Cancer Research Cancer Health Disparities Conference 2009  SU2C
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pollack, I. F.
Right arrow Articles by Sposto, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pollack, I. F.
Right arrow Articles by Sposto, R.
[Cancer Research 61, 7404-7407, October 15, 2001]
© 2001 American Association for Cancer Research


Advances in Brief

Age and TP53 Mutation Frequency in Childhood Malignant Gliomas

Results in a Multi-institutional Cohort1

Ian F. Pollack2, Sydney D. Finkelstein, Judith Burnham, Emiko J. Holmes, Ronald L. Hamilton, Allan J. Yates, Jonathan L. Finlay, Richard Sposto and for the Children’s Cancer Group

Departments of Neurosurgery [I. F. P.] and Pathology [S. D. F., J. B., R. L. H.], University of Pittsburgh Medical Center and the Children’s Hospital of Pittsburgh, Pittsburgh, Pennsylvania 15213; Ohio State University, Columbus, Ohio 43210 [A. J. Y.]; Department of Pediatrics, New York University Medical Center, New York, New York 10016 [J. L. F.]; Children’s Oncology Group, Arcadia, California 91006 [E. J. H.]; and Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California 90033 [R. S.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Patients and Methods
 Results
 Discussion
 REFERENCES
 
Malignant astrocytoma is one of the most deadly primary central nervous system tumors. Although significant progress has been made in understanding the molecular pathways that lead to the development of these tumors in adults, comparatively little analysis has been done in childhood astrocytomas, which are less common and have a more favorable prognosis. Our previous studies of an institutional cohort of children with malignant gliomas suggested the existence of distinct molecular pathways of tumorigenesis in younger versus older children, based on the finding of a high frequency of TP53 mutations in tumors from children >3 years of age at diagnosis, compared with those from younger children. In the current study, the association between TP53 mutations and age was examined in greater detail using the multi-institutional group of children enrolled in Children’s Cancer Group Study 945, the largest cohort of childhood high-grade gliomas analyzed to date. Seventy-seven tumors with centrally reviewed diagnoses of anaplastic astrocytoma or glioblastoma multiforme had sufficient archival histopathological material for microdissection-based genotyping. Sections were examined histologically, and topographic targets that contained malignant tissue were isolated by microdissection and subjected to PCR-based amplification and sequencing of TP53 exons 5–8. Twenty-six tumors (33.8%) had mutations in those exons. Mutations were observed in 2 of 17 tumors (11.8%) from children <3 years of age at diagnosis versus 24 of 60 tumors (40%) from older children, a difference that was statistically significant (P = 0.04), in agreement with our previous results. Whereas malignant gliomas in older children have a frequency of mutations comparable to tumors that arise in young adults, those from children <3 years old do not. The association between age and frequency of TP53 mutations among pediatric malignant gliomas indicates the probable existence of two distinct pathways of molecular tumorigenesis in younger versus older children.


    Introduction
 Top
 ABSTRACT
 Introduction
 Patients and Methods
 Results
 Discussion
 REFERENCES
 
High-grade astrocytomas are the most common primary central nervous system tumors in adults, but they are less common in children (1 , 2) . Although they generally respond poorly to conventional therapy with surgery, radiotherapy, and chemotherapy, numerous studies have indicated that malignant gliomas in children and young adults, as a group, have a better prognosis than those that occur in older patients and that young patients account for a disproportionate percentage of long-term survivors (3, 4, 5, 6, 7) . Although this observation implies age-related differences in tumor biology or host-tumor interactions (8) , a systematic comparison of pediatric and adult malignant gliomas on a molecular rather than histological basis has yet to be done.

