3D)
. However,
occasionally after prolonged culture (>4 months), md11 cells
spontaneously generated subclones that lost the differentiation
capability and that were able to outgrow the remaining population (not
shown).

View larger version (60K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. G-CSF induced terminal differentiation of md11 cells.
A, May-Grünwald-Giemsa staining of cytospin
preparations of md11 cells after cultivation in G-CSF for 6 days
(left panel) or 8 days (right panel);
larger panels, x20; insets, x63.
B, proliferation of md11 cells in response to 10 ng/ml
IL-3 or 10 ng/ml G-CSF. Absolute cell numbers are given.
C, FACS analysis of cell surface marker expression on
cells grown either in IL-3 or for 6 days in G-CSF. The expression of
GR-1 (left panel) and Mac-1 (=CD11b, right
panel) is shown. D, statistical analysis of cell
type distribution in the md11 cell population during G-CSF-induced
maturation. The cell type assessment was made by morphological criteria
on stained cytospin preparations.
|
|
Gene Expression Changes during Differentiation of md11 Cells.
Because G-CSF forced a "reversal" of the MLL-ENL-induced phenotype,
we wished to determine whether these morphological changes were also
accompanied by a corresponding genetic program. If MLL-ENL initiates a
differentiation block by the ectopic activation or repression of target
genes, it is possible that a normal expression level of these targets
is reestablished after restoration of myeloid differentiation by G-CSF.
It seemed, therefore, likely that a subset of the genes that are
differentially regulated after G-CSF addition is involved in the
maturation arrest that is mediated by MLL-ENL. To identify such genes,
a cDNA expression profiling was performed. Polyadenylated RNA was
isolated either from md11 cells maintained in IL-3 or from md11 cells
36 h after the addition of G-CSF. Radioactively labeled cDNA was
prepared from both RNA preparations using a mixture of 597
gene-specific primers corresponding to the 597 mouse cDNAs immobilized
on the Atlas mouse cDNA expression array. Two identical array membranes
were hybridized with the respective 32P-cDNAs,
and after a stringent wash procedure, the hybridization signals were
recorded with a phosphorimager. The hybridization patterns were
compared with each other using the Atlas Image software. This analysis
revealed 18 genes with more than a 2.2-fold change in expression
after 36 h in G-CSF (Table 1)
. Two macrophage/monocyte-specific genes coding for a chemokine C-C
receptor and for M-CSF (macrophage colony-stimulating factor)
were up-regulated in response to G-CSF. The RNA levels of the remaining
16 genes decreased in response to this cytokine. The majority of the
genes that were down-regulated after G-CSF treatment coded for
growth-indicators. Several of these are involved in the cell-cycle
regulatory circuit controlled by c-myc. Next to the RNA for
the proto-oncogene c-myc itself, the RNAs of four
established c-myc target genes (coding for the HSP60
mitchondrial heat-shock protein, the blast marker CD71, ornithine
decarboxylase, and the E2F dimerization partner DP-1; Refs. 26
, 27
) were less abundant in G-CSF-treated cells. In addition, the
expression of the proto-oncogene pim-1, which is known to
cooperate with c-myc (28)
, and of the
myc-regulatory transcription factor Nm23-M2
(29)
also decreased under the influence of G-CSF. The
remaining RNAs that were down-regulated after G-CSF treatment
corresponded to the following genes: proliferating cell nuclear
antigen (PCNA), cyclin A, the transcription
factors A10 and ATF4, the heat-shock proteins
HSP86 and HSP84, Rac1,
integrin-ß, and the DNA-binding protein YB1.
MLL-ENL Requires, and Cooperates with, c-myc to
Block Cellular Differentiation.
