| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Department of Oncology, Albert Einstein Cancer Center/Montefiore Medical Center, Bronx, New York 10467
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Modulation of mucin expression may be an important component both in the early steps of colon cancer development and in later tumor progression. For example, it has been reported that in aberrant crypt foci, morphological alterations in the flat mucosa that are considered early putative preneoplastic lesions (2 , 3) , there is a lack of representation of goblet cells and therefore of the mucus they secrete (4) . These abnormalities are recapitulated in the mouse Apc1638 model (5) , which has a genetically inactivated Apc allele and spontaneously develops intestinal tumors (6) . Qualitative and/or quantitative alterations in mucin glycosylation characterize later stages of colon tumor progression, and the recent availability of probes for the genes that encode mucin peptides has made it possible to study alterations of apomucin expression; both levels and pattern of expression of mucin genes are altered in adenocarcinoma compared with normal tissues, and these changes correlate with the cancer phenotype (7) .
Extensive work from our lab, as well as others, has focused on the regulation of the human MUC2 gene (8, 9, 10, 11, 12, 13) . Sequence analysis of the human MUC2 promoter revealed the presence of several GC boxes, putative binding sites for the Sp family of transcription factors, which have been suggested to play a role in the regulation of the MUC2 gene (11 , 12) . Accordingly, we now report that mithramycin, an inhibitor of Sp1 binding, blocked the expression of MUC2 in the HT29 adenocarcinoma cell line. To prove the role of the Sp family factors in the regulation of MUC2, we extended our work to the cloning, structural analysis, and functional analysis of the promoter of the mouse Muc2 gene, which has not been reported. In our structural characterization of the mouse Muc2 promoter, we have identified a strong sequence homology between the mouse and human genes in the region immediately upstream of the transcription initiation site. This conservation may suggest functional relevance, also indicated by a similar pattern of expression that is shared by the mouse and human MUC2 genes in the intestine of the two species (14) . The mouse proximal promoter region, similar to the corresponding region in the human MUC2 promoter, contains several GC boxes that we show are binding sites for the Sp family of transcription factors, and we show that there are distinct binding patterns of Sp1 and Sp3 to the mouse and human proximal promoters. However, our data demonstrate that the functional difference between the proximal promoter region in the mouse and human MUC2 genes is not attributable to a differential ability of this region to bind members of the Sp family of transcription factors, but rather to the different anatomy of the individual GC boxes in the mouse and human promoters.
| MATERIALS AND METHODS |
|---|
|
|
|---|
To generate the mMuc2/luciferase reporter vectors, different portions
of the 3.5kb sequence upstream of the translational start site, as
shown in Fig. 7
, were cloned into the pGL2basic vector (Promega), which
contain no regulatory elements. The 3.5kb
SacI-NcoI most 5' fragment of the mMuc2 promoter
(Fig. 2A)
was blunt ended at the NcoI site,
corresponding to the AUG initiation codon, HindIII
linkers were added, and the fragment was then cloned into the
HindIII-SacI site of pGL2basic generating the
m-3.5kb construct. The m-3.5kb plasmid was partially digested with
DraIII, blunt ended, and the 1.2kb
DraIII/HindIII fragment was cloned into the
SmaI/HindIII sites of the pGL2basic vector to
generate the m-1.2kb plasmid. A unique PvuII site, present
in both the human and mouse promoters, was used to generate the 140-bp
constructs by cloning the PvuII/HindIII fragment
into the SmaI/HindIII sites of the pGL2 vector
generating the m- and h-0.14kb constructs, respectively.
|
|
Restriction digestion and double-stranded sequencing were carried out to confirm sequences and orientations of all of the constructs.
Cell Culture and Transient Transfection Assay.
HT29 and HeLa cells were grown in MEM supplemented with 10% FCS,
nonessential amino acids, glutamine, and 100 units and 100 mg/ml of
penicillin and streptomycin, respectively. HT29 cells were treated with
F and TPA as described previously (8)
. For mithramycin
treatment, HT29 cells were preincubated with the drug at 100
nM for 16 h before the addition of F and TPA.