In that context, it has been recognized for some time that malignant gliomas in adults can arise by at least two distinct molecular pathways. One group includes the so-called primary or de novo tumors, which are histologically malignant at diagnosis and characteristically manifest in older adult patients. These lesions commonly exhibit amplification of EGFR (9, 10, 11, 12, 13, 14) . A second group includes the so-called secondary gliomas, which generally occur in adults <40 years of age, evolving in some cases from previously detected lower-grade gliomas and therefore with longer overall natural histories than the primary tumors. These lesions have a high frequency of TP53 mutations but a relatively low frequency of EGFR amplification (9, 10, 11, 12, 13, 14) . Apart from those differences, both groups of tumors share many common genetic alterations, including frequent abnormalities in genes that control G1-S cell cycle progression, such as mutation or homozygous deletion of RB1, CDKN2A, or CDKN2B or amplification of CDK4 (15) , and a high frequency of deletions involving chromosome 10 (16, 17, 18, 19) , in many cases incorporating the PTEN/MMAC1 locus (17 , 20, 21, 22) .

Compared with the extensive work that has been done to characterize the molecular features of adult high-grade gliomas (9 , 13 , 15 , 22) , relatively little data have been collected on pediatric tumors, in part reflecting the fact that these lesions are less common. However, institutional pilot studies from our group (23 , 24) and others (25, 26, 27) have suggested that de novo pediatric malignant gliomas rarely show amplification of the EGFR gene and more commonly exhibit mutations of the TP53 gene, similar to secondary gliomas in young adults. Because these studies have all incorporated relatively small cohorts of patients, it has been difficult to evaluate the potential existence of distinct pathways of tumorigenesis among pediatric malignant gliomas. In support of this possibility, our previous studies noted that TP53 mutations were distinctly less common in tumors from children diagnosed before 3 years of age than in older children (24) , raising the possibility that malignant gliomas in young children may arise from molecular pathways distinct from those in older children.

To address this issue in greater detail, we initiated a more extensive analysis of the molecular features of pediatric high-grade gliomas by incorporating the multi-institutional cohort of children of CCG3 study CCG-945, the largest group of pediatric high-grade gliomas accrued to date (28) . The availability of centralized neuropathological review, coupled with the large size of cohort available for correlative biological analysis, provided a unique opportunity to address issues of molecular etiology. The results reported here indicate that malignant gliomas in young children show a significantly lower frequency of TP53 mutations than those in older children, confirming the existence of at least two distinct pathways of tumorigenesis among pediatric malignant gliomas, a finding that may have important therapeutic implications.


    Patients and Methods
 Top
 ABSTRACT
 Introduction
 Patients and Methods
 Results
 Discussion
 REFERENCES
 
Patient Population.
The cohort examined in these studies consisted of the patients included in the CCG non-brainstem high-grade glioma study, CCG-945 (28) , who had centrally reviewed diagnoses of AA or GBM. Patients were treated with a combination of surgery, radiotherapy (5400 cGy in 180-cGy fractions), and chemotherapy with adjuvant prednisone, lomustine, and vincristine, or the "8-drugs-in-1-day" (eight-in-one) regimen administered for two cycles before irradiation and continued after irradiation. Patients younger than 24 or 36 months, depending on the year of study entry, and those with spinal cord malignant gliomas were nonrandomly assigned to receive the eight-in-one regimen, whereas older children with intracranial high-grade gliomas were randomly assigned between the eight-in-one and prednisone, lomustine, and vincristine regimens (29 , 30) . In all patients, histological and clinical factors were monitored rigorously, and long-term follow-up was achieved. No significant difference in survival was noted between the two treatment arms (28) .

Tissue accrual for the current study was initiated by the Pediatric Branch of the Cooperative Human Tissue Network in the context of a CCG-endorsed biopathology study, CCG-B975, also approved by the Children’s Hospital of Pittsburgh Human Rights Committee. The original clinical cohort included a sizeable subgroup of tumors that were later found to be ineligible (e.g., atypical low-grade gliomas) on central review (28) . Therefore, the current molecular analysis was restricted to tumors in which the neuropathologist who performed central review for the CCG-945 clinical study (A. J. Y.) confirmed diagnoses of AA or GBM in a recent blinded re-review, using contemporary WHO criteria (31) , and in which sufficient histopathological material was available from the tumor specimen for microdissection-based genotyping. After prescreening, 77 specimens were eligible for inclusion in the studies reported here.