The role of c-myc in the MLL-ENL-induced transformation
process was further examined because this proto-oncogene is of central
importance in the regulation of growth versus
differentiation during hematopoietic development. For this purpose,
BMCs were cotransduced with two different retroviruses expressing
MLL-ENL and either a dominant-negative mutant of Myc lacking the
transactivation domain (
Myc) or authentic Myc itself. Cells
harboring both viruses were selected by simultaneous addition of G418
and puromycin. The
Myc protein is capable of forming heterodimers
with its normal cellular counterpart Max. The
Myc/Max heterodimers
are still able to bind to E-box-containing promoters but lack the
transcriptional transactivator function (24)
. As controls,
BMCs were coinfected with MLL-ENL/pMSCV-neo, Myc/pMSCV-pac,
Myc/pMSCV-pac, and with pMSCV-neo/pMSCV-pac (Neo/Puro). The
double-transduced cells were tested for their self-renewing capacity,
the phenotypic and growth properties, and their differentiation
capabilities. In the standard methylcellulose replating assay (Fig. 4A)
, colonies will form in tertiary rounds of plating only if
a cell with self-renewing capabilities has been immortalized.
Nontransformed cells will exhaust their proliferative potential and
terminally differentiate. In this assay, the coexpression of
dominant-negative Myc completely inhibited MLL-ENL-induced colony
formation. Apparently, this was not attributable to a simple
cell cycle and growth suppression because an equal number of primary
MLL-ENL/
Myc and MLL-ENL/neo colonies were observed (Fig. 4B)
. In addition, the total cell count of MLL-ENL/
Myc and
MLL-ENL/Neo cells was comparable in the primary round of plating (Fig. 4C)
. In contrast, cells cotransduced with MLL-ENL and
wild-type Myc consistently yielded a higher number of colonies in
third-round platings when compared with the MLL-ENL/Neo control cells.
In the absence of MLL-ENL, neither cells expressing Myc nor cells
expressing
Myc formed colonies in third-round platings (Fig. 4B
and not shown). Similar results were obtained when the
proliferation of the cells in response to IL-3 was measured 3 days
after explantation from third-round methylcellulose cultures.
MLL-ENL/Myc cells proliferated more vigorously and reached higher cell
densities than MLL-ENL cells (Fig. 4D)
. Both cell
populations could be grown continuously (>4 weeks) in liquid medium
without any signs of decrease in vitality. Cells coexpressing the
dominant-negative Myc, however, proliferated only weekly and stopped
growth completely after
2 weeks in liquid culture. The
Puro/Neo negative control cells did not grow in liquid culture
(not shown). Myc also had an effect on the differentiation potential of
md11 cells. MLL-ENL/Myc cells remained arrested in an earlier state of
myeloid differentiation (Mac-1 negative) and showed less spontaneous
differentiation than MLL-ENL cells (Fig. 5A)
. Additionally,
G-CSF did not induce growth arrest and differentiation of MLL-ENL/Myc
cells but, instead, stimulated a proliferative response similar to that
from IL-3 (Fig. 5B)
. G-CSF treated MLL-ENL/Myc cells
up-regulated surface Mac-1, but only a small subpopulation showed an
increase in GR-1. The generation of a GR-1+
subpopulation after G-CSF treatment was accompanied by the appearance
of a few mature granulocytes in cytospin preparations (Fig. 5, A and C)
. The majority of the cell population,
however, remained arrested in a premature state and continued to
proliferate in the presence of G-CSF. Despite the growth promoting
effects of Myc, it did not render the cells growth-factor independent.
MLL-ENL/Myc cells responded up to an optimum G-CSF concentration of
0.5 ng/ml with an increase in the proliferation rate and did not
grow without this cytokine. Higher than optimal G-CSF concentrations
lead to a slight reduction in the proliferation rate (Fig. 5D)
. The integrity of the Myc and
Myc retroviral inserts
was verified by immunoblot analysis of protein extracts prepared from
the viral packaging cells (Fig. 5E)
. The MLL-ENL RNA as well
as the Myc and the
Myc transcript was detected by RT-PCR in
MLL-ENL/Myc and MLL-ENL/
Myc cells (Fig. 5F)
.
 |
DISCUSSION
|
|---|
Translocations affecting the chromosomal locus 11q23 are the
hallmark of a class of aggressive leukemias that are especially
prevalent in infants. Much effort has been devoted to prove that the
expression of MLL fusion proteins generated by the translocation events
constitutes the underlying cause of the respective leukemias. Here, we
describe the consequences of the expression of MLL-ENL, the product of
a t(11;19), for the development of mouse hematopoietic precursor cells.