For transfection experiments, cells were plated at a density of 5 x 104 cells/well in 24-well plates, and nonliposomal-mediated transfections were performed 2 days later using FuGENE 6 transfection reagent (Boehringer Mannheim). A total of 1 µg of DNA/well, containing 0.5 µg of test plasmid, 0.1 µg of the reference plasmid TK-renilla (to correct for transfection efficiency), and 0.4 µg of carrier plasmid, was mixed with FuGENE 6 in a ratio of 1:3. The Sp1 and Sp3 expression plasmids were a generous gift of Dr. Paolo Dotto, Harvard University, Boston, MA. They were used at a concentration of 100 ng of DNA/well, as determined in pilot titration experiments. After incubation for 15 min at room temperature, the DNA mixture was added dropwise to each well. Fresh media was replaced 24 h later, and cells were harvested 48 h after transfection. The luciferase activity was determined using 520 µl of cell extract with the dual luciferase assay system (Promega), following the manufacturers instructions. The luciferase activity was normalized to the renilla activity and expressed relative to the activity of the control plasmid.
Gel Mobility Shift Assay.
Nuclear extracts were prepared from HT29 cells using the NP40 detergent
lysis buffer and 0.4 M NaCl extraction buffer method, as
described by Schreiber et al. (16)
. Protein
concentration was determined by the Bradford assay (17)
.
All of the oligonucleotides, the coordinates of which are given in
Table 1
, were purified by PAGE. For binding reactions, 5 µg of nuclear
proteins were incubated with 1 µg poly(dI·dC)·poly(dI·dC) and 1
µg poly(dG·dC)·poly(dG·dC) in 20 µl in the presence of 10
fmol of [32P]
ATP end-labeled double-stranded
probe for 20 min at room temperature. Oligonucleotide competition
experiments were performed in the presence of 50-fold excess (500 fmol)
of cold competitor DNA. Supershift experiments were done by
preincubating nuclear extract proteins with antibodies for 1 h at
4°C before the addition of the DNA probe. Polyclonal anti-Sp1
antibody (Sc-59X) and polyclonal anti-Sp3 antibody (Sc-644X; Santa Cruz
Biotechnology) were used for supershift experiments. The nonrelated
antihuman C4d antibody (Quidel) was used as a negative control. To
block Sp1 binding to DNA, DNA probes were preincubated for 1 h at
4°C with different concentrations (100300 nM)
of mithramycin (Sigma Chemical Co.) before being used in binding
reactions. Protein/DNA complexes were fractionated by electrophoresis
in nondenaturing 4% polyacrylamide gels and visualized by
autoradiography.
|
For primer extension analysis, 20 µg of total RNA, isolated from the indicated tissues using Triazol (Life Technologies, Inc.), were annealed to 1 ng of 32P 5' end-labeled oligonucleotide (nt +36/+55 from the AUG; 5'TGGCTAAGGCCAGGACTAGG3') in 10 µl of annealing buffer [20 mM Tris; 0.4 M KCl (pH 8.3)]. The extension reaction was done in 40 µl of 1 x reverse transcription buffer supplemented with 625 µM 2'-deoxynucleoside 5'triphosphates, 4 units of RNasin (Promega), 2.5 mM DTT, and 1 µl of actinomycin D (1 mg/ml) in the presence of 0.2 µl of reverse transcriptase II (Life Technologies, Inc.) at 42°C for 1.5 h, followed by RNase A digestion. The extension product was precipitated and analyzed by denaturing PAGE alongside sequencing reactions generated using the same primer.
| RESULTS |
|---|
|
|
|---|
|
To determine the transcription start site of the mMuc2 mRNA and hence
delineate the upstream promoter region, we used a primer extension
analysis that detected a single extension product in RNA isolated from
colon and small intestine but not in RNA from stomach and kidney, where
Muc2 is not expressed, as shown in Fig. 3
. The mMuc2 mRNA start site mapped to a G residue located at position
-29 from the ATG. A similar initiation site for transcription has been
reported for the rat and human MUC2 genes (15
, 19)
.
|
The Proximal Promoter Region of the Mouse and Human
MUC2 Genes Shows Distinct Binding Properties to Members
of the Sp1 Family.
To investigate whether the GC boxes identified in the mouse and human
proximal region represented Sp1-binding sites, we designed
oligonucleotides to be used in gel shift assays that span approximately
300 nts of the proximal promoter region. These oligonucleotides were
numbered progressively 1 to 6 starting from the ATG codon, and their
coordinates are given in Table 1
.
Fig. 4A
shows the result of a representative experiment using human
oligonucleotide 1, which contains a potential Sp1-binding site, and
nuclear extract from HT29 cells. A lower mobility band (complex I) and
two faster migrating bands (complexes II and III) were observed which
could be competed specifically by 50-fold molar excess of cold
oligonucleotides 1 and 3 but not of an unrelated oligonucleotide. These
bands were competed as well by human oligonucleotide 2, which also
harbors sequences related to the Sp1-binding site, although at lower
efficiency. Oligonucleotides 4 and 5, which do not contain Sp1-related
binding sites, did not affect any complex formation. In addition, an
oligonucleotide containing the Sp1 consensus binding site completely
abolished the formation of all of the DNA-protein complexes (compare
Lane 1 versus Lanes 2 and 7).
To identify which member of the Sp1-related family was present in these
complexes, we used an antibody specific for Sp1. Preincubation of
nuclear extract with the anti-Sp1 antibody resulted in a specific
supershift of complex I, leaving complexes II and III unaffected (Fig. 4A)
, which demonstrates that the upper band contained Sp1,
whereas the lower bands might harbor other members of the Sp1 family
(see below) as indicated by the competition experiments. An unrelated
antibody (hC4d) did not affect the formation or migration of any
complex.
|
To ascertain whether other members of the Sp1 family were present in
the additional DNA-protein complexes observed with the human and mouse
oligonucleotides, which were specifically competed by the Sp1 consensus
oligo, we performed gel shift experiments in the presence of an
antibody that specifically recognizes the Sp3 factor. As shown in Fig. 5
, the formation of complex II with human oligo 1 (Fig. 5A)
and 3 (Fig. 5B)
as probes was abolished by the presence of
anti-Sp3 antibody in the reaction, indicating that the antibody
recognizes an epitope required for DNA interaction. The formation of
complex I, which contains Sp1, was unaffected. Conversely, anti-Sp3
antibody had no effect on the formation of any complexes when mouse
oligos 2 and 1 were used as probes (Fig. 5A
; and data not
shown), but it blocked complex II formation with mouse oligo 3 as a
probe (Fig. 5B)
.
|
Mouse and Human Proximal Promoter Regions Display Different
Functional Activity.
The different binding pattern of Sp1 and Sp3 to oligos spanning the
proximal promoter region of the mouse and human genes prompted a closer
inspection of the human and mouse DNA sequences in this region.
Although the homology 1 region is the most conserved between the mouse
and human 5' untranscribed DNA, there is a lack of homology in the
sequence surrounding the conserved TATA box region. In the mouse
promoter at nt position -80 (Fig. 2C)
, there is a Sp1/AP2
site, conserved in the rat Muc2 promoter but not in the human sequence,
which has been reported essential for the expression of the rat
Muc2 gene in SPOC cells, a tracheobronchial cell line
(20)
. To investigate the functional significance of this
difference, we cloned a short fragment from the ATG to -0.14 kb,
comprising the region of interest that included Sp1-binding sites as
determined by our gel shift experiments, from both the human and mouse
promoters into pGL2basic and compared its activity with that of
reporter vectors harboring additional upstream untranscribed DNA. All
of the reporter plasmids contain mMuc2 5'untranscribed DNA
regions starting at the initiation of translation (+1) and extending
upstream as represented schematically in Fig. 6A
. The different constructs were transiently transfected into
HT29, an adenocarcinoma cell line. The m-0.14kb construct showed the
same level of activity as the longer -1.2kb plasmid, which was
slightly lower than that associated with the -3.5kb vector that
contained all four regions of homology between the mouse and human
promoter (Fig. 6B)
. In contrast, the human h-0.14 kb was
only half as active as the longer h-0.3kb construct, which displayed
maximal transcriptional activity as reported previously
(11)
.
|
The Proximal Promoter Regions of the m and
hMUC2 Gene Are Equally Responsive to Overexpression of
Sp1 and Sp3.
Mithramycin inhibits binding of both Sp1 and Sp3, and both
factors have been shown by gel shift analysis to form complexes of
distinct characteristics with the proximal promoter region of the mouse
and human genes (Fig. 4
5)
. Therefore, we investigated whether the
different functional activity of the mouse and human -0.14kb reporters
was a direct consequence of the different binding pattern of Sp1 and
Sp3 to this promoter region in the two species by assessing the effect
of Sp1 and Sp3 overexpression on the m- and h-0.14kb vector activity.
As shown in Fig. 7
, the activity of both the wt m- and h-0.14kb reporters was stimulated
by overexpression of either Sp1 or Sp3, consistent with the gel shift
analysis, demonstrating that both factors can bind to the proximal
promoter regions of the MUC2 gene in the two species.
Stimulation by Sp3 was consistently 23-fold higher than that observed
with Sp1 overexpression, both for the mouse and human constructs. In
addition, no interference was observed when the two transcription
factors were coexpressed. However, mutation of the Sp1/Ap2 site in the
mouse reporter abolished the ability of Sp1 to enhance the activity of
the m-0.14kb vector, whereas the same mutation only partially affected
the induction mediated by Sp3, thus functionally demonstrating that the
GC box at -80 in the mouse DNA is an Sp1-binding site.
| DISCUSSION |
|---|
|
|
|---|
Comparative analysis of the mouse and human 5' untranscribed region of DNA identified four nonadjacent segments that show a high degree of sequence conservation between the mouse and human promoters that may contribute to the similar pattern of expression observed for the mouse and human MUC2 gene both in vivo (14) and in vitro (this report and Ref. 11 ). The proximal promoter region reveals the presence of several putative binding sites for known transcription factors. Most notable is the presence of several GC-rich boxes that we show are binding sites for members of the Sp family of transcription factors. The location and composition of several of these Sp-binding sites are maintained in the mouse and human genes. In agreement, the importance of the Sp-binding sites in the expression of the MUC2 gene is clearly demonstrated by our data, which shows that mithramycin, an inhibitor of Sp1/Sp3 binding, blocks the expression of MUC2 in HT29 cells.
By a combination of gel shift analysis, site-directed mutagenesis, and overexpression of Sp1 and Sp3, we identified the relative contribution of individual GC boxes and of the factor they bind to the regulation of the mouse Muc2 gene, which appears to be different in the two species.
We show that oligonucleotides spanning the region from +1 to -170 of the mouse and human promoters (oligos 13) form complexes with Sp1. However, although the human oligos, which span this region, can also form Sp3-specific complexes, only mouse oligo 3 can bind Sp3. Both human and mouse oligo 3 contain the sequence GCCACACCCA, which was shown by Gum et al. (12) to form at least two distinct complexes, the slower one specifically containing Sp1. The pattern is very similar to both the human and mouse oligo 3, and thus the fast migrating form most likely represents Sp3/DNA complexes, as shown by our data.
Accordingly, we show that the basal level of activity of a minimal mouse promoter (m -140kb vector) is increased by both Sp1 and Sp3 overexpression, the latter having a larger effect. However, our data suggest that the mouse Sp1 is the major contributor to the regulation of the basal activity of the mMuc2 promoter and acts, at least in part, through the Sp1/Ap2 site located at -80 in the mouse sequence, because mutation of the Sp1/AP2 site greatly reduces the basal activity of the m-0.14kb vector. This Sp1/Ap2 site is very well conserved structurally and functionally in the rat MUC2 promoter (20) but not in the human sequence. Moreover, mutation in the Sp1/Ap2 site eliminates the enhancement by Sp1 overexpression, although it only partially affects induction by Sp3 overexpression.
Finally, we show that, similar to the mouse promoter, the human proximal promoter region is activated by Sp1 and Sp3 overexpression demonstrating that the distinct binding patterns of Sp1 and Sp3 to the mouse and human proximal promoters do not directly determine their different transcriptional potency. However, our mutational analysis has identified the -80 GC box in the mouse sequence as responsible for the higher activity of the proximal promoter of mouse compared with human. Because this Sp1-binding site is intertwined with a putative AP2-binding site not conserved in the human sequence, it is possible that the anatomy of the GC box, distinct in the mouse and human, dictates the different functional properties of the proximal promoter region of the Muc2 gene in the two species. This may be due to differential physical and/or functional interactions with other transcription factors, as it has been reported for other genes.
There is growing evidence that the Sp family plays an important regulatory function during proliferation and differentiation as the level of expression of members of this family is regulated during development and in different cell types (21) and participates in the regulation of genes that are both ubiquitously expressed as well as those expressed in a tissue-specific manner (22) . Furthermore, several studies have demonstrated that Sp1 mediates activation of target genes in response to exogenous stimuli (23) , including oncogenes such as Ras (24) and Rb (25) and that its activity is enhanced in some tumors (26) . Finally, an additional level of regulation may be exerted through the ability of Sp1 to prevent methylation of CpG islands, which are particularly enriched in GC boxes, and to alter the organization of chromatin structure (27 , 28) , thus establishing transcriptional competence of target genes. It is worth noting that the status of methylation of the proximal promoter of the human MUC2 gene contributes to the level of expression of the hMUC2 gene in cell lines derived from colonic tumors (29) . Thus, it is tempting to speculate that in mucinous tumors the activity of Sp1 may be altered and participate in the deregulation of MUC2 expression through direct transcriptional activation, and/or establishment of transcriptional competence of the locus.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by Grants CA 72835, CA 68965, and P30
13330 from the National Cancer Institute. ![]()
2 To whom requests for reprints should be
addressed, at Department of Oncology, Montefiore Medical Center, 111E
210th Street, Bronx, NY 10467. Phone: (718) 920-2149; Fax:
(718) 882-4464; E-mail: velcich{at}aecom.yu.edu ![]()
3 The abbreviations used are: nt, nucleotide; wt,
wild-type; F, forskolin; TPA,
12-O-tetradecanoylphorbol-13-acetate; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; poly(dI·dC),
poly(deoxyinosinic-deoxycytidylic acid); poly(dG·dC),
poly(deoxyguanosine-deoxycytidylic). ![]()
Received 7/13/00. Accepted 11/10/00.
