| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Department of Surgery and the A. J. Siteman Cancer Center, The Washington University School of Medicine, St. Louis, Missouri 63110
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
However, the APC protein interacts with multiple proteins distinct from
ß-catenin, and there are a number of studies which suggest that
APC mutations may drive neoplastic growth by
ß-catenin-independent mechanisms. Effects of the APC protein on cell
cycle progression may result from interactions with proteins distinct
from ß-catenin (6)
. Expression of an intact
APC gene in APC-mutant human colon carcinoma
cells induces apoptosis without altering ß-catenin levels
(7)
. The APC gene product appears to mediate
certain effects on cell growth via alterations in 
-catenin rather
than ß-catenin (8)
. Furthermore, the expression of
activated ß-catenin alleles does not result in the neoplastic
transformation of rodent fibroblasts (9
, 10)
or of
transgenic mouse intestinal epithelium (11)
. Thus, despite
substantial indirect evidence, a direct role for ß-catenin activity
in the neoplastic growth of APC-mutant colon cancer cells
has not been formally demonstrated.
Antisense ODNs represent one experimental approach to the selective down-regulation of a particular target gene (12 , 13) . Antisense ODNs bind to complementary sequences of their target mRNA and catalyze the degradation of the mRNA molecule by the nuclease RNaseH. Whereas antisense studies have been plagued by a number of factors resulting in scientifically questionable or incorrect results (14) , appropriately designed and selected ODNs can catalyze the degradation of a specific target mRNA (12, 13, 14) . Such antisense-mediated down-regulation of gene expression has been documented both in cell culture systems and in experimental animals. In fact, antisense compounds have entered clinical trials in patients with a variety of diseases, most prominently cancer (15, 16, 17) .
To further elucidate the function of ß-catenin signaling in human colon carcinoma, we have used antisense ODNs to specifically down-regulate ß-catenin mRNA expression and suppress ß-catenin/Tcf signaling in APC-mutant colon carcinoma cells. Using this experimental approach, we have explored the role of ß-catenin signaling in the neoplastic growth of colon carcinoma cells in vitro and in the tumorigenic growth of carcinoma xenografts implanted into nude mice.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
ODNs and Cell Treatment Protocol.
Phosphorothioate ODNs with the following sequences were obtained
from Trilink Biotechnology (San Diego, CA):
ß-catenin Antisense CA5 20mer TAAGAGCTTAACCACAACTG.
Mismatched ß-catenin Antisense CA5:
1 base mismatch TAAGAGCCTAACCACAACTG
2 base mismatch TAAGAGCCTAACCACAATTG
5 base mismatch TGAGAGCCTAACTACAATTA
Scrambled Antisense Control 20mer CAGTAACTGAATAGCTACCA.
Lyophilized ODNs were reconstituted in sterile distilled water to 1 mM, and filter was sterilized and stored in aliquots at -20°C as stock solutions. The uptake of phosphorothioate ODNs by cells was facilitated using Lipofectin (Life Technologies, Inc., Gaithersburg, MD). Lipofectin was diluted to give a concentration of 100 µg/ml in 1/10 treatment volume of OPTIMEM I (Life Technologies, Inc.) and incubated at room temperature for 30 min. Phosphorothioate ODNs diluted to 10 times the final desired concentration in 1/10 treatment volume of OPTIMEM I were added, and the Lipofectin/DNA mixture was allowed to form a complex at room temperature for 15 min. The mixture was then warmed to 37°C for 5 min, and prewarmed OPTIMEM I was added to give final concentrations of 10 µg/ml Lipofectin and the desired ODN concentration (generally 1 µM). Cells were exposed to the mixture for 4 h after which time the ODN/Lipofectin containing media was replaced with standard culture medium.
Northern Blotting.
Overnight culture of 5 x 105
cells/60-mm dish was treated with 10 µg/ml Lipofectin with or without
ODNs for 4 h. Total RNA was prepared from cells 24 h after
the initiation of ODN treatment using the phenol/guanidine
isothiocyanate method with TRIzol Reagent (Life Technologies, Inc.).