TP53 Mutation Analysis.
Paraffin-embedded specimens were used for all aspects of the analysis. Samples were provided in a coded format to "blind" investigators to clinical, histological, and outcome results. Tumor slides were reviewed, and blocks that contained malignant glioma were sectioned at a thickness of 4 µm. Sections were stained with H&E to confirm that characteristic tissue had been obtained. Adjacent sections were subjected to genotyping analyses. For assessment of TP53 mutations, exons 5–8 were specifically examined because those regions encompass most TP53 mutations that have been detected in astrocytic (32) and nonastrocytic (33) tumors.

Tissue targets from regions of highest anaplasia were removed directly from the tumor sections, using microdissection-based techniques as described previously (24 , 34, 35, 36) . For larger targets, manual microdissection was performed under stereomicroscopic viewing, whereas laser capture microdissection (PixCell II; Arcturus) was used for smaller targets. Microdissected tissue was collected in 100 µl of dilute Tris buffer with 1% SDS. After phenol/chloroform extraction, sample DNA was precipitated with 100% ethanol, washed in 70% ethanol, resuspended in Tris buffer, and stored at -20°C for subsequent nucleic acid amplification.

Individual exons were amplified independently using the following primer pairs: (a) exon 5, (sense) GCAGTACTCCCCTGCCTCAA and (antisense) GCCCCAGCTGCTCACCATCGC; (b) exon 6, (sense) GGGTCCCCAGGCCTCTGATT and (antisense) CCTCCCAGAGACCCCAGTT; (c) exon 7, (sense) CTTGCCACAGGTCTCCCCAAG and (antisense) GCAGGCCAGTGTGCAGGGTGG; and (d) exon 8, (sense) TTTTCCTATCCTGAGTAGTGG; and (antisense) GGTCTCCTCCACCGCTTCTTG as reported previously (24 , 36) . PCR products were then isolated and directly sequenced by dideoxy chain termination using S-35 dATP (Sequenase; United States Biochemical Corp., Cleveland, OH) as described previously (24 , 36) , using the above-mentioned primers. Sequences were read from overnight-exposed autoradiograms of 6% polyacrylamide gels.

Statistical Analysis.
To assess the association between TP53 mutations and both patient age and tumor histology in the current study, mutation status and clinical and histological information were provided in a blinded fashion. Association between each of these parameters was assessed using Fisher’s exact test.


    Results
 Top
 ABSTRACT
 Introduction
 Patients and Methods
 Results
 Discussion
 REFERENCES
 
Patient Characteristics.
Seventy-seven patients were identified with non-brain stem malignant gliomas that met the criteria for the current study. Thirty-five tumors had review diagnoses of AA, and 42 tumors had review diagnoses of GBM. Seventeen patients were <3 years of age at diagnosis, and 60 patients ranged in age from 3–18 years. Five-year event-free survival in the group of 77 review-confirmed malignant gliomas (16.9 ± 4.3%) was comparable with that of the group of 71 tumors with eligible histologies in which adequate tissue was not available for TP53 genotyping (19.7 ± 4.7%; P = 0.31, log-rank test).

TP53 Mutation Analysis.
Table 1Citation summarizes data on TP53 mutations, age, and tumor histologies of the 77 eligible patients. In the overall group, 26 tumors (33.8%) had mutations within TP53 exons 5–8. A significant difference was apparent in the frequency of mutations in tumors from children <3 years of age at diagnosis (2 of 17 tumors, 11.8%) versus that in children between 3 and 18 years old (24 of 60 tumors, 40%; P = 0.04). Among the latter group, the frequency of mutations did not vary significantly in different age subgroups. There were mutations in 12 of 27 tumors (44.4%) from children diagnosed between 3 and 10 years old versus 12 of 33 tumors (36.4%) from children between 10 and 18 years old at diagnosis.


View this table:
[in this window]
[in a new window]

 
Table 1 Histopathological and clinical characteristics of 26 pediatric high-grade gliomas with TP53 mutations

 
Although there was a trend between frequency of mutations and increasing histopathological grade, it did not reach statistical significance. Mutations were observed in 9 of 35 tumors (25.7%) classified as AA (grade III astrocytoma) versus 17 of 42 (40.4%) tumors classified as GBM (grade IV astrocytoma; P = 0.23). Differences in distribution of tumor histology in younger and older age groups did not account for age-related differences in the frequency of TP53 mutations. Mutations were observed in 1 of 10 (10%) AAs from children <3 years of age at diagnosis versus 8 of 25 (32.0%) AAs from older children. Mutations were observed in only 1 of 7 (14.3%) GBMs of children <3 years of age versus 16 of 35 (45.7%) GBMs in older children.