MLL-ENL sets a reversible block in myelomonocytic differentiation and
causes the transformation of factor-dependent, highly
apoptosis-sensitive myeloid cells. Furthermore, we show that the
proto-oncogene c-myc is a mediator of MLL-ENL-dependent
transformation. The presence of active Myc is essential for the
MLL-ENL-induced differentiation arrest, and excess Myc renders this
process irreversible.
The md11 cells described here are in several aspects significantly
different from cells that were established from 11q23 leukemias:
(a) a characteristic clinical feature of this type of
leukemia is the frequent treatment failure attributable to the
resistance of the leukemic cells to high doses of chemotherapeutic
agents (30)
. Recent reports underscore these observations
and describe an unusual resistance of four different patient-derived
cell lines against apoptosis (31
, 32)
. md11 cells, in
contrast, are highly apoptosis sensitive; (b) unlike md11
cells many of the cell lines derived from patients carrying a 11q23
translocation were not dependent on growth factors other than those
contained in the serum of the culture medium; and (c) most
of these lines did not show any differentiation capability (33
, 34)
. These differences are supportive of the hypothesis that the
expression of an MLL-ENL fusion protein might only be the first genetic
event and has to be followed by additional mutations before acute
leukemia arises. These secondary mutations would render the cells
finally apoptosis-resistant, growth-factor independent, and refractory
toward differentiation stimuli. Interestingly, a series of studies that
recreated a t(9;11) translocation in a natural setting by a genomic
knock-in strategy observed a distinct two-phase etiology of leukemia
(19
, 20)
. Dobson et al. (20)
detected an elevated level of myeloid cells in the blood of the AF9
knock-in mice shortly after birth but no clinical signs of leukemia
were present yet. After up to 6 months of latency, the animals finally
succumbed to acute leukemias. This would be consistent with the initial
presence of a population of myeloid cells with a partial block in
differentiation similar to md11 cells. A subsequent genetic event or
events might convert this initial myeloproliferative disease into an
acute leukemia. The multistep nature of leukemias with an 11q23
translocation is also corroborated by the discovery of three genes that
have been found mutated in leukemia cells that are isolated from
patients. Dominant-negative mutants of the transcription factor
Ikaros and an abrogation of INK4A expression by
promoter methylation were frequent in these leukemias (35
, 36)
. In addition, in rare cases, activated ras
mutants have been detected (37)
.
The experiments presented here suggest that the proto-oncogene
c-myc is not only a likely candidate for a secondary
mutation but it seems to be also intricately involved in the biological
function of MLL-ENL. The nuclear phosphoprotein c-Myc controls cell
cycle progression and has a central role in growth regulation.