Total RNA (10 µg) per lane was electrophoresed on a formaldehyde
containing 1% agarose gel, transferred onto a nylon membrane
(Boehringer Mannheim, Indianapolis, IN), and hybridized with
digoxigenin-labeled (Boehringer Mannheim) 1.1 kb human
ß-catenin cDNA probe (amplified from human ß-catenin cDNA;
ATCC). digoxigenin-labeled GAPDH probe (CLONTECH, Palo Alto, CA)
was used as a loading and transfer control.
Western Blotting.
Western blotting was performed as described (18)
48 h
after ODN treatment. Antibodies specific for ß-catenin (antibody
C-18) and -catenin (C-20) were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). Antibodies to cyclin D1 (AB2) were
obtained from Oncogene Research (Cambridge, MA). An actin-specific
monoclonal antibody (MSX) was obtained from Chemi-Con (Temecula, CA).
All antibodies were used according to the supplier’s recommendations.
Tcf Reporter Assay.
SW480 colon cancer cells (2 x 105) were treated with 1 µM
concentrations of corresponding ODN. After ODN treatment (18 h), cell
culture dishes were transfected with 1 µg of either TOPFLASH or
FOPFLASH (Upstate Biotechnology, Waltham, MA) reporter vector. After
transfection with the reporter vector (30 h), cells were lysed in lysis
buffer [20 mM Tris-PO4 (pH 7.8), 2
mM DTT, 2 mM
1,2-cyclohexylenedinitrilotetraacetic acid, 10% Glycerol, and 1
mM Triton X-100]. Each lysate (20 µl) was used to detect
luciferase activity using D-luciferin (PharMingen, San Diego, CA)
dissolved in reaction buffer [20 nM Tricine, 1.07
nM
(MgCO3)4Mg(OH)2·5H2O,
2.67 mM MgSO4, 0.1 mM
EDTA, 33.3 mM DTT, and 530 µM ATP] as
substrate, and relative light units were recorded in a luminometer
(Monolight 3010). The ratio of relative light units generated by
TOPFLASH transfection to FOPFLASH transfection represents Tcf activity
(19)
.
MTT Cell Proliferation Assay.
Cell proliferation was quantitated using an MTT (Roche Pharmaceuticals,
Indianapolis, IN) assay as described (20)
. Results
represent the means of triplicate samples and are presented as
mean ± SE.
Anchorage-independent Growth Assay.
Anchorage-independent growth capability was determined by assessing the
colony-forming efficiency of cells suspended in soft agar as described
(21)
. Cells were treated with ODNs (1 µM)
24 h before plating in soft agar and were fed weekly with 1 ml of
culture medium. Colonies >0.25 mm were counted using an inverted phase
microscope and a calibrated template. Colonies were counted after 28
days. Bar graphs represent mean ± SE of triplicate
groups.
Boyden Chamber Invasion Assay.
Cells (105) were treated with Lipofectin or 1
µM ODN, and 24 h after treatment,
104
cells were plated into top chambers of
collagen-coated Millicell-CM assay plates (Millipore, Bedford, MA) in
growth media containing 1% fetal bovine serum. The bottom chamber
contained growth media with 10% fetal bovine serum to serve as a
chemoattractant. After 36 h of incubation, the cells on top of the
membrane were washed, and the membrane was fixed in 3% glutaraldehyde,
and cells on the bottom side of the membrane were viewed after staining
with crystal violet (Sigma Chemical Co., St. Louis, MO). In replicate
experiments, cells from the top and bottom of the membrane were
trypsinized and counted using a hemocytometer. Results are normalized
for the fraction of viable cells in each population. Bar graphs
represent mean ± SE of triplicate groups.
Tumor Cell Line Implantation and Measurement of Tumor Growth.
SW480 tumor cells were released from tissue culture dishes and washed
in serum-free medium. Tumor cells were diluted with HBSS to a
concentration of 2 x 107 cells/ml
and were injected into the mid-dorsum of BALB/c nude mice in a total
volume of 0.1 ml. Animals were inspected daily for tumor development.