    Discussion
 Top
 ABSTRACT
 Introduction
 Patients and Methods
 Results
 Discussion
 REFERENCES
 
Although initial studies that involved childhood malignant gliomas suggested that these tumors rarely exhibited TP53 mutations (37, 38, 39) , recent reports, which have incorporated more rigorous histological criteria, have suggested that a subgroup of AAs and glioblastomas of childhood exhibits such mutations (24, 25, 26, 27) . The importance of this observation is that tumors with TP53 mutations may be resistant to p53-dependent apoptotic pathways, which help mediate the cytotoxic effects of conventional chemotherapy and radiotherapy (40, 41, 42, 43) . In other tumor types, lesions with intact p53 pathways have been observed to be more susceptible to the therapeutic effects of those modalities than lesions with p53 mutations (45, 46, 47, 48) . In preclinical models that involved tumors with mutated TP53, transfer of wild-type TP53 constructs enhanced therapeutic responsiveness (48, 49, 50) .

In view of the influence of tumor TP53 mutation status on responsiveness to adjuvant therapies, the present study yielded several potentially important observations. First, the frequency of TP53 mutations in this centrally reviewed multi-institutional series of pediatric malignant gliomas (26 of 77 tumors, 33.8%) was greater than that seen in previous childhood studies (37, 38, 39) and similar to frequencies observed in secondary malignant gliomas typical in young adults (14 , 15 , 38) . Both groups of tumors commonly exhibit TP53 mutations but rarely show EGFR amplification (23 , 26) , unlike de novo malignant gliomas that generally occur in older adults (9 , 13 , 20 , 22) , which suggests that the biological behavior and molecular pathogenesis of most primary childhood high-grade gliomas may be more similar to those in young adults than those in older adults. The greater incidence of TP53 mutations in the current study compared with earlier reports (37, 38, 39) may largely reflect that previous studies of childhood gliomas likely included significant percentages of atypical pilocytic or other unusual low-grade astrocytoma variants, such as pleomorphic xanthoastrocytoma, which can exhibit some features of malignant gliomas and present a diagnostic challenge. These lesions are clearly distinguished from truly high-grade (i.e., grade III or IV) gliomas in contemporary classification schemes (31) . In contrast, our previous institutional pilot study, which included only high-grade gliomas in which the diagnosis was confirmed by central review of the histopathological material, noted a frequency of TP53 mutations comparable with the current series (24) .

Second, the observation that a substantial percentage of malignant gliomas from children >3 years of age at diagnosis had TP53 mutations but that such mutations were rare in tumors from younger children suggests that infant malignant gliomas may differ on a biological and molecular pathogenetic basis from similar lesions in older children. Although it was not possible to assess age-related differences in treatment response in the current cohort because young children were treated differently than older children [in many cases, younger children did not receive radiotherapy after eight-in-one chemotherapy (28 , 51) ], more recent clinical studies suggest that infant malignant gliomas may be more likely to respond favorably to therapy than histologically similar lesions in older patients. For example, regimens that incorporate intensive chemotherapy in an effort to delay radiotherapy and thereby minimize the severity of radiation-related cognitive deterioration have achieved objective response rates of more than 50% and 5-year survival rates of up to 50% in infants with malignant gliomas (52 , 53) , often without irradiation. These observations contrast with the generally discouraging results that have been obtained in older patients, despite the use of irradiation and either before or after irradiation chemotherapy (28 , 29) .