Consequently, it is frequently found as an activated oncogene in human
neoplastic disease (38)
. The expression of
c-myc is normally tightly controlled. Forced myc
expression can drive quiescent cells into cycle and is able to block
differentiation. When coexpressed with an oncogenic partner such as
ras, c-myc can induce transformation of primary cells. A
plausible model to explain the effects of Myc on the MLL-ENL-induced
transformation would postulate that MLL-ENL cooperates with Myc in a
common pathway to activate the transcription of an overlapping set of
target genes. Alternatively, MLL-ENL and Myc might act in parallel
pathways that converge on essential targets that cannot be sufficiently
activated by either MLL-ENL or Myc alone. The intricate connection of
MLL fusion proteins and Myc was corroborated in a recent study of
Galoian et al. (39)
. In these
experiments, not only MLL-ENL but also three other MLL fusion proteins
functioned as specific transactivators for promoters that contained
myc-type E-boxes. Most importantly, this transactivator property of
MLL-ENL was essentially dependent on the presence of the Myc protein
itself. The MLL fusion proteins did not transactivate E-box promoters
in Myc-/- cells. Because the levels of
Myc protein were unaltered in cells expressing MLL fusion proteins, the
cooperation apparently augments the intrinsic ability of Myc to
activate certain target promoters. It is easy to imagine how a moderate
increase in the concentration of Myc targets might lead to a reversible
differentiation arrest that can be overcome by a strong maturation
stimulus, e.g., by G-CSF. An additional overexpression of
the Myc protein might amplify the cooperative effect with MLL-ENL and
finally drive the cells beyond a threshold level that makes the
maturation block irreversible. Although the activation of Myc targets
seems to be necessary for the MLL-ENL transformation mechanism, it is
not sufficient. An overexpression of Myc alone did not lead to
transformation of the hematopoietic cells and, therefore, MLL-ENL must
have additional effects that are required to elicit a true
transformation. The availability of the bone marrow transduction system
will allow us to dissect additional molecular details of the
leukemogenesis caused by MLL-ENL and to identify other potentially
cooperating oncogenes.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dirk Eick (Gesellschaft für
Strahlen- und Umweltforschung GSF, Munich, Germany) for the kind gift
of the c-myc cDNAs and Gary Nolan (Stanford University,
Stanford, CA) for the phoenix packaging cell line. We are grateful for
technical advice by Jorge DiMartino and for continual support
from Georg Fey.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by grants from the Deutsche
Forschungsgemeinschaft (SFB466-C7, SFB473-B10, SL27/4-1) and a Ria
Freifrau-von-Fritsch Stiftung career development award. 
2 To whom requests for reprints should be
addressed, at Department of Genetics, University of Erlangen,
Staudtstrasse 5, 91058 Erlangen, Germany. Phone: 49-9131-8528527; Fax:
49-9131-8528526; E-mail: rslany{at}biologie.uni-erlangen.de 
3 The abbreviations used are: G-CSF, granulocyte
colony-stimulating factor; GM-CSF, granulocyte macrophage
colony-stimulating factor; IL, interleukin; SCF, stem cell factor;
RT-PCR, reverse transcription-PCR; BMC, bone marrow cell; MTT,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; TUNEL,
terminal dideoxy nucleotidyltransferase nick-end labeling; FACS,
fluorescence-activated cell sorter; 5-FU, 5-fluorouracil. 
4 Internet address:
http://www.stanford.edu/group/nolan/. 
Received 2/13/01.
Accepted 6/28/01.
 |
REFERENCES
|
|---|
-
Look A. T. Oncogenic transcription factors in the human acute leukemias.. Science (Wash. DC)., 278: 1059-1064, 1997.[Abstract/Free Full Text]
-
Rowley J. D. The critical role of chromosome translocations in human leukemias.. Annu. Rev. Genet., 32: 495-519, 1998.[Medline]
-
Dimartino J. F., Cleary M. L. Mll rearrangements in haematological malignancies: lessons from clinical and biological studies.. Br. J. Haematol., 106: 614-626, 1999.[Medline]
-
Felix C. A. Secondary leukemias induced by topoisomerase-targeted drugs.. Biochim. Biophys. Acta, 1400: 233-255, 1998.[Medline]
-
Djabali M., Selleri L., Parry P., Bower M., Young B. D., Evans G. A. A trithorax-like gene is interrupted by chromosome 11q23 translocations in acute leukaemias [published erratum appears in Nat. Genet., 4: 431, 1993]. Nat. Genet., 2: 113-118, 1992.[Medline]
-
Gu Y., Nakamura T., Alder H., Prasad R., Canaani O., Cimino G., Croce C. M., Canaani E. The t(4;11) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene.. Cell, 71: 701-708, 1992.[Medline]
-
Tkachuk D. C., Kohler S., Cleary M. L. Involvement of a homolog of Drosophila trithorax by 11q23 chromosomal translocations in acute leukemias.. Cell, 71: 691-700, 1992.[Medline]
-
Ziemin-van der Poel, S., McCabe, N. R., Gill, H. J., Espinosa, R., III, Patel, Y., Harden, A., Rubinelli, P., Smith, S. D., LeBeau, M. M., Rowley, J. D., et al. Identification of a gene, MLL, that spans the breakpoint in 11q23 translocations associated with human leukemias [published erratum appears in Proc. Natl. Acad. Sci. USA, 89: 4220, 1992]. Proc. Natl. Acad. Sci. USA, 88: 1073510739, 1991.