Growing tumors were measured using vernier calipers, and tumor volume
was calculated by the formula length x width2 x 0.52, which approximates the
volume of an elliptical solid.
In Vivo Administration of Antisense ODNs.
Mice were weighed on the days of treatment. Stock ODNs were diluted
with sterile saline to give a dose of 20 mg/kg in a volume of 0.5 ml.
Tumor-bearing animals were injected i.p. with antisense or control ODN
solutions in a total volume of 0.5 ml using a 27-gauge needle.
Treatment was initiated on days 7 (Fig. 5A)
or 1 (Fig. 5B)
after tumor cell injection.
|
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Down-regulation of ß-catenin mRNA in antisense-treated
APC-mutant SW480 colon carcinoma cells was assessed by
Northern hybridization. Blots were quantitated by densitometry, and
results were normalized for effects on the unrelated gene
GAPDH to control for nonspecific or toxic effects. Most of
the antisense ODNs examined had little or no effect on ß-catenin mRNA
expression (Fig. 1A)
. However, one sequence, CA5, was able to potently
down-regulate ß-catenin expression and was chosen for additional
study. To additionally enhance the potency of this ß-catenin-specific
antisense ODN, three 20-base ß-catenin antisense molecules
with sequences overlapping the CA5 15mer were synthesized and tested
for their ability to suppress ß-catenin mRNA levels. One 20-base
molecule, termed CA5–20, was significantly more potent at
down-regulating ß-catenin mRNA expression than the CA5 15mer (data
not shown) and has been used in subsequent experiments.
|
. There is no effect of a scrambled
antisense (11-base mismatch) ODN sequence at any dose tested. Neither
the CA5–20 ODN nor the scrambled control ODN has an effect on
expression of mRNA encoding the unrelated gene GAPDH (Fig. 1B)
. The ability of a particular antisense ODN to
down-regulate its target mRNA molecule reflects hybridization by
Watson-Crick base-pairing. To confirm the sequence specificity of the
CA5 ODN for its ß-catenin target, similar ODNs mismatched at one,
two, and five bases were synthesized, and their effects on ß-catenin
expression were compared with the effect of the intact CA5–20 ODN. As
shown in Fig. 1C
, the introduction of two or more mismatched
bases largely abrogates the effect of the CA5–20 ODN on ß-catenin
mRNA expression. Thus, the ability of the CA5–20 antisense ODN to
down-regulate ß-catenin expression is sequence-specific and
dose-dependent.
Antisense Treatment Down-Regulates the ß-Catenin Protein and
Inhibits Tcf-driven Gene Transcription.
On the basis of the ability of the CA5–20 ß-catenin antisense ODN to
down-regulate total cellular ß-catenin mRNA expression, it seemed
likely that levels of the ß-catenin protein were also down-regulated.
To confirm this hypothesis, the levels of ß-catenin and the
structurally related, APC-regulated protein -catenin were
examined on Western blots. As shown in Fig. 2A
, ß-catenin antisense treatment selectively inhibits
expression of the ß-catenin protein but has little effect on the
expression of -catenin. Cell fractionation experiments demonstrate
parallel down-regulation of ß-catenin in both nuclear and membrane
fractions (data not shown).
|
, CA5–20 antisense treatment
results in >70% inhibition of Tcf-regulated transcriptional activity.
After antisense-mediated suppression of ß-catenin/Tcf transcriptional
activity, there is a corresponding decrease in the expression of
cyclin D1, a gene known to be
transcriptionally regulated by ß-catenin/Tcf complexes (Refs.
22
and 23
; Fig. 2C
). Thus,
antisense-mediated suppression of ß-catenin expression appears to
functionally replace the activity of the APC gene in
down-regulating ß-catenin expression and transcriptional activity in
an APC-mutant colon cancer cell line.
Down-Regulation of ß-Catenin Inhibits the Proliferation of
APC-Mutant Colorectal Cancer Cells.