| REFERENCES |
|---|
|
|
|---|
2(I) collagen to transforming growth factor-ß1. J. Biol. Chem., 272: 19738-19745, 1997.This article has been cited by other articles:
![]() |
S. M. Reamon-Buettner and J. Borlak Epigenetic Silencing of Cell Adhesion Molecule 1 in Different Cancer Progenitor Cells of Transgenic c-Myc and c-Raf Mouse Lung Tumors Cancer Res., September 15, 2008; 68(18): 7587 - 7596. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. C. Wu, R. Wu, Y. Chen, N. Tarasova, and M. M. J. Chang PMA Stimulates MUC5B Gene Expression through an Sp1-Based Mechanism in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., November 1, 2007; 37(5): 589 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Brouland, P. Gelebart, T. Kovacs, J. Enouf, J. Grossmann, and B. Papp The Loss of Sarco/Endoplasmic Reticulum Calcium Transport ATPase 3 Expression Is an Early Event during the Multistep Process of Colon Carcinogenesis Am. J. Pathol., July 1, 2005; 167(1): 233 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Yang, A. Velcich, I. Lozonschi, J. Liang, C. Nicholas, M. Zhuang, L. Bancroft, and L. H. Augenlicht Inactivation of p21WAF1/cip1 Enhances Intestinal Tumor Formation in Muc2-/- Mice Am. J. Pathol., April 1, 2005; 166(4): 1239 - 1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gaudier, A. Jarry, H. M. Blottiere, P. de Coppet, M. P. Buisine, J. P. Aubert, C. Laboisse, C. Cherbut, and C. Hoebler Butyrate specifically modulates MUC gene expression in intestinal epithelial goblet cells deprived of glucose Am J Physiol Gastrointest Liver Physiol, December 1, 2004; 287(6): G1168 - G1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sekar and J. D. Veldhuis Involvement of Sp1 and SREBP-1a in transcriptional activation of the LDL receptor gene by insulin and LH in cultured porcine granulosa-luteal cells Am J Physiol Endocrinol Metab, July 1, 2004; 287(1): E128 - E135. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mesquita, N. Jonckheere, R. Almeida, M.-P. Ducourouble, J. Serpa, E. Silva, P. Pigny, F. S. Silva, C. Reis, D. Silberg, et al. Human MUC2 Mucin Gene Is Transcriptionally Regulated by Cdx Homeodomain Proteins in Gastrointestinal Carcinoma Cell Lines J. Biol. Chem., December 19, 2003; 278(51): 51549 - 51556. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gazzoli and R. D. Kolodner Regulation of the Human MSH6 Gene by the Sp1 Transcription Factor and Alteration of Promoter Activity and Expression by Polymorphisms Mol. Cell. Biol., November 15, 2003; 23(22): 7992 - 8007. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perez, R. Barco, I. Fernandez, S. A. Price-Schiavi, and K. L. Carraway PEA3 Transactivates the Muc4/Sialomucin Complex Promoter in Mammary Epithelial and Tumor Cells J. Biol. Chem., September 19, 2003; 278(38): 36942 - 36952. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ookawa, T. Kudo, S. Aizawa, H. Saito, and S. Tsuchida Transcriptional Activation of the MUC2 Gene by p53 J. Biol. Chem., December 6, 2002; 277(50): 48270 - 48275. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zen, K. Harada, M. Sasaki, K. Tsuneyama, K. Katayanagi, Y. Yamamoto, and Y. Nakanuma Lipopolysaccharide Induces Overexpression of MUC2 and MUC5AC in Cultured Biliary Epithelial Cells : Possible Key Phenomenon of Hepatolithiasis Am. J. Pathol., October 1, 2002; 161(4): 1475 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Perrais, P. Pigny, M.-C. Copin, J.-P. Aubert, and I. Van Seuningen Induction of MUC2 and MUC5AC Mucins by Factors of the Epidermal Growth Factor (EGF) Family Is Mediated by EGF Receptor/Ras/Raf/Extracellular Signal-regulated Kinase Cascade and Sp1* J. Biol. Chem., August 23, 2002; 277(35): 32258 - 32267. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Velcich, W. Yang, J. Heyer, A. Fragale, C. Nicholas, S. Viani, R. Kucherlapati, M. Lipkin, K. Yang, and L. Augenlicht Colorectal Cancer in Mice Genetically Deficient in the Mucin Muc2 Science, March 1, 2002; 295(5560): 1726 - 1729. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Perrais, P. Pigny, M.-P. Ducourouble, D. Petitprez, N. Porchet, J.-P. Aubert, and I. Van Seuningen Characterization of Human Mucin Gene MUC4 Promoter. IMPORTANCE OF GROWTH FACTORS AND PROINFLAMMATORY CYTOKINES FOR ITS REGULATION IN PANCREATIC CANCER CELLS J. Biol. Chem., August 10, 2001; 276(33): 30923 - 30933. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |