| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
The Joseph Gottstein Memorial Cancer Research Laboratory, Departments of Pathology and Biochemistry, University of Washington School of Medicine, Seattle, Washington 98195-7705
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Several 5-FdUR and antifolate-resistant TS enzymes have been created in the last 2 years (5, 6, 7, 8, 9) . Recently, three novel human drug resistant TS mutants (D49G, G52S, and K47E) were identified via EMS mutagenesis of human sarcoma HT1080 cells (5) . The mutations are located in the highly conserved Arg50-loop, a loop that forms a bridge linking the enzyme COOH-terminus, cofactor, and cosubstrate together and undergoes reorientation upon binding the phosphate moiety of dUMP to accept the incoming folate molecule (10, 11, 12) . The resultant enzymes demonstrate a high degree of resistance to both 5-FdUR and the antifolate Thymitaq (AG337).
In the present study, we generated human TS mutants of the Arg50-loop and residue Tyr 33 through random mutagenesis. These mutants were selected for their ability to confer growth of E. coli in the presence of 5-FdUR. Those able to survive at the highest dosages were expressed in E. coli, purified, and characterized by kinetic studies in vitro. Our results indicate that the Arg50-loop is highly mutable, and many of the mutants are highly resistant to 5-FdUR.
The sensitivity of normal human cells, particularly bone marrow cells, is a major limiting factor in chemotherapy by 5-FU. Gene therapy holds promise in boosting the resistance of these cells to the cytotoxic effects of chemotherapeutic agents. The potential for bone marrow protection has been strengthened by gene transfer experiments in relevant mammalian cells, such as hematopoietic stem cells, and, in some cases, by success in animals (13, 14) . Our goal is to create novel TS enzymes for ex vivo gene therapy that could reduce the myelosuppression observed after treatment with 5-FU.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2913recA (
thyA572, recA56),
kindly provided by Dr. Daniel Santi (University of California, San
Francisco, CA), is tetracycline resistant and was used in all of the
complementation studies and in the purification of plasmid-encoded TS.
Unless otherwise stated, all of the DNA oligodeoxyribonucleotides were
from Operon Technologies (Alameda, CA).
Plasmids.
Plasmid pGCHTS-TAA, from Dr. Daniel Santi, contains the wild-type TS
cDNA in a pUC vector background and has been described
previously (10
, 15)
. A nonfunctional
Arg50-TS stuffer vector that spans the residues
targeted for randomization was created by replacing the TS open reading
frame between nucleotides 94 (NcoI site) and 183
(SphI site) with a 920-bp fragment derived from the
pET34-LIC vector (Novagen, Madison, WI). The DNA insert was prepared by
digestion of pET34-LIC with NcoI and SphI,
purified using the Qiaquick PCR spin kit (Qiagen, Chatsworth, CA), and
ligated into the NcoI-SphI-digested TS vector.
Construction of the TS Random Library.
The TS random library was constructed by annealing two
single-stranded DNA oligodeoxyribonucleotides, both containing
randomized nucleotide segments. Random oligomer
TS-R50-Nco is a 67-mer that
corresponds to the sense nucleotides 71137 and contains a
NcoI site (nucleotide 94) for cloning. It is
5'-d(GCGTCCGCCCCATGGTGAACTGCAGTACCTGGGGCAGATCCAACACATCCTCCGCTGCGGCGTCAGG)-3',
and it contains partially random nucleotides (underlined) corresponding
to residue 33 of TS. Oligomer
TS-R50-Sph is a 67-mer that
corresponds to the antisense nucleotides 126192 and contains a
SphI site (nucleotide 183) for cloning. Its sequence is
5'-d(AGCGCGCCTGCATGCCGAATACCGACAGGGTGCCGGTGCCCGTGCGGTCGTCCTTCCTGACGCCGCA)-3',
and it contains partially randomized nucleotides (underlined)
corresponding to the Arg50-loop residues 4752.
All of the partially randomized nucleotides were designed to contain
80% of the wild-type base and 20% of the remaining three nucleotides.
These oligodeoxyribonucleotides were synthesized by Integrated DNA
Technologies (Coralville, IA). Oligomers TS-R50-Nde and
TS-R50-Sph were annealed in 50 µl of 200
mM Tris-HCl (pH 7.5), 100
mM MgCl2, 250
mM NaCl by incubation at 80°C for 5 min,
followed by 55°C for 15 min, at 37°C for 15 min, and at room
temperature for 15 min. The partial oligonucleotide duplex was extended
in a 40-µl reaction mixture that contained 10
mM Tris-HCl (pH 7.5), 5 mM
MgCl2, 7.5 mM DTT, 250
µM deoxynucleotide triphosphates, and 5 units
Klenow fragment of E. coli DNA Pol I for 2 h at 37°C.
The extended DNA was purified using the Qiaquick PCR Purification Kit,
digested with NcoI (New England Biolabs) and SphI
(New England Biolabs), and purified by phenol extraction and ethanol
precipitation.
Replacement of the Wild-Type TS Sequence with the Random Library.
The purified partially random oligonucleotides were used as
inserts for construction of the human TS plasmid library. The
nonfunctional "stuffer" insert was removed by digestion with
SphI and NcoI, and the resulting 3.6-kb fragment
was ligated with a 5:1 molar excess of the 122-bp restricted random
insert using T4 DNA ligase (Life Technologies, Inc.). The ligation
mixture was directly transformed (Bio-Rad Genepulser; 2 kV, 25
microfarads, 400 ohm) into fresh electrocompetent NM522 cells
(Stratagene) in 20 separate transformations using 2 µl of the
ligation mixture and 100 µl NM522 E. coli. After combining
the transformation reactions, the size of the library that contained
the TS plasmid was determined by plating an aliquot transformation
mixture on media that contained carbenicillin (50 µg/ml; Island
Scientific, Bainbridge Island, WA). The remainder of the library
was amplified by growing the transformed NM522 cells overnight in
2 x YT media in the presence of carbenicillin,
and the plasmid was harvested. Electrocompetent
2913
(TS-) cells were transformed with the plasmid
library, pooled, plated to confirm adequate transformation efficiency,
grown overnight in 50 µg/ml carbenicillin, 12.5 µg/ml tetracyline,
and 50 µg/ml thymidine, and stored in aliquots at -80°C in 10%
glycerol. The extent of randomization was verified by sequencing
plasmid DNA isolated from 24 clones of NM522 E. coli cells
that contained the random library. DNA was isolated using a Qiagen
Miniprep kit, and sequencing reactions were conducted with the ABI
Prism Dye Terminator Cycle Sequencing Kit with AmpliTaq DNA polymerase
using the sequencing primer DLPCRTS3R,
5'-d(AAAAAAAAACCATGTCTCCGGATCTCTGGTAC)-3'.
Genetic Selection.
For selection of active TS, thawed
2913 cells that contained the
random library were inoculated (1:100) into 1 x YT
medium that contained 50 µg/ml thymidine, 50 µg/ml carbenicillin,
and 10 µg/ml tetracycline, and grown at 37°C until the absorbance
at 600 nm attained a value of 0.8 to 1.0. Aliquots of 1 ml of the
exponentially growing cells were pelleted and resuspended in M9 salts,
plated on minimal medium that contained appropriate antibiotics, and
incubated at 37°C for 36 h. Plasmid DNA was isolated from 66
surviving colonies, and the corresponding random region was sequenced.
To select for library members that are resistant to killing with
5-FdUR, transfectants were plated on the above described minimal medium
that contained increasing amounts of 5-FdUR (0175 nM
5-FdUR) and incubated at 37°C for 36 to 48 h. Colonies formed on
5-FdUR that contained agar plates were isolated, and the plasmid from
each clone was retransformed into fresh
2913 E. coli to
confirm the drug-resistant phenotype. Each retransformed bacterium was
then subjected to the same selection procedure. Plasmid DNA from cells
that survived 175 nM FdUR (n = 70), which is lethal to E. coli harboring the
wild-type TS, was sequenced.
Determination of TS Expression Level.
From a fresh overnight culture,
2913 cells that contained the
wild-type or mutant forms of TS were grown in 30 ml 2 x YT medium that contained carbenicillin. After attaining an absorbance
at 600 nm of 0.8, cells were harvested by centrifugation, resuspended
in 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 200
mM NaCl, 10% glycerol, and 200 µg/ml lysozyme,
aliquoted, and stored at -80°C. Frozen cells were thawed and lysed
on ice for 3 h, centrifuged (27,000 x g), and the pellet discarded. Quantitation of active TS
dimer was determined by [3
H]-5-FdUMP binding.
Crude extracts (50 µl) were incubated with 600
mM
CH2H4-folate and 300
nM [3
H]-5-FdUMP in a
standard reaction (500 ml) that contained 50 mM
N-tris[hydroxymethyl]methyl-2-aminoethane-sulfonic acid
(pH 7.4), 20 mM MgCl2, 6.5
mM formaldehyde, 1 mM EDTA,
and 150 mM 2-mercaptoethanol. The specific
activity of [3
H]-5-FdUMP was 18.6 Ci/mmol.
After incubation for 1 h at room temperature, 125 µl 50%
trichloroacetic acid was added, and the mixture was centrifuged
at 13,000 x g for 5 min. The pellet was
washed four times with 10% trichloroacetic acid, resuspended in a
mixture of 2 M NaOH/50% ethanol, and added to 5
ml Scinti-Verse scintillation fluid (Fischer), and the radioactivity
was quantitated. For calculations, we assumed 1.7 mol FdUMP bound to 1
mol of TS (7, 8)
. The assay was repeated using one-half of
the amount of crude extract to ensure
[3
H]-5-FdUMP saturation. Reactions were
conducted in duplicate. No counts above background were detected in a
control reaction incubated in the absence of cell extract. Quantitation
of purified wild-type TS was conducted as a control and was in
agreement with the concentration obtained by the dye-binding procedure
of Bradford. Total protein in the crude extracts was quantitated using
the Bradford assay.
Purification of Wild-type and Mutant TS.
To construct a plasmid expressing the mutant TS enzymes linked to a
6X-His polypeptide, the TS mutants were digested with MroI
and NcoI and ligated into a digested pHis-TS-WT construct.
pHis-TS-WT was constructed via PCR amplification of TS, creation of a
SalI restriction endonuclease site, digestion with
NdeI and SalI, and ligation into the similarly
digested vector pHis (a modified pUC12 vector provided by Amnon Hizi,
Tel Aviv University, Tel Aviv, Israel). Details of its
construction have been described previously (7)
. Cloning
procedures were confirmed by restriction analysis and DNA sequencing.
The TS-6X-His fusion proteins were purified by a one-step
Ni2+ affinity chelation chromatographic procedure
using resin and buffers (His-Bind resin and buffer kit; Novagen)
according to a previously described protocol (7)
modified
from that of the supplier. An overnight culture of approximately 125 ml
yielded from 400 to 600 µg of purified TS. After SDS polyacrylamide
gel analysis and dialysis, the concentration of purified TS was
determined by using the Bradford assay.
Kinetic Analysis of TS Mutants.
TS activity was monitored spectrophotometrically by the increase in
absorbance at 340 nm that occurs concomitant with the production of
H2-folate (
= 6400
M-1 cm-1;
Ref. 16, 17
). The standard reaction buffers and
methodology have been described previously (7)
. When the
concentration of dUMP was varied, a high concentration of
(6R,S)-CH2H4-folate
(6002400 µM) was added; when
CH2H4-folate was varied,
the concentration of dUMP was 500 µM.
CH2H4-folate was added to
initiate the reaction at 25°C. Michaelis constants
(Km) for
CH2H4-folate and dUMP were
determined from initial velocity measurements, obtained on a
Perkin-Elmer Lamba Bio 20 UV/Vis spectrophotometer. Steady state
kinetic parameters were subsequently obtained by a nonlinear least
squares fit of the data to the Michaelis-Menten equation using
Kalidegraph 3.0 software (Abelbeck Software, Reading, PA).
kcat values were obtained by dividing
the specific activity (Vmax/mg
protein) by the molecular weight of enzyme.
Kis for 5-FdUMP were obtained from the steady-state inhibition reaction rates for mixtures of enzyme, dUMP, CH2H4-folate, and inhibitor at 25°C. A constant dUMP concentration of 500 µM was used, and FdUMP concentrations were varied to measure inhibition by FdUMP. To initiate reactions, CH2H4-folate was added to a final concentration of 600 µM for all of the mutants with the exception of K47Q;D48E, where 1200 µM CH2H4-folate was used.
| RESULTS |
|---|
|
|
|---|
Sequencing of Nonselected Clones to Determine Library Diversity.
Before selection, plasmid DNA was isolated from 24 transformed clones
and sequenced. The number of substitutions/clone is presented in Table 1
, and the types of substitutions are tabulated in Fig. 1A
. An average of 5.1 nucleotide changes and 2.8 amino acid
changes/clone were detected in the nonselected library (Table 1)
. Amino
acid substitutions in the nonselected clones were approximately evenly
distributed among the seven residues encoded by the randomized
nucleotides (Fig. 1A)
. The least number of substitutions
were observed at G52. Four of the 24 nonselected clones analyzed (17%)
contained frameshift mutations (all were deletions), and three
contained termination codons. On the basis of the number and frequency
of random substitutions, we calculated that the probability of
obtaining a wild-type nucleotide sequence in the nonselected library is
approximately 1%. The likelihood of obtaining a wild-type protein is higher because of the degeneracy of the nucleotide code and is
approximately 4.5%. Therefore, it is not surprising that no wild-type
molecules were detected among the 24 sequenced nonselected clones.
|
|
Selection of Mutants Resistant to Fluorodeoxyuridine.
To isolate members from the random enzyme library that exhibit enhanced
resistance to 5-FdUMP, positive genetic selection was again used by
plating on minimal medium agar plates that contained gradients of
5-FdUR. Previously, we reported (7, 8)
that the survival
of the E. coli harboring wild-type TS is only modestly
reduced to 90% at 75 nM 5-FdUR; however,
it precipitously declines to 0.1% at 100
nM of the analogue. Consistent with these
results, no clones harboring wild-type TS enzyme formed colonies on
media that contained >100 nM 5-FdUR (Fig. 2)
. At 100 nM 5-FdUR, approximately 60% of the
random library formed colonies. Library survival decreased linearly, to
40% at 150 nM 5-FdUR and 8% at 175
nM 5-FdUR.
|
Whereas wild-type TS represented 10% of the active mutant library, no wild-type enzymes were detected among the 70 5-FdUR survivors. Seven mutants were detected twice in the library (D48E, D48E;D49G, D48E;T51S, T51S;G52S, D48F;T51S;G52C, D48Y;T51S;G52A and K47E). One mutant, K47N, was detected three times. In all of the cases but two, the clones isolated were unique, as indicated by silent changes (nucleotide substitutions that did not alter the protein sequence) in other nucleotides within the random region. Thus these 70 mutants isolated from the 5-FdUR resistant clones, which harbored anywhere from one to three amino acid changes, were independently created and selected among 1.5 million original mutants.
It is apparent from Fig. 1C
that many alterations lead to
drug resistance. Mutants harboring a single amino acid change included:
K47Q, K47E, D48E, G52S, and G52P. Interestingly, T51S was not detected
as a single mutant despite being the single most common change seen in
the library. However, the alteration T51S was often detected in concert
with the mutation G52S. Examples include T51S;G52S, D48G;T51S;G52S, and
D49E;T51S;G52S. T51S;G52S was detected twice, with unique silent
nucleotide changes, in the library. As was observed among active
mutants, changes at Arg 50 and Tyr 33 were rare and never occurred in
the absence of other alterations. The only mutation at Y33 in the
drug-selected clones was to tryptophan in the clone D48E;Y33W.
Several mutants were manually screened at increasing doses of
5-FdUR (Fig. 2)
. The previously identified drug-resistant mutant
A197V;L198I;C199F was used as a positive control (7)
. This
mutant, which was found to have a Kd
for 5-FdUMP 20 times greater than that of wild type, formed colonies at
dosages up to but not above 150 nM, consistent
with previous observations (Fig. 2A
; Ref.
7, 8
). The single mutants D48E and G52S formed colonies in
media that contained as much as 200 nM 5-FdUR
(Fig. 2A)
. The mutant G52C was identified in the active
mutant pool. Because of the published importance of alterations at G52
in conferring drug resistance (5)
, this single mutant was
manually screened and demonstrated drug resistance up to 175
nM 5-FdUR (Fig. 2A)
. Interestingly,
with one exception, the multiple mutants demonstrated improved
colony-forming ability compared with the single mutants. K47Q;D48E
formed colonies at up to 250 nM 5-FdUR;
D48E;T51S;G52C at up to 300 nM; and lastly
T51S;G52S grew at up to 400 nM (Fig. 2B)
. The exception is the single mutant K47E, also
identified by Tong et al. (5)
, which formed
colonies at 400 nM.
To rule out that TS overexpression in the transfected E.
coli contributed to the observed drug resistance, multiple clones
of the wild-type and mutant-transfected
2913 cells were analyzed
using a [3
H]-FdUMP binding assay
(18)
. The wild-type and single mutant G52S demonstrated
the highest level of expression (6.3 and 5.1 ng TS/µg total protein),
four times that of the double and triple mutants (range 1.31.9 ng
TS/µg total protein). However, these two proteins demonstrated the
lowest survival against 5-FdUR in E. coli. These results
suggest that the major reason for the observed improvement in survival
at dosages of 5-FdUR clearly lethal to the wild-type TS can be
attributed to the mutation in TS rather than to its level of
expression.
Purification and Kinetic Analysis of Mutant Enzymes.
Because augmented survival in E. coli could potentially
result from mechanisms unrelated to altered enzymology, we purified the
wild-type and four mutant enzymes as NH2-terminal
fusions with a histidine tag. After purification, a single major
component on SDS polyacrylamide gel migrating with an apparent
molecular weight of human TS monomer
(Mr 36,000) was observed for
the wild-type and mutant enzymes. Purity was estimated to be >80%.
To obtain information about the catalytic and ligand-binding properties
of these TS variants, the Vmax and
Km values for the substrate and
cofactor and Ki values for the
inhibitor 5-FdUMP were determined (Table 2)
. Kinetic parameters of the single mutant G52S were consistent with the
findings of Tong et al. (5)
. All of the mutants
were catalytically efficient, with the lowest
kcat measuring approximately half that
of the wild-type enzyme.
|
| DISCUSSION |
|---|
|
|
|---|
In contrast, relatively few changes were observed in
evolutionarily highly conserved residues Tyr 33, Arg 50, and Thr 51.
The only alterations detected at Tyr 33 were to cysteine and serine in
the active clones and to tryptophan (as D48E;Y33W) in the
drug-resistant clone. Although substitutions at Tyr 33 have not been
extensively studied, the mutant Y33H results in an enzyme with an
8-fold decrease in kcat, a
Kd value for the inhibitor 5-FdUMP of
four times that of the wild type, and a near normal affinity for dUMP
and the cosubstrate (21, 22, 23)
. Residue 33, a Tyr in all of
the species of TS except Lactobacillus Lactis, is
located within the
-helix A and forms hydrogen bonds with residues
of the
-helix J which forms a wall of the active site cavity
(24, 25)
. Our study did not confirm the Y33H alteration
nor find other substitutions at this residue that were highly
associated with drug resistance. Given the role of Arg 50 in
maintaining the bound structure, we find it remarkable that even a
modest breadth of residue substitutions were detected (Pro, Ser, Asn,
Trp, Gly). None of these were single mutations, preventing us from
ruling out the effects of complementary changes in the loop. However
R50P, R50G, and R50S have been constructed as single mutants via
site-directed mutagenesis and determined to be active via E.
coli complementation (4
, 26)
.
Although it was not found as a single substitution in the drug-resistant library, T51S was the most common substitution observed. It occurred synergistically with many changes, notably G52S. Also, survival data indicate that clones tested with the T51S alteration appear to demonstrate colony-forming ability in E. coli at the highest doses of 5-FdUR. After binding of the substrates, it has been observed that reorientation of the Arg50- loop allows for the interaction of hydrophobic atoms of Thr 51 to contact the buried V313 side chain (10, 11, 12 , 19 , 27) . Mutation to serine could alter the conformation of this absolutely required terminal valine or nearby residues.
Remarkably, it appears that mutants that contain multiple amino acid
changes survive at higher dosages of 5-FdUR than their corresponding
single mutants. For example, G52S and D48E both formed colonies up to
200 nM, and G52C to 175 nM, but the double
mutants T51S;G52S and D48E;T51S;G52C formed colonies at 400 and 300
nM 5-FdUR, respectively (Fig. 2 A and B)
. This is in agreement with the observation that the
average number of amino acid changes increases in the drug-resistant
library (2.2 amino acid alterations/clone) relative to the active
mutant library (1.7 amino acid changes/clone; Table 1
). The increase in
the average number of amino acid changes is not solely
attributable to elimination of the wild-type enzyme; the relative
proportion of mutants with three and four changes is greater than that
of the active mutant library (data not shown).
In our sequencing of 70 drug-resistant mutants, we did not detect the
single mutant D49G, identified by Tong et al.
(5)
. However, this mutation was detected in concert with
other alterations. All of the mutants analyzed survived not only at
concentrations of 5-FdUR prohibitive for the growth of wild-type TS, as
expected, but at concentrations higher than the previously reported
active site mutant that we identified A197V;L198I;C199F
(7)
. Thus these novel mutants appear in our hands to be
the most highly 5-FdUR-resistant TS enzymes to date. The observed small
number of colonies at high concentrations of 5-FdUR (Fig. 2)
may be
attributable to local perturbations in concentration of 5-FdUR caused
by adjacent nondividing cells or scavenging of thymidine from the
adjacent cells in plates.
Binding studies that used [3 H]-FdUMP demonstrated that the increased survival was not because of preferential overexpression of the mutant TS forms. Expression of G52S was approximately equivalent to that of the wild-type TS, whereas enzyme levels of the three remaining mutants analyzed were approximately 4-fold less than wild type. This could be attributable to decreased intrinsic stability and preferential degradation of mutants with two to three amino acid changes as compared with the wild-type or single mutant G52S.
Kinetic Parameters of Mutant Thymidylate Synthases.
On the basis of both robust survival in E. coli and the
substitutions encoded, we selected three mutants (T51S;G52S,
D48E;T51S;G52C, and K47Q;D48E) alongside the wild type and the
previously identified G52S, for purification and kinetic studies. Each
of these mutant TSs were catalytically active, with no mutant
displaying more than a 50% decrease in
kcat.
Km values for dUMP for all of the
mutants were approximately five times the wild type, with the exception
of K47Q;D48E (Km
20 times wild
type). CH2H4-folate
affinity appeared to follow the same pattern as dUMP affinity. G52S
demonstrated a Km for
CH2H4-folate not
significantly different from wild type, consistent with that observed
by Tong et al. (5)
. However, the same
alteration in combination with T51S (T51S;G52S) had a 10-fold increase
in Km for the cosubstrate. The triple
mutant, with alterations at these two positions alongside D48E
(D48E;T51S;G52C), demonstrated a Km of
almost 20-fold wild type. Lastly, K47Q;D48E demonstrated a 30-fold
increase in Km for
CH2H4-folate (Table 2)
.
Kinetic inhibition studies confirmed the E. coli genetic selection studies in that all of the enzymes were 5-FdUR resistant compared with the wild-type TS. In accord with the E. coli data but to a larger degree, K47Q;D48E demonstrated a 75-fold increase in Ki, and the triple mutant D48E;T51S;G52C displayed the greatest resistance with a Ki for 5-FdUMP 100-fold greater than that of the wild type. In some cases, Ki has been shown to not fully correlate with IC50 (5, 6) . However, as our enzymes have been selected in a biological system, we expect the observed survival advantage to extend to mammalian cells. Work is currently underway to determine survival in a mammalian system.
For many years, the only known drug-resistant human TS enzyme was the mutant Y33H, discussed previously (20) . In the last 2 years, other drug-resistant TSs that contain amino acid substitutions in many different regions of the protein have been identified. We have previously identified several 5-FdUR-resistant TSs by creating random substitutions in a stretch of 13 residues near the active site (7, 8) . By subjecting highly conserved residues important in cofactor binding to site-directed mutagenesis, I108A was found to be resistant to the antifolates Raltitrexed (Tomudex; ZD1694) and Thymitaq, and F225W was found resistant to the antifolate BW1843U89 and 5-FdUR (6) . Recently, a cell line adapted to increasing concentrations of 5-FdUR was determined to encode a P303L mutant that, although metabolically unstable, was nonetheless able to confer resistance to transfected cells against FdUR, Raltitrexed, Thymitaq, and BW1843U89 (9) .
Studies that used EMS mutagenesis followed by selection in human HT1080 cells with the antifolate Thymitaq have identified three mutants that demonstrate resistance to Thymitaq and 5-FdUR (5) . All three of these identified mutants contain substitutions in the essential and conserved Arg50-loop. These mutants, all of which harbor a single amino acid alteration (K47E, D49G, or G52S), confer a high degree of drug resistance to mammalian cells in culture (5) . The mutant G52S conferred almost a 100-fold increase in IC50 against 5-FdUR, whereas D49G demonstrated a 40-fold increase in IC50 for Thymitaq while still retaining resistance to 5-FdUR. Inhibition studies with 5-FdUMP and three antifolate inhibitors indicated that D49G and G52S demonstrated an increase in the Ki for FdUMP of 5.4- and 20-fold, respectively, while retaining a Ki for Thymitaq approximately 6-fold that of wild type. Interestingly, despite a 5-fold increase in IC50 for Thymitaq and 5-FdUR, K47E did not demonstrate variant kinetics for any of the inhibitors tested (5) .