The potent activity of the CA5–20 antisense ODN in suppressing
ß-catenin expression and inhibiting ß-catenin/Tcf-stimulated
transcription has been used to examine the role of ß-catenin
signaling in APC-mutant colon cancer cell proliferation. As
shown in Fig. 3A
, ß-catenin antisense treatment of SW480 colon cancer
cells results in a dose-dependent inhibition of cell growth as
determined by MTT assay. Similar results were obtained using direct
cell counts (data not shown). This antiproliferative effect parallels
the dose-dependent effects on ß-catenin mRNA expression, as shown in
Fig. 1B
. In contrast to the effect of the CA5–20 ODN, the
scrambled sequence control ODN has only minimal effects on SW480 cell
proliferation at concentrations 
1 µM. To
avoid potentially confounding nonspecific toxic effects that occur at
ODN concentrations >1 µM, all other
experiments were conducted at ODN concentrations of 1
µM.
|
. To additionally
exclude the possibility that the inhibition of SW480 cell growth
observed after ß-catenin antisense treatment was the result of a
nonantisense mechanism, the requirement for Watson-Crick base-pairing
in such growth inhibition was examined. As shown in Fig. 3B
,
a CA5–20 ODN analogue that is mismatched at 2 of 20 bases has markedly
less activity in inhibiting SW480 cancer cell growth than does the
CA5–20 ß-catenin antisense ODN itself. The loss of potency of the
two-base mismatch ODN with regards to its effect on cell growth
parallels its loss of potency in down-regulating ß-catenin mRNA
levels (Fig. 1C)
. This strongly suggests that the
antiproliferative activity of the CA5–20 ß-catenin antisense
molecule is the result of its suppression of ß-catenin mRNA.
ß-catenin antisense treatment also inhibits the growth of
APC-mutant colon cancer cell lines, distinct from SW480. As
shown in Fig. 3C
, the growth of two other colon carcinoma
lines, Colo201 and DLD-1, which are known to contain APC
mutations, is significantly inhibited after exposure to the CA5–20
antisense ODN. The proliferation of cancer cells containing wild-type
APC and mutant ß-catenin alleles, such as HCT116
(5)
, is also inhibited by ß-catenin antisense treatment
(data not shown). In contrast, there is little or no antiproliferative
activity after CA5–20 antisense exposure in cancer cell lines which
have both wild-type APC and wild-type ß-catenin alleles,
such as BT474 and SKBR3 (24
, 25)
. It should be emphasized
that antisense treatment does result in ß-catenin down-regulation in
such cells (data not shown), but the cells have undergone neoplastic
transformation by a distinct molecular mechanism and are apparently not
dependent on continued high levels of ß-catenin expression to
replicate. Similarly, the proliferation of the nontransformed diploid
fibroblast line WI-38 is only minimally inhibited by ß-catenin
antisense treatment (Fig. 3C)
. In contrast, cells containing
APC mutations are demonstrated to be dependent on
continuously elevated ß-catenin levels for cell proliferation.
Effects of ß-Catenin Antisense Treatment on Anchorage-independent
Growth and Cellular Invasiveness.
Adherent cell growth in vitro is a relatively poor correlate
of tumorigenic growth in vivo; the in vitro
property of cancer cells which most accurately predicts in
vivo tumorigenicity is anchorage-independent growth. Examination
of the effect of ß-catenin antisense ODN treatment on the
anchorage-independent growth of SW480 cells suspended in soft agar
demonstrates a significant inhibition of colony formation (Fig. 4A)
. There is no effect of the scrambled sequence control ODN
on SW480 cell colony formation. Thus, down-regulation of ß-catenin
expression inhibits both adherent and anchorage-independent growth of
APC-mutant colon carcinoma cells.
|
, treatment with ß-catenin antisense ODNs results in a
substantial inhibition of SW480 colon carcinoma cell invasiveness. The
scrambled sequence control ODN has no such effects. It should be noted
that results are presented as the percentage of surviving viable cells
that traverse the collagen membrane. This eliminates potentially
confounding effects in interpreting the results of this assay resulting
from ß-catenin antisense effects on cell viability or proliferation.