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by a grant from the Copeland Fund of the Pittsburgh Foundation (to I. F. P.) and NIH Grants NS01810 and NS37704 (to I. F. P.) and CA13539 to the Children’s Cancer Group. Back

2 To whom requests for reprints should be addressed, at Children’s Oncology Group, P. O. Box 60012, Arcadia, CA 91066-6012. Phone: (626) 447-0064, ext. 122; Fax: (626) 445-4334; E-mail: Pollaci{at}chplink.chp.edu Back

3 The abbreviations used are: CCG, Children’s Cancer Group; AA, anaplastic astrocytoma; GBM, glioblastoma multiforme. Back

Received 7/26/01. Accepted 8/27/01.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Patients and Methods
 Results
 Discussion
 REFERENCES
 

  1. Pollack I. F. Current concepts: brain tumors in children. N. Engl. J. Med., 331: 1500-1507, 1994.[Free Full Text]
  2. Young J. L., Miller R. W. Incidence of malignant tumors in U.S. children. J. Pediatr., 86: 254-258, 1975.[Medline]
  3. Devaux B. C., O’Fallon J. R., Kelly P. J. Resection, biopsy, and survival in malignant glial neoplasms. A retrospective study of clinical parameters, therapy, and outcome. J. Neurosurg., 78: 767-775, 1993.[Medline]
  4. Nazzaro J. M., Neuwelt E. A. The role of surgery in the management of supratentorial intermediate and high-grade astrocytomas in adults. J. Neurosurg., 73: 331-344, 1990.[Medline]
  5. Chandler K. L., Prados M. D., Malec M., Wilson C. B. Long-term survival in patients with glioblastoma multiforme. Neurosurgery, 32: 716-720, 1993.[Medline]
  6. Salcman M., Scholtz H., Kaplan R. S., Kulik S. Long-term survival in patients with malignant astrocytoma. Neurosurgery, 34: 213-220, 1994.[Medline]
  7. Salford L. G., Brun A., Nirfalk S. Ten-year survival among patients with supratentorial astrocytoma grade III and IV. J. Neurosurg., 69: 506-509, 1988.[Medline]
  8. Campbell J. W., Pollack I. F., Martinez A. J., Shultz B. L. High-grade astrocytomas in children: radiologically complete resection is associated with an excellent long-term prognosis. Neurosurgery, 38: 258-264, 1996.[Medline]
  9. Louis D. N. A molecular genetic model of astrocytoma histopathology. Brain Pathol., 7: 755-764, 1997.[Medline]
  10. He J., Olson J. J., James C. D. Lack of p16INK4 or retinoblastoma protein (pRb) or amplification-associated overexpression of cdk4 is observed in distinct subsets of malignant glial tumors and cell lines. Cancer Res., 55: 4833-4836, 1995.[Abstract/Free Full Text]
  11. von Deimling A., von Ammon K., Schoenfeld D., Weistler O. D., Seizinger B. R., Louis D. N. Subsets of glioblastoma multiforme defined by molecular genetic analysis. Brain Pathol., 3: 19-26, 1993.[Medline]
  12. Lang F. F., Miller D. C., Koslow M., Newcomb E. W. Pathways leading to glioblastoma multiforme: a molecular analysis of genetic alterations in 65 astrocytic tumors. J. Neurosurg., 81: 427-436, 1994.[Medline]
  13. Galanis E., Buckner J., Kimmel D., Jenkins R., Alderete B., O’Fallon J., Wang C. H., Scheithauer B. W., James C. D. Gene amplification as a prognostic factor in primary and secondary high-grade malignant gliomas. Int. J. Oncol., 13: 717-724, 1998.[Medline]
  14. Watanabe K., Tachibana O., Sata K., Yonekawa Y., Kleihues P., Ohgaki H. Overexpression of the EGF receptor and p53 mutations are mutually exclusive in the evolution of primary and secondary glioblastomas. Brain Pathol., 6: 217-224, 1996.[Medline]
  15. Ichimura K., Bolin M. B., Goike H. M., Schmidt E. E., Moshref A., Collins V. P. Deregulation of the p14ARF/MDM2/p53 pathway is a prerequisite for human astrocytic gliomas with G1-S transition control gene abnormalities. Cancer Res., 60: 417-424, 2000.[Abstract/Free Full Text]
  16. James C. D., Carlbom E., Dumanski J. P., Hansen M., Nordenskjold M., Collins V. P., Cavenee W. K. Clonal genomic alterations in glioma malignancy stages. Cancer Res., 48: 5546-5551, 1988.[Abstract/Free Full Text]
  17. Ichimura K., Schmidt E. E., Miyakawa A., Goike H. M., Collins V. P. Distinct patterns of deletion on 10p and 10q suggest involvement of multiple tumor suppressor genes in the development of astrocytic gliomas of different malignancy grades. Genes Chromosomes Cancer, 22: 9-15, 1998.[Medline]
  18. Fults D., Pedone C. Deletion mapping of the long arm of chromosome 10 in glioblastoma multiforme. Genes Chromosomes Cancer, 7: 173-177, 1993.[Medline]
  19. Rasheed B. K., McLendon R. E., Friedman H. S., Friedman A. H., Fuchs H. E., Bigner D. D., Bigner S. H. Chromosome 10 deletion mapping in human gliomas: a common deletion region in 10q25. Oncogene, 10: 2243-2246, 1995.[Medline]
  20. Liu W., James C. D., Frederick L., Alderete B. E., Jenkins R. B. PTEN/MMAC1 mutations and EGFR amplification in glioblastomas. Cancer Res., 57: 5254-5257, 1997.[Abstract/Free Full Text]
  21. Li J., Yen C., Liaw D., Podsypanina K., Bose S., Wang S. I., Puc J., Miliaresis C., Rodgers L., McCombie R., Bigner S. H., Giovanella B. C., Ittmann M., Tycko B., Hibshoosh H., Wigler M. H., Parsons R. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science (Wash. DC), 275: 1943-1947, 1997.[Abstract/Free Full Text]
  22. Collins V. P. Progression as exemplified by human astrocytic tumors. Cancer Biol., 9: 267-276, 1999.
  23. Bredel M., Pollack I. F., Hamilton R. L., James C. D. Epidermal growth factor receptor (EGFR) expression in high-grade non-brainstem gliomas of childhood. Clin. Cancer Res., 5: 1786-1792, 1999.[Abstract/Free Full Text]
  24. Pollack I. F., Hamilton R. L., Finkelstein S. D., Campbell J. W., Martinez A. J., Sherwin R. N., Bozik M. E., Gollin S. M. The relationship between TP53 mutations and overexpression of p53 and prognosis in malignant gliomas of childhood. Cancer Res., 57: 304-309, 1997.[Abstract/Free Full Text]
  25. Raffel C., Frederick L., O’Fallon J. R., Atherton-Skaff P., Perry A., Jenkins R. B., James C. D. Analysis of oncogene and tumor suppressor gene alterations in pediatric malignant astrocytomas reveals reduced survival for patients with PTEN mutations. Clin. Cancer Res., 5: 4085-4090, 1999.[Abstract/Free Full Text]
  26. Sung T., Miller D. C., Hayes R. L., Alonso M., Yee H., Newcomb E. W. Preferential inactivation of the p53 tumor suppressor pathway and lack of EGFR amplification distinguish de novo high grade pediatric astrocytomas from de novo adult astrocytomas. Brain Pathol., 10: 249-259, 2000.[Medline]
  27. Sure U., Ruedi D., Tachibana O., Yonekawa Y., Ohgaki H., Kleihues P., Hegi M. E. Determination of p53 mutations, EGFR overexpression, and loss of p16 expression in pediatric glioblastomas. J. Neuropathol. Exp. Neurol., 56: 782-789, 1997.[Medline]
  28. Finlay J. L., Boyett J. M., Yates A. J., Wisoff J. H., Milstein J. M., Geyer J. R., Bertolone S. J., McGuire P., Cherlow J. M., Tefft M., Turski P. A., Wara W. M., Edwards M., Sutton L. N., Berger M. S., Epstein F., Ayers G., Allen J. C., Packer R. J. Randomized Phase III trial in childhood high-grade astrocytoma comparing vincristine, lomustine, and prednisone with the eight-drugs-in-1-day regimen. J. Clin. Oncol., 13: 112-123, 1995.[Abstract/Free Full Text]
  29. Sposto R., Ertel I. J., Jenkin R. D. T., Boesel C. P., Venes J. L., Ortega J. A., Evans A. E., Wara W., Hammond D. The effectiveness of chemotherapy for treatment of high grade astrocytoma in children: results of a randomized trial. A report from the Children’s Cancer Study Group. J. Neurooncol., 7: 165-177, 1989.[Medline]
  30. Pendergrass T. W., Milstein J. M., Geyer J. R., Mulne A. F., Kosnik E. J., Morris J. D., Heideman R. L., Ruymann F. B., Stuntz J. T., Bleyer W. A. Eight drugs in one day chemotherapy for brain tumors: experience in 107 children and rationale for preradiation chemotherapy. J. Clin. Oncol., 5: 1221-1231, 1987.[Abstract/Free Full Text]
  31. Kleihues P., Burger P. C., Scheithauer B. W. Histological typing of tumours of the central nervous system Sobin L. H. eds. . International Histological Classification of Tumours, Vol. 21: 11-16, Springer-Verlag Geneva 1993.
  32. Fults D., Brockmeyer D., Tullous M. W., Pedone C. A., Cawthon R. M. p53 mutation and loss of heterozygosity on chromosome 17 and 10 during astrocytoma progression. Cancer Res., 52: 674-679, 1992.[Abstract/Free Full Text]
  33. Hollstein M., Sidransky D., Vogelstein B., Harris C. C. p53 mutations in human cancers. Science (Wash. DC), 253: 49-53, 1991.[Abstract/Free Full Text]
  34. Wu T.-T., Barnes L., Bakker A., Swalsky P. A., Finkelstein S. D. K-ras-2 and p53 genotyping of intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Mod. Pathol., 9: 199-204, 1996.[Medline]
  35. Kim S. H., Godfrey T., Jensen R. H. Whole genome amplification and molecular genetic analysis of DNA from paraffin-embedded prostate adenocarcinoma tumor tissue. J. Urol., 162: 1512-1518, 1999.[Medline]
  36. Finkelstein S. D., Sayegh R., Christensen S., Swalsky P. A. Genotypic classification of colorectal adenocarcinoma. Biologic behavior correlates with K-ras-2 mutation type. Cancer (Phila.), 71: 3827-3838, 1993.[Medline]
  37. Litofsky N. S., Hinton D., Raffel C. The lack of a role for p53 in astrocytomas in pediatric patients. Neurosurgery, 34: 967-973, 1994.[Medline]
  38. Rasheed B. K. A., McLendon R. E., Herndon R. E., Friedman H. S., Friedman A. H., Bigner D. D., Bigner S. H. Alterations of the TP53 gene in human gliomas. Cancer Res., 54: 1324-1330, 1994.[Abstract/Free Full Text]
  39. Lang F. F., Miller D. C., Pisharody S., Koslow M., Newcomb E. W. High frequency of p53 protein accumulation without p53 gene mutation in human juvenile pilocytic, low grade and anaplastic astrocytomas. Oncogene, 9: 949-954, 1994.[Medline]
  40. Kerr J. F. R., Winterford C. M., Harmon B. V. Apoptosis: its significance in cancer and cancer therapy. Cancer (Phila.), 73: 2013-2026, 1994.[Medline]
  41. Lowe S. W., Ruley H. E., Jacks T., Housman D. E. p53-dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell, 74: 957-967, 1993.[Medline]
  42. Kinzler K. W., Vogelstein B. Cancer therapy meets p53. N. Engl. J. Med., 331: 49-50, 1994.[Free Full Text]
  43. Lowe S. W., Bodis S., McClatchey A., Remington L., Ruley H. E., Fisher D. E., Housman D. E., Jacks T. p53 status and the efficacy of cancer therapy in vivo. Science (Wash. DC), 266: 807-810, 1994.[Abstract/Free Full Text]
  44. Rusch V., Klimstra D., Venkatraman E., Oliver J., Martini N., Gralla R., Kris M., Dmitrovsky E. Aberrant p53 expression predicts clinical resistance to cisplatin-based chemotherapy in locally advanced non-small cell lung cancer. Cancer Res., 55: 5038-5042, 1995.[Abstract/Free Full Text]
  45. Esrig D., Elmajian D., Groshen S., Freeman J. A., Stein J. P., Chen S.-C., Nichols P. W., Skinner D. G., Jones P. A., Cote R. J. Accumulation of nuclear p53 and tumor progression in bladder cancer. N. Engl. J. Med., 331: 1259-1264, 1994.[Abstract/Free Full Text]
  46. Harris C. C., Hollstein M. Clinical implications of the p53 tumor-suppressor gene. N. Engl. J. Med., 329: 1318-1327, 1993.[Free Full Text]
  47. Goh H-S., Yao J., Smith D. R. p53 point mutation and survival in colorectal cancer patients. Cancer Res., 55: 5217-5221, 1995.[Abstract/Free Full Text]
  48. Lang F. F., Yung W. K. A., Sawaya R., Tofilon P. J. Adenovirus-mediated p53 gene therapy for human gliomas. Neurosurgery, 45: 1093-1104, 1999.[Medline]
  49. Shaw P., Bovey R., Tardy S., Sahli R., Sordat B., Costa J. Induction of apoptosis by wild-type p53 in a human colon tumor-derived cell line. Proc. Natl. Acad. Sci. USA, 89: 4495-4499, 1992.[Abstract/Free Full Text]
  50. Fujiwara T., Grimm E. A., Mukhopadhyay T., Zhang W.-W., Owen-Schaub L. B., Roth J. A. Induction of chemosensitivity in human lung cancer cells in vivo by adenovirus-mediated transfer of the wild-type p53 gene. Cancer Res., 54: 2287-2291, 1994.[Abstract/Free Full Text]
  51. Geyer J. R., Finlay J. L., Boyett J. M., Wisoff J. W., Yates A., Mao L., Packer R. J. Survival of infants with malignant astrocytomas: a report from the Children’s Cancer Group. Cancer (Phila.), 75: 1045-1050, 1995.[Medline]
  52. Duffner P. K., Krischer J. P., Burger P. C., Cohen M. E., Backstrom J. W., Horowitz M. E., Sanford R. A., Friedman H. S., Kun L. E. Treatment of infants with malignant gliomas: the Pediatric Oncology Group experience. J. Neurooncol., 28: 245-256, 1996.[Medline]
  53. Mason W. P., Grovas A., Halpern S., Dunkel I. J., Garvin J., Heller G., Rosenblum M., Gardner S., Lyden D., Sands S., Puccetti D., Lindsley K., Merchant T. E., O’Malley B., Bayer L., Petriccione M. M., Allen J., Finlay J. L. Intensive chemotherapy and bone marrow rescue for young children with newly diagnosed malignant brain tumors. J. Clin. Oncol., 16: 210-221, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Child NeurolHome page
O. J. Becher, K. M. Peterson, S. Khatua, M. R. Santi, and T. J. MacDonald
IGFBP2 Is Overexpressed by Pediatric Malignant Astrocytomas and Induces the Repair Enzyme DNA-PK
J Child Neurol, October 1, 2008; 23(10): 1205 - 1213.
[Abstract] [PDF]


Home page
JCOHome page
D. Faury, A. Nantel, S. E. Dunn, M.-C. Guiot, T. Haque, P. Hauser, M. Garami, L. Bognar, Z. Hanzely, P. P. Liberski, et al.
Molecular Profiling Identifies Prognostic Subgroups of Pediatric Glioblastoma and Shows Increased YB-1 Expression in Tumors
J. Clin. Oncol., April 1, 2007; 25(10): 1196 - 1208.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
A. Broniscer and A. Gajjar
Supratentorial High-Grade Astrocytoma and Diffuse Brainstem Glioma: Two Challenges for the Pediatric Oncologist
Oncologist, April 1, 2004; 9(2): 197 - 206.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Khatua, K. M. Peterson, K. M. Brown, C. Lawlor, M. R. Santi, B. LaFleur, D. Dressman, D. A. Stephan, and T. J. MacDonald
Overexpression of the EGFR/FKBP12/HIF-2{alpha} Pathway Identified in Childhood Astrocytomas by Angiogenesis Gene Profiling
Cancer Res., April 15, 2003; 63(8): 1865 - 1870.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pollack, I. F.
Right arrow Articles by Sposto, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pollack, I. F.
Right arrow Articles by Sposto, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online