-
Gould A. Functions of mammalian Polycomb group and trithorax group related genes.. Curr. Opin. Genet. Dev., 7: 488-494, 1997.[Medline]
-
Yu B. D., Hess J. L., Horning S. E., Brown G. A., Korsmeyer S. J. Altered Hox expression and segmental identity in Mll-mutant mice.. Nature (Lond.), 378: 505-508, 1995.[Medline]
-
Hanson R. D., Hess J. L., Yu B. D., Ernst P., van Lohuizen M., Berns A., van der Lugt N. M., Shashikant C. S., Ruddle F. H., Seto M., Korsmeyer S. J. Mammalian trithorax and polycomb-group homologues are antagonistic regulators of homeotic development.. Proc. Natl. Acad. Sci. USA, 96: 14372-14377, 1999.[Abstract/Free Full Text]
-
Yu B. D., Hanson R. D., Hess J. L., Horning S. E., Korsmeyer S. J. MLL, a mammalian trithorax-group gene, functions as a transcriptional maintenance factor in morphogenesis.. Proc. Natl. Acad. Sci. USA, 95: 10632-10636, 1998.[Abstract/Free Full Text]
-
Yagi H., Deguchi K., Aono A., Tani Y., Kishimoto T., Komori T. Growth disturbance in fetal liver hematopoiesis of Mll-mutant mice.. Blood, 92: 108-117, 1998.[Abstract/Free Full Text]
-
Hess J. L., Yu B. D., Li B., Hanson R., Korsmeyer S. J. Defects in yolk sac hematopoiesis in Mll-null embryos.. Blood, 90: 1799-1806, 1997.[Abstract/Free Full Text]
-
Rubnitz J. E., Morrissey J., Savage P. A., Cleary M. L. ENL, the gene fused with HRX in t(11;19) leukemias, encodes a nuclear protein with transcriptional activation potential in lymphoid and myeloid cells.. Blood, 84: 1747-1752, 1994.[Abstract/Free Full Text]
-
Prasad R., Yano T., Sorio C., Nakamura T., Rallapalli R., Gu Y., Leshkowitz D., Croce C. M., Canaani E. Domains with transcriptional regulatory activity within the ALL1 and AF4 proteins involved in acute leukemia.. Proc. Natl. Acad. Sci. USA, 92: 12160-12164, 1995.[Abstract/Free Full Text]
-
Schreiner S. A., Garcia-Cuellar M. P., Fey G. H., Slany R. K. The leukemogenic fusion of MLL with ENL creates a novel transcriptional transactivator.. Leukemia, 13: 1525-1533, 1999.[Medline]
-
Lavau C., Szilvassy S. J., Slany R., Cleary M. L. Immortalization and leukemic transformation of a myelomonocytic precursor by retrovirally transduced HRX-ENL. EMBO J., 16: 4226-4237, 1997.[Medline]
-
Corral J., Lavenir I., Impey H., Warren A. J., Forster A., Larson T. A., Bell S., McKenzie A. N., King G., Rabbitts T. H. An Mll-AF9 fusion gene made by homologous recombination causes acute leukemia in chimeric mice: a method to create fusion oncogenes.. Cell, 85: 853-861, 1996.[Medline]
-
Dobson C. L., Warren A. J., Pannell R., Forster A., Lavenir I., Corral J., Smith A. J., Rabbitts T. H. The mll-AF9 gene fusion in mice controls myeloproliferation and specifies acute myeloid leukaemogenesis.. EMBO J., 18: 3564-3574, 1999.[Medline]
-
Dobson C. L., Warren A. J., Pannell R., Forster A., Rabbitts T. H. Tumorigenesis in mice with a fusion of the leukaemia oncogene Mll and the bacterial lacZ gene.. EMBO J., 19: 843-851, 2000.[Medline]
-
Ausubel, F. M. Short protocols in molecular biology, Ed. 4, Vol. 1. New York: Wiley & Sons, 1999.
-
Hawley R. G., Lieu F. H., Fong A. Z., Hawley T. S. Versatile retroviral vectors for potential use in gene therapy.. Gene Ther., 1: 136-138, 1994.[Medline]
-
Hermeking H., Wolf D. A., Kohlhuber F., Dickmanns A., Billaud M., Fanning E., Eick D. Role of c-myc in simian virus 40 large tumor antigen-induced DNA synthesis in quiescent 3T3L1 mouse fibroblasts.. Proc. Natl. Acad. Sci. USA, 91: 10412-10416, 1994.[Abstract/Free Full Text]
-
Kohlhuber F., Hermeking H., Graessmann A., Eick D. Induction of apoptosis by the c-Myc helix-loop-helix/leucine zipper domain in mouse 3T3L1 fibroblasts.. J. Biol. Chem., 270: 28797-28805, 1995.[Abstract/Free Full Text]
-
Schuhmacher M., Kohlhuber F., Holzel M., Kaiser C., Burtscher H., Jarsch M., Bornkamm G. W., Laux G., Polack A., Weidle U. H., Eick D. The transcriptional program of a human B cell line in response to Myc.. Nucleic Acids Res., 29: 397-406, 2001.[Abstract/Free Full Text]
-
Coller H. A., Grandori C., Tamayo P., Colbert T., Lander E. S., Eisenman R. N., Golub T. R. Expression analysis with oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and adhesion.. Proc. Natl. Acad. Sci. USA, 97: 3260-3265, 2000.[Abstract/Free Full Text]
-
van Lohuizen M., Verbeek S., Scheijen B., Wientjens E., van der Gulden H., Berns A. Identification of cooperating oncogenes in E mu-myc transgenic mice by provirus tagging [see comments].. Cell, 65: 737-752, 1991.[Medline]
-
Postel E. H., Berberich S. J., Flint S. J., Ferrone C. A. Human c-myc transcription factor PuF identified as nm23H2 nucleoside diphosphate kinase, a candidate suppressor of tumor metastasis [see comments].. Science (Wash. DC)., 261: 478-480, 1993.[Abstract/Free Full Text]
-
Heerema N. A., Sather H. N., Ge J., Arthur D. C., Hilden J. M., Trigg M. E., Reaman G. H. Cytogenetic studies of infant acute lymphoblastic leukemia: poor prognosis of infants with t(4;11)a report of the Childrens Cancer Group. Leukemia, 13: 679-686, 1999.[Medline]
-
Kersey J. H., Wang D., Oberto M. Resistance of t(4;11) (MLL-AF4 fusion gene) leukemias to stress-induced cell death: possible mechanism for extensive extramedullary accumulation of cells and poor prognosis.. Leukemia, 12: 1561-1564, 1998.[Medline]
-
Dorrie J., Schuh W., Keil A., Bongards E., Greil J., Fey G. H., Zunino S. J. Regulation of CD95 expression and CD95-mediated cell death by interferon-
in acute lymphoblastic leukemia with chromosomal translocation t(4;11).. Leukemia, 13: 1539-1547, 1999.[Medline]
-
Matsuo Y., Drexler H. G. Establishment and characterization of human B cell precursor-leukemia cell lines.. Leuk Res., 22: 567-579, 1998.[Medline]
-
Hayashi Y., Honma Y., Niitsu N., Taki T., Bessho F., Sako M., Mori T., Yanagisawa M., Tsuji K., Nakahata T. SN-1, a novel leukemic cell line with t(11;16)(q23;p13): myeloid characteristics and resistance to retinoids and vitamin D3.. Cancer Res., 60: 1139-1145, 2000.[Abstract/Free Full Text]
-
Nakamura, M., Sugita, K., Inukai, T., Goi, K., Iijima, K., Tezuka, T., Kojika, S., Shiraishi, K., Miyamoto, N., Karakida, N., Kagami, K., T, O. K., Mori, T., and Nakazawa, S. p16/MTS1/INK4A gene is frequently inactivated by hypermethylation in childhood acute lymphoblastic leukemia with 11q23 translocation. Leukemia, 13: 884890, 1999.
-
Sun L., Heerema N., Crotty L., Wu X., Navara C., Vassilev A., Sensel M., Reaman G. H., Uckun F. M. Expression of dominant-negative and mutant isoforms of the antileukemic transcription factor Ikaros in infant acute lymphoblastic leukemia.. Proc. Natl. Acad. Sci. USA, 96: 680-685, 1999.[Abstract/Free Full Text]
-
Mahgoub N., Parker R. I., Hosler M. R., Close P., Winick N. J., Masterson M., Shannon K. M., Felix C. A. RAS mutations in pediatric leukemias with MLL gene rearrangements.. Genes Chromosomes Cancer, 21: 270-275, 1998.[Medline]
-
Nesbit C. E., Tersak J. M., Prochownik E. V. MYC oncogenes and human neoplastic disease.. Oncogene, 18: 3004-3016, 1999.[Medline]
-
Galoian K., Milne T., Brock H. W., Shilatifard A., Slany R. S., Hess J. L. Deregulation of c-Myc by leukemogenic MLL fusion proteins.. Blood, 96(Suppl): 457 2000.
This article has been cited by other articles:

|
 |

|
 |
 
Y. Guo, C. Niu, P. Breslin, M. Tang, S. Zhang, W. Wei, A. R. Kini, G. P. Paner, S. Alkan, S. W. Morris, et al.
c-Myc-mediated control of cell fate in megakaryocyte-erythrocyte progenitors
Blood,
September 3, 2009;
114(10):
2097 - 2106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chen, D. A. Santillan, M. Koonce, W. Wei, R. Luo, M. J. Thirman, N. J. Zeleznik-Le, and M. O. Diaz
Loss of MLL PHD Finger 3 Is Necessary for MLL-ENL-Induced Hematopoietic Stem Cell Immortalization
Cancer Res.,
August 1, 2008;
68(15):
6199 - 6207.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Behbod and J. M. Rosen
Will cancer stem cells provide new therapeutic targets?
Carcinogenesis,
April 1, 2005;
26(4):
703 - 711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Cartwright, C. McLean, A. Sheppard, D. Rivett, K. Jones, and S. Dalton
LIF/STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism
Development,
March 1, 2005;
132(5):
885 - 896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. B. Zeisig, T. Milne, M.-P. Garcia-Cuellar, S. Schreiner, M.-E. Martin, U. Fuchs, A. Borkhardt, S. K. Chanda, J. Walker, R. Soden, et al.
Hoxa9 and Meis1 Are Key Targets for MLL-ENL-Mediated Cellular Immortalization
Mol. Cell. Biol.,
January 15, 2004;
24(2):
617 - 628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Johnson, W. Chen, W. Hudson, Q. Yao, M. Taylor, T. H. Rabbitts, and J. H. Kersey
Prenatal and postnatal myeloid cells demonstrate stepwise progression in the pathogenesis of MLL fusion gene leukemia
Blood,
April 15, 2003;
101(8):
3229 - 3235.
[Abstract]
[Full Text]
[PDF]
|
 |
|