Thus, in addition to effects on cancer cell growth, suppression
of ß-catenin expression results in inhibition of cancer cell
invasiveness.
Effects of Systemic ß-Catenin Antisense Treatment on Tumor
Xenografts.
Antisense ODNs have entered clinical trials for the treatment of a
variety of disease states, most prominently, cancer
(15, 16, 17)
. On the basis of the inhibitory effects of
ß-catenin antisense ODNs on the proliferation, viability, and
invasiveness of APC-mutant colon cancer cells in
vitro, it was of interest to: (a) determine whether
antisense treatment of human colon cancer cells in a xenograft model
could down-regulate ß-catenin expression in vivo; and
(b) examine the effects of such down-regulation on tumor
growth. As shown in Fig. 5A
, treatment of SW480 tumor-bearing nude mice with i.p.
injections of the CA5–20 ß-catenin antisense ODN is able to
significantly reduce ß-catenin protein levels in s.c. tumor nodules.
Treatment of SW480 tumor-bearing mice with the scrambled sequence
control ODN has no effect on tumor ß-catenin levels. Thus, it is
possible to down-regulate tumor ß-catenin levels by the systemic
administration of a ß-catenin antisense ODN.
Antisense-mediated suppression of ß-catenin exerts a significant
inhibitory effect on the tumorigenic growth of SW480 cancer cells
implanted into nude mice. As shown in Fig. 5B
tumor cells
implanted into nude mice treated with i.p. injections of the CA5–20
antisense ODN at a dose of 20 mg/kg daily grow much more slowly than do
tumors in mice treated with injections of saline, with three of five
antisense-treated mice completely regressing their small tumor nodules.
In contrast, tumors in mice injected with the scrambled sequence
control ODN display a growth pattern not significantly different from
the saline-treated mice; all of the animals in these two groups
developed progressively growing lethal tumors. Similar results have
been obtained in replicate experiments; some ß-catenin
antisense-treated mice demonstrate complete tumor regression, whereas
all animals in saline and control ODN treatment groups developed
progressively growing tumors. It should be noted that animals rendered
tumor-free by ß-catenin antisense treatment have been observed for an
additional 120+ days (6 months total) without evidence of tumor
recurrence. Thus, down-regulation of ß-catenin expression in
vivo can inhibit, and in some cases eradicate, the tumorigenic
growth of APC-mutant colon cancer cells.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Whereas the studies presented here demonstrate that targeted suppression of ß-catenin inhibits the neoplastic growth of APC-mutant colon cancer cells, the mechanisms by which ß-catenin contributes to the cancer phenotype remain to be elucidated. It is possible that alterations in ß-catenin levels alter E-cadherin-mediated cell membrane properties, with resulting effects on cancer cell invasiveness and viability. It is also possible that the suppression of ß-catenin/Tcf transcription factor activity resulting from antisense-mediated down-regulation of ß-catenin inhibits cancer cell growth attributable to effects on the expression of downstream genes, such as cyclin D1. Studies addressing these two nonmutually exclusive possibilities are in progress.
The availability of an antisense ODN capable of selectively disrupting ß-catenin activity in cancer cells will be of use in additionally defining molecular mechanisms in colon carcinogenesis resulting from APC gene mutations. Studies using inducible APC constructs have begun to identify downstream molecules, the transcription of which is regulated by APC (27 , 28) . It has been suggested that these effects are all of the result of alterations in ß-catenin signaling, but ß-catenin may not be the only transcriptionally active molecule regulated by APC (8) . It will be of interest to examine changes in gene expression after the direct inhibition of ß-catenin activity and to compare these changes with those resulting from APC activity.
The antitumor effects observed as a result of ß-catenin
down-regulation are similar to the effects observed when
APC-mutant colon cancer cells were treated with an
adenoviral expression vector containing a ß-catenin-binding segment
of the APC gene (29)
. The latter construct,
however, also contained -catenin and axin-binding domains of the
APC protein, and, thus, antitumor effects could not be
definitively linked to effects on ß-catenin. In contrast, the
ß-catenin antisense ODN used in our studies appears to selectively
target ß-catenin. The results presented here thus formally establish
ß-catenin as a valid molecular target for additional developmental
therapeutics.
The murine and human ß-catenin genes are highly homologous, but the region of the human ß-catenin mRNA targeted by the CA5–20 antisense ODN described here differs from the corresponding murine mRNA at 4 of 20 bases. There is no effect of CA5–20 ODN treatment on ß-catenin expression in either murine cell lines or in other tissues of human tumor xenograft-bearing mice.4 However, we have recently identified an antisense ODN with specific activity in suppressing murine ß-catenin mRNA expression. Studies using this molecule to systemically suppress ß-catenin in mice are ongoing; it appears that systemic suppression of ß-catenin, using antisense ODN doses comparable with those shown to inhibit tumor growth here, is relatively well tolerated.4 It may thus be possible to achieve antitumor effects using antisense ODNs to inhibit ß-catenin expression in APC-mutant colon cancer cells without excessive toxicity to the tumor-bearing host.
The studies presented here demonstrate a novel approach to the targeted therapy of tumors containing tumor suppressor gene mutations: direct suppression of the molecular target normally regulated by the tumor suppressor gene product. This has a number of advantages compared with the more traditional gene therapy approach of attempting to replace the tumor suppressor gene, particularly in the areas of gene delivery and regulation. Successful delivery of a gene therapy construct into even a modest fraction of tumor cells in a treated animal remains an elusive goal. In contrast, antisense ODNs are widely distributed after in vivo administration (12) and are capable of selectively inhibiting their target in the majority of tumor cells, as demonstrated in the present work and in numerous other studies. The activity of antisense ODNs does not require transcriptional regulatory mechanisms and can be modulated pharmacologically by modifying the treatment dose. This approach clearly has activity in the APC/ß-catenin system described here and might have utility in other tumor suppressor gene defects where the suppressor gene inhibits a well-defined downstream signaling pathway.
|
FOOTNOTES |
|---|
1 Supported by NIH Grant CA79841 and a career
development award from the Society for Surgery of the Alimentary Tract
(both to J. A. D.). H. R. was supported by a postdoctoral training
grant from the Susan B. Komen Foundation. D. W. G. and C. B. B.
were supported by NIH training Grant CA09621. 
2 To whom requests for reprints should be
addressed, at Washington University School of Medicine, Campus Box
8109, St. Louis, MO 63110. Phone: (314) 362-7046; Fax:
(314) 367-1943; E-mail: drebinj{at}msnotes.wustl.edu
3 The abbreviations used are: APC,
adenomatous polyposis coli; ODN, oligonucleotide; ATCC,
American Type Culture Collection; GAPDH, glyceraldehyde phosphate
dehydrogenase; MTT,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.
4 H. Roh et al., unpublished
observations.
Received 3/ 6/01. Accepted 6/29/01.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-catenin is regulated by the APC tumor suppressor and its oncogenic activity is distinct from that of ß-catenin.. Genes Dev., 14: 1319-1331, 2000.
, in patients with advanced cancer.. J. Clin. Oncol., 17: 3586-3595, 1999.-catenin mutations, but not E-cadherin inactivation, underlie T-cell factor/lymphoid enhancer factor transcriptional deregulation in gastric and pancreatic cancer.. Cell Growth Differ., 10: 369-376, 1999.-catenin in epithelial tumor cell lines and characterization of a unique cell line.. Cancer Lett., 126: 33-41, 1998.[Medline]
is an APC-regulated target of non-steroidal anti-inflammatory drugs.. Cell, 99: 335-345, 1999.[Medline]
This article has been cited by other articles:
|
|
 |
|
  L.-N. Song and E. P. Gelmann Silencing Mediator for Retinoid and Thyroid Hormone Receptor and Nuclear Receptor Corepressor Attenuate Transcriptional Activation by the {beta}-Catenin-TCF4 Complex J. Biol. Chem., September 19, 2008; 283(38): 25988 - 25999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Schneikert and J. Behrens The canonical Wnt signalling pathway and its APC partner in colon cancer development Gut, March 1, 2007; 56(3): 417 - 425. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Park, J. Gwak, M. Cho, T. Song, J. Won, D.-E. Kim, J.-G. Shin, and S. Oh Hexachlorophene Inhibits Wnt/beta-Catenin Pathway by Promoting Siah-Mediated beta-Catenin Degradation Mol. Pharmacol., September 1, 2006; 70(3): 960 - 966. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. K. Roy, D. P. Kunte, J. L. Koetsier, J. Hart, Y. L. Kim, Y. Liu, M. Bissonnette, M. Goldberg, V. Backman, and R. K. Wali Chemoprevention of colon carcinogenesis by polyethylene glycol: suppression of epithelial proliferation via modulation of SNAIL/{beta}-catenin signaling. Mol. Cancer Ther., August 1, 2006; 5(8): 2060 - 2069. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Faux, J. L. Ross, C. Meeker, T. Johns, H. Ji, R. J. Simpson, M. J. Layton, and A. W. Burgess Restoration of full-length adenomatous polyposis coli (APC) protein in a colon cancer cell line enhances cell adhesion J. Cell Sci., January 22, 2004; 117(3): 427 - 439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. K. Veeramachaneni, H. Kubokura, L. Lin, J. A. Pippin, G. A. Patterson, J. A. Drebin, and R. J. Battafarano Down-regulation of beta catenin inhibits the growth of esophageal carcinoma cells J. Thorac. Cardiovasc. Surg., January 1, 2004; 127(1): 92 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Gatenby and T. L. Vincent An Evolutionary Model Of Carcinogenesis Cancer Res., October 1, 2003; 63(19): 6212 - 6220. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-H. Xiao, C. Ghosn, C. Hinchman, C. Forbes, J. Wang, N. Snider, A. Cordrey, Y. Zhao, and R. A. S. Chandraratna Adenomatous Polyposis Coli (APC)-independent Regulation of {beta}-Catenin Degradation via a Retinoid X Receptor-mediated Pathway J. Biol. Chem., August 8, 2003; 278(32): 29954 - 29962. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Rajakangas, S. Basu, I. Salminen, and M. Mutanen Adenoma Growth Stimulation by the trans-10, cis-12 Isomer of Conjugated Linoleic Acid (CLA) Is Associated with Changes in Mucosal NF-{kappa}B and Cyclin D1 Protein Levels in the Min Mouse J. Nutr., June 1, 2003; 133(6): 1943 - 1948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. N. Verma, R. M. Surabhi, A. Schmaltieg, C. Becerra, and R. B. Gaynor Small Interfering RNAs Directed against {beta}-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells Clin. Cancer Res., April 1, 2003; 9(4): 1291 - 1300. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-S. Kim, H. Crooks, A. Foxworth, and T. Waldman Proof-of-Principle: Oncogenic {beta}-Catenin Is a Valid Molecular Target for the Development of Pharmacological Inhibitors Mol. Cancer Ther., December 1, 2002; 1(14): 1355 - 1359. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Takahashi, M. Fujita, Y. Furukawa, R. Hamamoto, T. Shimokawa, N. Miwa, M. Ogawa, and Y. Nakamura Isolation of a Novel Human Gene, APCDD1, as a Direct Target of the {beta}-Catenin/T-Cell Factor 4 Complex with Probable Involvement in Colorectal Carcinogenesis Cancer Res., October 15, 2002; 62(20): 5651 - 5656. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sekiya, T. Nakamura, Y. Kazuki, M. Oshimura, K. Kohu, K.-i. Tago, S. Ohwada, and T. Akiyama Overexpression of Icat Induces G2 Arrest and Cell Death in Tumor Cell Mutants for Adenomatous Polyposis Coli, {beta}-catenin, or Axin Cancer Res., June 1, 2002; 62(11): 3322 - 3326. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
), CA5–20 ß-catenin antisense ODNs (20 mg/kg; 
),
or scrambled sequence control ODNs (20 mg/kg; 
) for 21 days. Tumor
growth was measured as described in "Materials and Methods."