Because EMS mutagenesis is statistically unlikely to test synergistic effects of multiple mutations in one polypeptide or to allow multiple nucleotide substitutions within a particular codon, we view the mutants identified by Tong et al. (5) as prototype, or first-generation, drug-resistant TSs that can guide the discovery of mutants with yet greater resistance. Because 5-FdUMP is structurally similar to the natural substrate dUMP, it is difficult to predict how single amino acid substitutions or multiple substitutions could restrict the binding of 5-FdUMP without affecting binding of dUMP. Random oligonucleotide mutagenesis provides a combinatorial alternative that can examine a large amount of sequence space and create altered enzymes without requiring detailed knowledge about amino acid interactions or effects of specific alterations. Reselection of the single mutants discovered by Tong et al. (Ref. 5 ; G52S and K47E) demonstrates the validity of our E. coli assay in several ways. Firstly, this rapid E. coli assay was effective in identifying previously detected 5-FdUR-resistant TSs among an extremely large plasmid library. Secondly, the types of alterations seen as a whole in the resistant mutants appear to mimic those seen via selection in human cells. The fact that the identical mutants (G52S, K47E) could be selected via either 5-FdUR or a folate-based inhibitor (Thymitaq) can be explained likely by the central role of the Arg50-loop in coordination with both of the corresponding substrates.
The decrease in affinity to 5-FdUMP in mutants with near normal catalytic activity suggests these mutants may be suitable for use as drug-resistant genes in gene therapy applications. Although effective, the use of 5-FU as a chemotherapeutic agent has been limited by toxicity to bone marrow, gastrointestinal, and other tissues (28) . The introduction and expression of mutants of human TS that can function in the presence of systemic 5-FU chemotherapeutic treatment could protect normal cells from cytotoxicity or allow augmentation of the maximally tolerated dose of 5-FU. Additionally, a better understanding of the interactions of thymidylate synthase with 5-FdUMP will be useful in the targeted drug design of more clinically effective pyrimidine or antifolate inhibitors.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by Grants from the NIH (Grant CA78885;
to L. A. L. and D. M. L.) and the Medical Scientist Training
Program (NIH National Institution of General Medical Sciences Grant 5
T32 07266; to D. M. L.) and the Cora May Poncin Scholarship Fund (to
D. M. L.). ![]()
2 To whom requests for reprints should be
addressed, at University of Washington, School of Medicine, K-072 HSB,
Department of Pathology, Box 357705, Seattle, Washington 98195-7705.
Phone: (206) 543-6015; Fax: (206) 543-3967; E-mail: laloeb{at}u.washington.edu ![]()
3 The abbreviations used are: TS, human
thymidylate synthase; 5-FdUR, 5-fluoro-2'-deoxyuridine; FdUMP,
5-fluoro-2'-deoxyuridine 5'-monophosphate;
CH2H4-folate,
(6R,S)-N5,N10-methylene-5,6,7,8-tetrahydrofolate;
EMS, ethyl methanesulfonate; 5-FU, 5-fluorouracil. ![]()
Received 1/17/00. Accepted 11/13/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. M. Fontes, B. M. Davis, L. P. Encell, K. Lingas, D. T. Covas, M. A. Zago, L. A. Loeb, A. E. Pegg, and S. L. Gerson Differential competitive resistance to methylating versus chloroethylating agents among five O6-alkylguanine DNA alkyltransferases in human hematopoietic cells Mol. Cancer Ther., January 1, 2006; 5(1): 121 - 128. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawate, D. M. Landis, and L. A. Loeb Distribution of Mutations in Human Thymidylate Synthase Yielding Resistance to 5-Fluorodeoxyuridine J. Biol. Chem., September 20, 2002; 277(39): 36304 - 36311. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gaspar, E. De Clercq, and J. Neyts Human Herpesvirus 8 Gene Encodes a Functional Thymidylate Synthase J. Virol., September 11, 2002; 76(20): 10530 - 10532. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |